Removal of Microsatellite Interruptions by DNA Replication Slippage:
Phylogenetic Evidence from Drosophila
Bettina Harr, Barbara Zangerl, and Christian Schlötterer
Institut für Tierzucht und Genetik, Veterinärmedizinische Universität Wien, Austria
Microsatellites are tandem repetitions of short (1–6 bp) motifs. It is widely assumed that microsatellites degenerate
through the accumulation of base substitutions in the repeat array. Using a phylogenetic framework, we studied the
evolutionary dynamics of interruptions in three Drosophila microsatellite loci. For all three loci, we show that the
interruptions in a microsatellite can be lost, resulting in a longer uninterrupted microsatellite stretch. These results
indicate that mutations in the microsatellite array do not necessarily lead to decay but may represent only a transition
state during the evolution of a microsatellite. Most likely, this purification of interrupted microsatellites is caused
by DNA replication slippage.
Introduction
Recently, the mutational dynamics of microsatellite DNA has gained substantial attention. The widespread use of microsatellites in behavioral ecology
(Schlötterer and Pemberton 1998), population genetics
(Jarne and Lagoda 1996), and phylogenetic reconstruction (Harr et al. 1998) requires a better understanding
of microsatellite mutational processes. While singlecopy DNA evolves primarily through the accumulation
of base substitutions, the predominant mutation mechanism of microsatellites is DNA replication slippage
(Tautz and Schlötterer 1994). This mutation process is
caused by the special structure of microsatellites,
which consists of a tandem repetition of short repeat
units (1–6 bp). During DNA synthesis, the two DNA
strands can slip against each other and realign out of
register, which results in unpaired repeat loops. Most
of these loops are corrected by the mismatch repair
system, and only the small fraction which was not repaired results in gains or losses of one or more repeat
units (Eisen 1999). Experimentally determined microsatellite mutation rates range from 1026 to 1022 (Levinson and Gutman 1987; Dallas 1992; Weber and Wong
1993; Schug, Mackay, and Aquadro 1997; Wierdl,
Dominska, and Petes 1997; Schlötterer et al. 1998;
Schug et al. 1998a), which is considerably higher than
the nucleotide substitution rate.
A very useful approach to the study of microsatellite evolution is to map sequence changes in the microsatellite onto a phylogenetic tree. Because uninterrupted microsatellites are on average more polymorphic
than interrupted ones (Weber 1990; Goldstein and Clark
1995), there is a preference to select loci with an uninterrupted repeat in the focal species (Ellegren, Primmer, and Sheldon 1995). Caused by this ascertainment
bias, the generally emerging picture from cross-species
comparisons is that microsatellite loci seem to decay
with increasing phylogenetic distance through the accumulation of point mutations in the repeat array. Here,
we demonstrate that interruptions of the repeat motif can
Key words: Drosophila, microsatellite, interruption, slippage.
Address for correspondence and reprints: Christian Schlötterer,
Institut für Tierzucht und Genetik, Veterinärplatz 1, 1210 Wien, Austria. E-mail: [email protected].
Mol. Biol. Evol. 17(7):1001–1009. 2000
q 2000 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038
also be removed, thus providing a mechanism that counteracts the decay of microsatellites.
Material and Methods
Fly Stocks
Drosophila melanogaster and D. simulans flies
were taken from our laboratory collection. The remaining lines were obtained from the Bloomington Drosophila Species Stock Center and the UMEA Drosophila Stock Center.
Molecular Biology
PCR primers were designed from D. melanogaster
sequences. Identical PCR conditions were used for all
species. Primer sequences and annealing temperatures
are given in table 1.
Genomic DNA was extracted from single flies with
a high-salt method (Miller, Dykes, and Polesky 1988).
To identify homozygous individuals from D. melanogaster and D. simulans, we typed 30 individuals following standard protocols (Schlötterer 1998). A typical cycling profile consisted of 30 cycles with 50 s at 948C,
50 s at 55–578C (depending on the primer pair), and 90
s at 728C.
For DNA sequencing, 50 ml PCR reactions with
100 ng of genomic DNA, 1.5 mM MgCl2, 200 mM
dNTPs, 1 mM of each primer, and 2.5 U Taq polymerase
were gel-purified and directly sequenced in both directions using the BigDye sequencing chemistry on an ABI
377 automated sequencer. The sequences have been deposited in GenBank (accession numbers AJ246181–
AJ246213).
Data Analysis
To test for orthology, we amplified the microsatellite with an alternative set of primers and sequenced
the PCR product. In all cases, the sequences obtained
with both primer sets were identical for each species.
Sequences were aligned using CUSTAL W
(Thompson, Higgins, and Gibson 1994). A parsimony
criterion was used for the alignment of the repetitive
microsatellite structure. Considering that base substitutions in the microsatellite repeat are less frequent than
slippage mutations, the alignment of the microsatellite
1001
1002
Harr et al.
Table 1
Microsatellite Loci and Amplification Conditions
Locus
Annealing
Temperature
Length
of PCR
Product
(bp)a
DS01001 . . . .
558C
440
DS06335b . . .
578C
152
DMTOR . . . .
578C
623
a
Primer Sequence (59–39)
tcgcagcgataagttaagca
ctcccacccaaaatggaaata
gcacaatcacatcgtattcactcagccaga
attgttgttgctgcgattttcaaatcaa
tttcgggtgctgcgatgcagtc
accctgcccttttgccaacaa
PCR product size is given for the Drosophila melanogaster sequence.
region was constructed by reducing the number of base
substitutions in the repeat while allowing for indels to
account for variation in repeat number (which is generated by DNA slippage). For one locus (DMTOR), sufficient flanking sequence was available to reconstruct the
phylogeny of this locus. This alignment is available
from the authors’ webpage (http://i122server.vuwien.ac.at). The microsatellite itself (i.e., positions 51–
91 of the D. melanogaster sequence AJ246186) and additional repetitive sequences in the flanking region that
showed length variability across species (i.e., positions
247–298, 360–369, 408–416, and 468–478 of the D.
melanogaster sequence AJ246186) were excluded from
the analysis. The phylogenetic tree was obtained by applying the maximum-likelihood criterion using the Puzzle, version 4.0.1 (Strimmer and von Haeseler 1996),
software and the Tamura-Nei model for sequence evolution (Tamura and Nei 1993). The obtained phylogenetic grouping was largely consistent with another data
set based on rDNA sequences (Pélandakis and Solignac
1993). As the locus DMTOR did not amplify in the species Drosophila ananassae and Drosophila kikkawai,
we included these species in the tree according to the
rDNA phylogeny (fig. 1).
Results
PCR primer-binding sites of the loci studied were
conserved to a variable extent. While locus DS01001
amplified in the melanogaster species complex only, the
primer-binding sites of the remaining loci were conserved over a larger phylogenetic range. Locus
DS06335b amplified the most distantly related species,
including species from the montium and ananassae
subgroups.
Locus DMTOR
To determine whether an interruption of a microsatellite sequence represents an ancestral or derived
state, a reliable phylogeny is required. We used the
flanking sequence at DMTOR to reconstruct the phylogenetic grouping of the species in which DMTOR could
be amplified (fig. 1). The obtained species phylogeny of
locus DMTOR is largely consistent with a previously
published phylogeny (Pélandakis and Solignac 1993).
FIG. 1.—Maximum-likelihood tree based on the flanking sequence
of microsatellite locus DMTOR. The dashed line indicates the phylogenetic grouping of Drosophila ananassae and Drosophila kikkawai
according to the rDNA phylogeny published by Pélandakis and Solignac (1993).
The (CA)n repeat motif of locus DMTOR is conserved in the melanogaster subgroup and some more
distantly related species (fig. 2). At character 27, the
(CA)n microsatellite is interrupted by a T (fig. 2). Figure 3A shows the character evolution of this substitution. Within the melanogaster subgroup, all species except D. melanogaster harbor a T at position 27, indicating that T represents the ancestral character state.
Thus, D. melanogaster has lost the T substitution and
gained an uninterrupted stretch of microsatellite repeats. Sequencing of four D. melanogaster alleles with
different repeat numbers always revealed an uninterrupted microsatellite. Sequence analysis of Drosophila
mauritiana (N 5 4) showed that the A→G substitution
at position 37 was not fixed; two individuals did not
carry this interruption. Most likely, this is not the result
of a purification event in the microsatellite, but a recent
substitution which is specific to D. mauritiana. The microsatellite region of more distantly related species
cannot be aligned unambiguously (homologous positions could not be identified with certainty) in the microsatellite region; therefore, no statement about gain
or loss of interruptions in the microsatellite can be
made. It should be noted, however, that the most distantly related species, Drosophila eugracilis and Drosophila elegans, have a relatively long stretch of seven
or nine uninterrupted CA repeats, respectively, possibly
Microsatellite Purification
1003
FIG. 2.—Microsatellite region at locus DMTOR. Lowercase letters indicate the flanking region, and capital letters indicate the microsatellite
region. Bold letters indicate the positions of microsatellite interruptions subjected to purification events.
indicating that some mechanisms are counteracting
base substitutions in the microsatellite.
Within the takahashii subgroup, the most frequent
interruption in the microsatellite is a G. Drosophila
prostipennis had three A→G substitutions (positions 33,
35, and 39). While multiple independent transitions cannot be excluded, an alternative explanation would be the
duplication of the G substitution by DNA slippage (see
fig. 4).
well as in all members of the simulans clade, it can be
assumed that it represents the ancestral state (fig. 3B).
Hence, both individuals from Kenya have lost the interruption and restored a pure microsatellite. Uncertainty
about the ancestral character state for two additional interruptions of the microsatellite in D. simulans, D. sechellia, and D. mauritiana (positions 41 and 48; fig. 5)
precluded their further analysis.
Locus DS06335b
Locus DS01001
The microsatellite region at locus DS01001 was sequenced in the melanogaster species complex. For D.
melanogaster, 110 individuals from several natural populations were analyzed. Drosophila simulans, D. mauritiana, and Drosophila sechellia were each represented
by a single individual. In all species, the microsatellite
repeat was interrupted by the insertion of a single nucleotide at position 30 (fig. 5). In D. melanogaster, two
individuals from Kenya were identified which did not
carry this interruption. Considering that the T interruption occurs at high frequency in D. melanogaster, as
A T interruption in the microsatellite at position 22
represents the ancestral state within the melanogaster
subgroup (figs. 3C and 6). This interruption was lost in
all members of the simulans clade through a purification
event in their common ancestor. In some members of
the takahashii/suzuki subgroup, a T interruption at a
similar position could be observed. Assuming that this
interruption is homologous to the interruption at position
22, it can be regarded as ancestral. Thus, the lack of the
T interruption in Drosophila lutescens indicates a purification event in this species (fig. 3C). In D. prostipennis, the T interruption may be homologous to either po-
1004
Harr et al.
FIG. 3.—Character state evolution of interruptions in the microsatellite at loci DMTOR, DS01001, andDS06335b. A, Locus DMTOR,
character 27 in figure 2. B, Locus DS01001, character 30 in figure 5. C, Locus DS06335b, character 22 in figure 6. D, Locus DS06335b,
character 45 and 46 in figure 6.
sition 22 or position 48; therefore, the mutational history
of the microsatellite in D. prostipennis cannot be unambiguously resolved.
A second interruption in the microsatellite (an insertion of AG at positions 45 and 46) is conserved
across the melanogaster and takahashii subgroup. While
this interruption is fixed in the melanogster subgroup,
Drosophila mimetica and D. prostipennis have lost it.
Mapping this character on the phylogenetic tree (fig. 3D)
suggests that this interruption has been lost twice (in D.
FIG. 4.—Mechanistic model for the duplication of interruptions in the microsatellite DMTOR. Imperfections in the repeat array are indicated
in bold letters. A, Leading-strand slippage of one repeat unit results in two adjacent microsatellite interruptions. B, Leading-strand slippage of
two repeat units results in microsatellite interruptions that are separated by one repeat unit.
Microsatellite Purification
1005
FIG. 5.—Microsatellite region at locus DS01001. Lowercase letters indicate the flanking region, and capital letters indicate the microsatellite
region. Bold letters indicate the positions of microsatellite interruptions subjected to purification events.
mimetica and in D. prostipennis). Most important, phylogenetic analysis of the flanking sequence of microsatellite locus DS06335b resulted in the same topology for
the suzuki/takahashii group (not shown). Thus, it can be
excluded that the repeated loss of an interruption in the
microsatellite is an artifact of an inaccurate phylogenetic
assumption (i.e., that the gene tree of DMTOR differs
from the gene tree of DS06335b).
For comparison, we also included the sequences of
two more distantly related Drosophila species, D. ananassae and D. kikkawai. Drosophila kikkawai, the most
distantly related species, has a long microsatellite with
eight uninterrupted CA repeats at this locus. Interesting-
ly, only the focal species, D. melanogaster, carries a
longer uninterrupted stretch of repeats.
Discussion
Phylogenetic Reconstruction Based on Flanking
Sequence of Microsatellites
Here, we used flanking sequence of the microsatellite locus DMTOR to reconstruct the phylogeny of the
microsatellite locus. The resulting relationships were
very similar to those previously published (Pélandakis
and Solignac 1993). For comparison, we also sequenced
the flanking sequence of microsatellite locus DS06335b
FIG. 6.—Microsatellite region at locus DS06335b. Lowercase letters indicate the flanking region, and capital letters indicate the microsatellite
region. Bold letters indicate the positions of microsatellite interruptions subjected to purification events.
1006
Harr et al.
for D. lutescens, D. prostipennis, D. takahashii, and D.
eugracilis and obtained the identical branching pattern,
as shown in figure 1. Despite this overall consistency
and the high bootstrap support values, the phylogenetic
tree also shows some discrepancy with a previously published consensus tree of the melanogaster complex
(Harr et al. 1998). While D. mauritiana and D. simulans
were more closely related in the microsatellite-based
phylogeny (Harr et al. 1998), the DNA sequence–based
phylogeny shown in figure 1 grouped D. sechellia and
D. simulans together. The reason for this discrepancy is
likely to be the well-described problem that gene trees
may differ from species trees, a phenomenon that is particularly pronounced for closely related species (Pamilo
and Nei 1988).
While the obtained high bootstrap support values
may suggest that noncoding sequences, such as flanking
regions of microsatellites, are potentially useful for phylogenetic reconstruction, determination of the correct
alignment of these regions can be quite challenging.
How General Is the Phenomenon of Microsatellite
Purification?
In this study, we report evidence for microsatellite
purification at three different loci. These data were extracted from a survey of 53 microsatellites in the melanogaster group (unpublished data). In total, approximately 300 locus/species combinations were amplified
and sequenced. It is difficult to infer the frequency of
purification events from this data set without certainty
about the ancestral state of the imperfection in the microsatellite. Very often, this proof was not possible, because either the relevant species did not amplify or the
homologous positions could not be unambiguously identified, particularly for more diverged taxa. Thus, we did
not include them in this report.
Purification of imperfections in a microsatellite repeat was also described in other studies. The analysis of
a dinucleotide (DQCAR) in a phylogenetic framework
identified the loss of an interruption at the allele DQB1
* 0202 (Jin et al. 1996; Taylor, Durkin, and Breden
1999). Laken et al. (1997) described the loss of an interrupting base substitution in a mononucleotide run in
the APC (adenomatous polyposis coli) gene, which was
associated with colorectal cancer. Similarly, two reports
which studied the evolution of an interrupted microsatellite in a plasmid in yeast also identified mutational
events which restored a pure microsatellite stretch (Petes, Greenwell, and Dominska 1997; Maurer,
O’Callaghan, and Livingston 1998). Hence, purification
of an imperfect microsatellite is apparently a general
phenomenon of microsatellite DNA and needs to be
considered for the long-term evolution of microsatellite
DNA.
Mechanisms of Microsatellite Purification
Average rates of DNA slippage mutation in D. melanogaster are on the order of 1026 (Schug, Mackay,
and Aquadro 1997; Schlötterer et al. 1998), which is
FIG. 7.—Model for the purification of an interrupted microsatellite. Interruptions in the repeat array are indicated in bold.
about 100 times as frequent as base substitutions (Powell 1997) and 1,000 times as frequent as deletions (Petrov and Hartl 1998). Hence, the high frequency of DNA
slippage makes this mutation process a good candidate
for the removal of interruptions in a microsatellite array.
Purification may occur through the following mechanism: the template strand slips back before the interruption is synthesized on the new DNA strand, and the
interruption is placed upstream of the 39 end of the nascent DNA strand (fig. 7). When DNA synthesis continues on the new DNA strand, this strand loses the interruption in the microsatellite. Experimental evidence
from microsatellites with imperfections strongly suggests that microsatellite interruptions are lost by an intramolecular process, such as DNA slippage (Petes,
Greenwell, and Dominska 1997; Maurer, O’Callaghan,
and Livingston 1998). Nevertheless, the important difference between the plasmid-based studies and our observations in D. melanogaster is that the plasmids carried a large number of repeats (.25 repeats). While
large deletions are common in plasmid systems with
long microsatellites (mean deletion size of 12.8 repeats
[Petes, Greenwell, and Dominska 1997] or 51.5 repeat
units [Maurer, O’Callaghan, and Livingston 1998]), they
are not expected to be a major evolutionary factor in D.
melanogaster, because the microsatellites in this species
are, on average, shorter than the deletions observed in
the plasmid studies (Schug et al. 1998b; Bachtrog et al.
1999).
One prediction of DNA slippage as the driving
force of microsatellite purification is that duplications of
interruptions in the microsatellite structure should also
be detectable. In a larger data set (unpublished data), we
identified eight loci with putative duplications of an in-
Microsatellite Purification
terruption. One of these duplications occurred at locus
DMTOR (fig. 2), where the G interruption is duplicated
twice in D. prostipennis (see fig. 4 for a mechanistic
model). Other published data sets also indicate that interruptions in a microsatellite can be duplicated. One
particularly good example is given by the microsatellite
locus A113 in Apis melifera, where a TT insertion is
repeated up to three times (Estoup et al. 1995).
In principle, the slippage process leading to the removal of an interruption in the microsatellite repeat does
not differ from a slippage event, which merely alters the
repeat number. Comparisons of microsatellite mutation
rates for interrupted and pure microsatellites indicate
that interrupted microsatellites have a lower mutation
rate (Weber 1990; Jin et al. 1996; Petes, Greenwell, and
Dominska 1997). One possible explanation for this phenomenon is that microsatellite mutation rates are lengthdependent (Jin et al. 1996; Wierdl, Dominska, and Petes
1997; Brinkmann et al. 1998; Schlötterer et al. 1998)
and that the mutation rate increases more than would be
expected by a linear function of microsatellite length
(Wierdl, Dominska, and Petes 1997; Brinkmann et al.
1998). Because the interruption of a microsatellite is often asymmetric, the mutation generates two arrays of
different lengths. Studies of interrupted microsatellites
showed that most of the slippage events occur in the
longer stretch of the subdivided microsatellite (Loridon
et al. 1998; Schlötterer and Zangerl 1999). Thus, the
lower mutation rate of interrupted microsatellites and the
predominance of slippage mutations in its longer stretch
strongly suggest that an interruption in the microsatellite
poses a significant barrier to DNA slippage. Hence, despite the general similarity to ‘normal’ slippage events,
it can be assumed that purification events occur more
rarely than per-repeat-unit slippage events in an uninterrupted microsatellite.
Implications for the Long-Term Evolution of
Microsatellites
The simplest model of microsatellite evolution assumes that a random mutation process generates short
‘‘proto’’ microsatellites. With an increasing repeat number, the probability of a DNA slippage event increases.
Under the conservative assumption that the gain of repeat units is as likely as their loss, there is a certain
probability that DNA slippage can generate a long
stretch of microsatellite DNA. Similarly, DNA slippage
may also reduce the length to a few repeat units. Theoretical studies using general models of microsatellite
evolution indicated that the persistence time of microsatellites can be quite large (Tachida and Iizuka 1992;
Stephan and Kim 1998).
With increasing persistence times, base substitutions in the microsatellite array become an important
evolutionary factor. Provided that interruptions in a microsatellite repeat have a dramatic impact on its mutational behavior, base substitutions in a microsatellite repeat have been regarded as an essential component determining their long-term evolution. While several stud-
1007
ies have assumed that selection maintains microsatellites
below a certain size, it has recently been suggested that
base substitution in the microsatellite array would also
prevent infinite growth of microsatellites (Bell and Jurka
1997; Kruglyak et al. 1998). Hence, the length distribution of microsatellites is assumed to be an equilibrium
state affected by the combination of two mutation processes occurring at different rates: DNA slippage and
base substitutions. Even if a biased mutation model is
accepted, under which the gain of repeat units is more
likely than the loss of repeat units, computer simulations
have shown that interruptions in the microsatellite are
an effective mechanism for prevention of infinite growth
of microsatellites (Palsbøll, Bérubé, and Jørgensen
1999).
Under the models used by Bell and Jurka (1997),
Kruglyak et al. (1998), and Palsbøll, Bérubé, and
Jørgensen (1999), interruptions in the microsatellite
can be lost by back mutations only. Provided that the
rate of base substitutions or non-DNA slippage-based
indels is much lower than DNA slippage rates, interruptions of a microsatellite are effectively unidirectional if slippage-based removal of microsatellite interruptions is not considered. A recent study put an even
stronger emphasis on the consequences of an interruption in a microsatellite (Taylor, Durkin, and Breden
1999). Based on known phylogenies, Taylor, Durkin,
and Breden (1999) used seven loci to map changes in
the microsatellite stretch on these phylogenies and concluded that once an interruption of a microsatellite occurred, the locus degenerated quickly. This model of
interruption-induced microsatellite decay provides an
interesting hypothesis, even though it remains unknown whether the persistence time would have been
longer without the initial interruption.
Consistent with previous observations, we also detected several interruptions in the microsatellite. Our
data, however, indicate that an interruption is often a
transitory state in the evolution of a microsatellite locus
and does not always result in its degeneration. Interestingly, even though the orthologous microsatellite sequence from distantly related species (such as D. elegans [DMTOR] or D. kikkawai [DS06335b]) was not
completely pure, parts of uninterrupted microsatellite
DNA of lengths similar to that found in the focal species
D. melanogaster could still be observed.
The evolutionary importance of purging interruptions in a microsatellite array is essentially dependent
on their frequency. Based on our data set, we were able
to demonstrate that the phenomenon exists, but whether
this is a rare or frequent event remains open to further
investigations.
Acknowledgments
Many thanks to Steven Weiss and the members of
C.S.’s lab for helpful comments and discussion. We are
grateful to the UMEA stock center and the Drosophila
Species Stock Center for providing flies. Special thanks
to C. Aquadro for his attentive editorship. This work
1008
Harr et al.
was supported by a grant from the Fonds zur Förderung
der wissenschaftlichen Forschung (FWF) to C.S.
LITERATURE CITED
BACHTROG, D., S. WEISS, B. ZANGERL, G. BREM, and C.
SCHLÖTTERER. 1999. Distribution of dinucleotide microsatellites in the Drosophila melanogaster genome. Mol. Biol.
Evol. 16:602–610.
BELL, G. I., and J. JURKA. 1997. The length distribution of
perfect dimer repetitive DNA is consistent with its evolution by an unbiased single-step mutation process. J. Mol.
Evol. 44:414–421.
BRINKMANN, B., M. KLINTSCHAR, F. NEUHUBER, J. HUHNE, and
B. ROLF. 1998. Mutation rate in human microsatellites: influence of the structure and length of the tandem repeat.
Am. J. Hum. Genet. 62:1408–1415.
DALLAS, J. F. 1992. Estimation of microsatellite mutation rates
in recombinant inbred strains of mouse. Mamm. Genome
3:452–456.
EISEN, J. A. 1999. Mechanistic basis for microsatellite instability. Pp. 34–48 in D. GOLDSTEIN and C. SCHLÖTTERER,
eds. Microsatellites: evolution and applications. Oxford
University Press, Oxford, England.
ELLEGREN, H., C. R. PRIMMER, and B. C. SHELDON. 1995. Microsatellite ‘evolution’: directionality or bias? Nat. Genet.
11:360–362.
ESTOUP, A., C. TAILLIEZ, J.-M. CORNUET, and M. SOLIGNAC.
1995. Size homoplasy and mutational processes of interrupted microsatellites in two bee species, Apis mellifera and
Bombus terrestris (Apidae). Mol. Biol. Evol. 12:1074–
1084.
GOLDSTEIN, D. B., and A. G. CLARK. 1995. Microsatellite variation in North American populations of Drosophila melanogaster. Nucleic Acid Res. 23:3882–3886.
HARR, B., S. WEISS, J. R. DAVID, G. BREM, and C. SCHLÖTTERER. 1998. A microsatellite-based multilocus phylogeny of
the Drosophila melanogaster species complex. Curr. Biol.
8:1183–1186.
JARNE, P., and P. J. L. LAGODA. 1996. Microsatellites, from
molecules to populations and back. Trends Ecol. Evol. 11:
424–429.
JIN, L., C. MACAUBAS, J. HALLMAYER, A. KIMURA, and E.
MIGNOT. 1996. Mutation rate varies among alleles at a microsatellite locus: phylogenetic evidence. Proc. Natl. Acad.
Sci. USA 93:15285–15288.
KRUGLYAK, S., R. T. DURRET, M. SCHUG, and C. F. AQUADRO.
1998. Equilibrium distributions of microsatellite repeat
length resulting from a balance between slippage events and
point mutations. Proc. Natl. Acad. Sci. USA 95:10774–
10778.
LAKEN, S. J., G. M. PETERSEN, S. B. GRUBER et al. (13 coauthors). 1997. Familial colorectal cancer in Ashkenazim
due to a hypermutable tract in APC. Nat. Genet. 17:79–
83.
LEVINSON, G., and G. A. GUTMAN. 1987. Slipped-strand mispairing: a major mechanism for DNA sequence evolution.
Mol. Biol. Evol. 4:203–221.
LORIDON, K., B. COURNOYER, C. GOUBELY, A. DEPEIGES, and
G. PICARD. 1998. Length polymorphism and allele structure
of trinucleotide microsatellites in natural accessions of Arabidopsis thaliana. Theor. Appl. Genet. 97:591–604.
MAURER, D. J., B. L. O’CALLAGHAN, and D. M. LIVINGSTON.
1998. Mapping the polarity of changes that occur in interrupted CAG repeat tracts in yeast. Mol. Cell. Biol. 18:4597–
4604.
MILLER, S. A., D. D. DYKES, and H. F. POLESKY. 1988. A
simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16:1215.
PALSBøLL, P. J., M. BÉRUBÉ, and H. JøRGENSEN. 1999. Multiple levels of single-strand slippage at cetacean tri- and
tetra nucleotide repeat microsatellite loci. Genetics 151:
285–296.
PAMILO, P., and M. NEI. 1988. Relationships between gene
trees and species trees. Mol. Biol. Evol. 5:568–583.
PÉLANDAKIS, M., and M. SOLIGNAC. 1993. Molecular phylogeny of Drosophila based on ribosomal RNA sequences. J.
Mol. Evol. 37:525–543.
PETES, T. D., P. W. GREENWELL, and M. DOMINSKA. 1997.
Stabilization of microsatellite sequences by variant repeats
in the yeast Saccharomyces cerevisiae. Genetics 146:491–
498.
PETROV, D. A., and D. L. HARTL. 1998. High rate of DNA
loss in the Drosophila melanogaster and Drosophila virilis
species groups. Mol. Biol. Evol. 15:293–302.
POWELL, J. R. 1997. Progress and prospects in evolutionary
biology—the Drosophila model. Oxford University Press,
Oxford, England.
SCHLÖTTERER, C. 1998. Microsatellites. Pp. 237–261 in A. R.
HOELZEL, eds. Molecular genetic analysis of populations: a
practical approach 2/e. Oxford University Press, Oxford,
England.
SCHLÖTTERER, C., and J. PEMBERTON. 1998. The use of microsatellites for genetic analysis of natural populations—a critical review. Pp. 71–86 in R. DESALLE and B. SCHIERWATER,
eds. Molecular approaches to ecology and evolution. Birkhäuser, Basel, Switzerland.
SCHLÖTTERER, C., R. RITTER, B. HARR, and G. BREM. 1998.
High mutation rates of a long microsatellite allele in Drosophila melanogaster provides evidence for allele-specific
mutation rates. Mol. Biol. Evol. 15:1269–1274.
SCHLÖTTERER, C., and B. ZANGERL. 1999. The use of imperfect
microsatellites for DNA fingerprinting and population genetics. Pp. 153–165 in J. T. EPPLEN and T. LUBJUHN, eds.
DNA profiling and DNA fingerprinting. Birkhäuser, Basel,
Switzerland.
SCHUG, M. D., C. M. HUTTER, K. A. WETTERSTRAND, M. S.
GAUDETTE, T. F. MACKAY, and C. F. AQUADRO. 1998a. The
mutation rates of di-, tri- and tetranucleotide repeats in Drosophila melanogaster. Mol. Biol. Evol. 15:1751–1760.
SCHUG, M. D., T. F. C. MACKAY, and C. F. AQUADRO. 1997.
Low mutation rates of microsatellite loci in Drosophila melanogaster. Nat. Genet. 15:99–102.
SCHUG, M. D., K. A. WETTERSTRAND, M. S. GAUDETTE, R. H.
LIM, C. M. HUTTER, and C. F. AQUADRO. 1998b. The distribution and frequency of microsatellite loci in Drosophila
melanogaster. Mol. Ecol. 7:57–69.
STEPHAN, W., and Y. KIM. 1998. Persistence of microsatellite
arrays in finite populations. Mol. Biol. Evol. 15:1332–1336.
STRIMMER, K., and A. VON HAESELER. 1996. Quartet puzzling:
a quartet maximum-likelihood method for reconstructing
tree topologies. Mol. Biol. Evol. 13:964–969.
TACHIDA, H., and M. IIZUKA. 1992. Persistence of repeated
sequences that evolve by replication slippage. Genetics 131:
471–478.
TAMURA, K., and M. NEI. 1993. Estimation of the number of
nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol.
10:512–526.
TAUTZ, D., and C. SCHLÖTTERER. 1994. Simple sequences.
Curr. Opin. Genet. Dev. 4:832–837.
Microsatellite Purification
TAYLOR, J. S., J. M. H. DURKIN, and F. BREDEN. 1999. The
death of a microsatellite: a phylogenetic perspective on microsatellite interruptions. Mol. Biol. Evol. 16:567–572.
THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON. 1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680.
WEBER, J. L. 1990. Informativeness of human (dC-dA)n.(dGdT)n polymorphisms. Genomics 7:524–530.
1009
WEBER, J. L., and C. WONG. 1993. Mutation of human short
tandem repeats. Hum. Mol. Genet. 2:1123–1128.
WIERDL, M., M. DOMINSKA, and T. D. PETES. 1997. Microsatellite instability in yeast: dependence on the length of the
microsatellite. Genetics 146:769–779.
CHARLES AQUADRO, reviewing editor
Accepted March 2, 2000