Brain Research 885 (2000) 25–31
www.elsevier.com / locate / bres
Research report
Changes in expressions of proinflammatory cytokines IL-1b, TNF-a
and IL-6 in the brain of senescence accelerated mouse (SAM) P8
Kyi Kyi Tha a , Yasunobu Okuma a , Hiroyuki Miyazaki a,b , Toshihiko Murayama a ,1 ,
Takashi Uehara a , Rieko Hatakeyama a , Yuka Hayashi b , Yasuyuki Nomura a , *
a
Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo 060 -0812, Japan
b
Hokkaido Foundation for Promotion of Scientific and Industrial Technology, Sapporo, Japan
Accepted 22 August 2000
Abstract
The senescence-accelerated mouse (SAM) is known to be a murine model for accelerated aging. The SAMP8 strain shows age-related
deterioration of learning and memory at an earlier age than control mice (SAMR1). In the present study, we investigated the changes in
expressions of interleukin-1b (IL-1b), tumor necrosis factor-a (TNF-a) and interleukin-6 (IL-6) in the brain of SAMP8. In the
hippocampus of 10 months old SAMP8, the expression of IL-1 mRNA was significantly elevated in comparison with that of SAMR1. In
both strains of SAMs, increases in IL-1b protein in the brain were observed at 10 months of age compared with 2 and 5 months. The only
differences found between the strain in protein levels were at 10 months and were elevations in IL-1b in the hippocampus and
hypothalamus, and in TNF-a and IL-6 in the cerebral cortex and the hippocampus in SAMP8 as compared with SAMR1. However,
lipopolysaccharide-induced increases in the expression of these cytokines in brain did not differ between SAMP8 and SAMR1. Increases
in expression of proinflammatory cytokines in the brain may be involved in the age-related neural dysfunction and / or learning deficiency
in SAMP8.  2000 Elsevier Science B.V. All rights reserved.
Theme: Development and regeneration
Topic: Aging process
Keywords: Senescence-accelerated mouse (SAM); Aging; Interleukin-1b (IL-1b); Tumor necrosis factor (TNF-b); Interleukin-6 (IL-6); Hippocampus;
Cerebral cortex; Hypothalamus; Learning and memory
1. Introduction
The senescence-accelerated mouse (SAM) has been
established as a murine model for accelerated aging [35].
SAM consists of the senescence-accelerated prone mouse
(SAMP) and senescence-accelerated resistant mouse
(SAMR), the latter showing normal aging characteristics.
The SAMP8 strain of senescence-accelerated prone mice
shows an age-related deterioration of learning and memory
[19,25,37]. We previously found neurochemical alterations
in the SAMP8 brain in comparison to SAMR1 during
*Corresponding author. Tel.: 181-11-706-3246; fax: 181-11-7064987.
E-mail address: [email protected] (Y. Nomura).
1
Present address: Laboratory of Chemical Pharmacology, Faculty of
Pharmaceutical Sciences, Chiba University, Chiba 263-8522, Japan.
aging, namely: (i) the amount of glutamate and glutamine
was elevated in the hippocampus, as was age induced
glutamate release [15]; (ii) release of acetylcholine and
noradrenaline was markedly reduced in SAMP8 [38,39];
and (iii) several neurotransmitter receptors such as the
muscarinic acetylcholine, serotonin-1A, benzodiazepine
and NMDA, and protein kinase C levels showed a decrease
in the hippocampus of SAMP8 [15,21,22,24]. These
findings indicated decreased synaptic activity in the brain,
which is relevant to cognitive impairment in SAMP8. In
addition, gliosis and abnormal metabolism of amyloid
precursor protein (APP)-like proteins were observed in
SAMP8 brain [23]. Proinflammatory cytokines, such as
interleukin (IL)-1b, IL-6 and tumor necrosis factor (TNFa, have been reported to be involved in the formation of
neuritic plaques in Alzheimer’s disease (AD) [11,33,27].
IL-1b has an important neuromodulatory role in the
0006-8993 / 00 / $ – see front matter  2000 Elsevier Science B.V. All rights reserved.
PII: S0006-8993( 00 )02883-3
K.K. Tha et al. / Brain Research 885 (2000) 25 – 31
26
hippocampus, acting downstream of the initial events of
long term potentiation [31]. An increased endogenous
IL-1b concentration in the hippocampus may be a common
trigger for impairments in long-term potentiation in ageand stress-induced rats [20]. Transgenic mice over expressing IL-6 exhibited a progressive age-related decline in
avoidance learning performance [13]. These findings suggest a relationship between cytokines and aging. In the
present study, we investigated the changes with age in
expression of proinflammatory cytokines in the brain of
SAMP8 in comparison with SAMR1.
2. Materials and methods
2.1. Mice
SAMs of both strains, SAMP8 and SAMR1, were bred
under conventional conditions, housed at 23618C, and
allowed free access to food and water; the light / dark cycle
was set at 12 h. Male SAMP8 and SAMR1 mice (2, 5 and
10 months old) were used. All animal experiments were
carried out in accordance with the NIH Guide for Care and
Use of Laboratories Animals and approved by the Animal
Care and Use Committee in Hokkaido University.
The mice were sacrificed by decapitation and the brains
were rapidly removed. The brain regions of interest were
dissected out on an ice-cold plate, and quickly frozen and
stored at 2808C for further analyses.
To estimate the expressions of IL-1b, TNF-a and IL-6
in the SAMs brain in response to LPS, each strain of 5
months old SAMs was randomly divided into two groups:
a treatment group and a control group. Lipopolysaccharide
(LPS) from Escherichia coli endotoxin (055:B5, Sigma)
was dissolved in saline and injected intraperitoneally.
Isotonic saline was injected by the same route in the
control group. Determinations of mRNA expression and
protein level were carried out 2 and 4 h after the
administration of LPS, respectively.
2.2. RT-PCR analysis
Total RNA was isolated using TRI REAGENTE
(SIGMA). The quantity of the RNA obtained was checked
by measuring the optical density (OD) at 260 and 280 nm.
cDNA was synthesized from 1 mg of total RNA by reverse
transcription using 100 U of Superscript Reverse transcriptase (GIBCO BRL) and Oligo(dt)12 – 18 primer in a
20-ml reaction mixture containing 53 first strand buffer
(GIBCO BRL), 1 mM dNTP mix, 10 mM DTT and 40 U
of RNase inhibitor. After incubation for 1 h at 428C, the
reaction was terminated by a denaturing enzyme for 15
min at 708C. For PCR amplification, 1.5 ml of cDNA was
added to 13.5 ml of a reaction mixture containing 0.2 mM
of each primer, 0.2 mM of dNTP mix, 0.5 U of ExpandE
High Fidelity (Boehringer Mannheim, Mannheim, Germany) and 1.5 mM MgCl 2 containing 103 PCR buffer II.
PCR was performed in a DNA thermal cycler (PerkinElmer 2400-R).
The oligonucleotide primers employed were based on
published mouse cDNA sequences (GenBank), shown in
Table 1. The PCR products (10 ml) were resolved by
electrophoresis in an 8% polyacrylamide gel in 13 TBE
buffer. The gel was stained with ethidium bromide, and
band densities were obtained by densitometric measurements using a FLA-200 image analyzer (Fujifilm Co. Ltd.,
Japan).
To compare the expressions of IL-1b, IL-6 and TNF-a
in the different experimental groups, the amounts of IL-1b,
IL-6 and TNF-a mRNAs in each brain region studied were
expressed as a ratio to b-actin mRNA used as a housekeeping gene that is commonly used as an internal
standard. No age-related alteration in the expression of
b-actin was observed in brain [32].
2.3. Enzyme-linked immunosorbent assay ( ELISA)
Each brain section was added to 10 vol of ice-cold
buffer (20 mM Tris–HCl, pH 7.4) containing 0.5 mM
PMSF, 0.5 mM benzamidine, 1.0 mM DTT and 1.0 mM
EDTA. Total protein was mechanically dissociated from
tissue using an ultrasonic cell disrupter. The sonicated
samples were immediately centrifuged at 30 0003g for 30
min at 48C and supernatants were removed and stored at
2808C until an ELISA was performed. Total protein
concentrations of brain sonication samples were determined by means of a Bio-Rad assay kit using bovine
serum albumin as the standard. The ELISAs for mouse
IL-1b, IL-6 and TNF-a were performed using commercially available kits from Endogen (Woburn, MA, USA). The
detection limit of IL-1b, IL-6 and TNF-a were ,3, ,7,
and ,10 pg / ml, respectively. The ELISA for IL-1b did
Table 1
Oligodeoxyribonucleotide primer sequences, annealing temperature and cycles used for PCR in the present study
cDNA
Upstream
Downstream
Product size (bp)
AT a
Cycles
IL-1b
IL-6
TNF-a
b-actin
aatctcacagcagcacatcaa
ggaggcttaattacacatgtt
cccctcagcaaaccaccaagt
ccacacccgccaccagttcg
agcccatactttaggaagaca
tgatttcaagatgaattggat
cttgggcagattgacctcagc
cccattcccaccatcacacc
671
435
373
165
56
57
60
61
36
38
34
23
a
AT, annealing temperature (8C).
K.K. Tha et al. / Brain Research 885 (2000) 25 – 31
not cross-react with mouse IL-1a, IL-3, IL-4, IL-5, IL-7,
IL-10, TNFa, IFN-g, GM-CSF or human IL-1b The
ELISA for IL-6 did not cross-react with mouse GM-CSF,
IFNg, IL-1a, IL-2, IL-3, IL-4, IL-5, IL-7, IL-9, IL-10,
IL-12 or human IL-6. The ELISA for TNF-a did not
cross-react with mouse IL-2, IL-3, IL-4, IL-5, IL-6, GMCSF, IFN-g or human TNF-a.
27
followed by a Bonferroni test. Significant values were
those with P values of ,0.05.
3. Results
3.1. Expressions of IL-1b mRNA in SAMP8 brain
2.4. Statistical significance
Independent values are expressed as the mean6S.E.
Simple comparisons between two groups were made using
Student’s t-test. In the case of multiple comparisons,
significance of difference was determined by ANOVA
We investigated the expression of IL-1b mRNA in 10
months old SAMP8 and SAMR1 using the RT-PCR
method. In the hippocampus of 10 months old SAMP8, the
expression of IL-1b mRNA was significantly elevated in
comparison with that of SAMR1 (P,0.01) (Fig. 1).
However, in the cerebral cortex and the brainstem, the
Fig. 1. Expression of IL-1b mRNA in the hippocampus of SAMP8 at 10 months. IL-1b mRNA were expressed as ratios of densitometric measurements of
the samples to the corresponding b-actin mRNA as an internal standard. The expressions of b-actin showed no difference between strains of SAMP8 and
SAMR1 and little variation among the brain regions. Thirty six cycles of PCR produced a linear relationship between the amount of input RNA and
resulting PCR product. Values are presented as mean6S.E. (n56). ** P,0.01 significantly different from SAMR1.
28
K.K. Tha et al. / Brain Research 885 (2000) 25 – 31
IL-1b mRNA expression was not significantly different
between the two strains of SAMs.
3.2. Changes of protein levels of IL-1b in SAMP8 brain
The protein levels of IL-1b in different regions of the
brain in 2, 5 and 10 months old SAMs were determined by
ELISA. In both strains of SAMs at 10 months old,
increases in the protein levels of IL-1b were observed in
all brain regions investigated (Fig. 2). The only significant
differences in the levels of IL-1b between the strains were
higher levels at 10 months in the hippocampus and the
hypothalamus of SAMP8 (P,0.001). The protein levels of
IL-1b did not show any significant strain differences in the
cerebral cortex and brainstem at the same age (Fig. 2).
3.3. Protein levels of TNF-a and IL-6 in SAMP8
In 10 months old SAMs, the protein levels of TNF-a
and IL-6 were significantly higher in SAMP8 than that of
SAMR1 in the cerebral cortex and the hippocampus (Figs.
3 and 4), but not in the hypothalamus or the brainstem.
In the next series, the response of LPS-induced expres-
Fig. 3. Protein levels of TNF-a in the brain of SAMP8 at 10 months old.
Values are presented as mean6S.E. (n59). * P,0.05, ** P,0.01 (significant difference from the respective values of SAMR1 performed by
Student’s t-test).
sions of IL-1b, TNF-a and IL-6 in the brain were
investigated in 5 months old SAMs. The mRNA expressions were determined by RT-PCR at 2 h after intraperitoneal injection of 20 mg / kg of LPS and protein levels
were determined by ELISA at 4 h after intraperitoneal
injection of 200 mg / kg of LPS. Compared with the saline
injected control group, mRNA and protein expressions of
Fig. 2. Protein levels of IL-1b in the brain at 2, 5 and 10 months old SAMP8. Values are presented as mean6S.E. (n59).* P,0.05, ** P,0.001
(significant difference from the respective values of SAMR1 performed by Student’s t-test); qq P,0.01, qqq P,0.001 (significant difference from the
respective values of 2 and 5 months determined by ANOVA followed by Bonferroni test).
K.K. Tha et al. / Brain Research 885 (2000) 25 – 31
Fig. 4. Protein levels of IL-6 in the brain of SAMP8 at 10 months old.
Values are presented as mean6S.E. (n59). ** P,0.01, *** P,0.001
(significant difference from the respective values of SAMR1 performed
by Student’s t-test).
IL-1b, TNF-a and IL-6 were induced by LPS in the
hippocampus and the hypothalamus of 5 months old
SAMP8. However, no significant differences in expression
of these cytokines in response to LPS between SAMP8 and
SAMR1 were observed (data not shown).
4. Discussion
In the present study, the expression of IL-1b mRNA in
the hippocampus in SAMP8 at 10 months old was significantly higher than SAMR1. The elevated expression of
IL-1b mRNA was correlated with higher levels of IL-1b
protein in the hippocampus and hypothalamus in SAMP8.
The protein levels of IL-6 and TNF-a were also elevated
in 10 months old SAMP8 in the cerebral cortex and the
hippocampus in comparison with the age-matched control
SAMR1 group. IL-1b which is assigned a key role in the
orchestration of the complex immune response to infection
and injury [7], was originally described as a peripheral
immune cell mediator. This cytokine has also been reported to be synthesized in the brain by glial cells and
certain neurons; and IL-1b receptors have been found in
different regions of the brain, with the highest abundance
in the hippocampus [1,12,30]. Proinflammatory cytokines
and including IL-1b TNF-a and IL-6 have been reported
to be significantly elevated in the cerebrospinal fluid or
plasma of AD patients [2,10]. In addition, evidence for a
role of inflammation in AD is the reported inverse association between anti-inflammatory drugs therapy and the
onset and symptoms [3,29]. Immunocytochemical studies
have shown that senile plaques contain several inflammatory markers, including complement and acute phase
proteins, as well as activated microglia [8]. Griffin et al.
[11] reported the expression of IL-1 in different plaque
types in AD, indicating that an inflammatory response
plays a central role in plaque development and dystrophic
neurite formation. IL-6 was present during the early stages
of plaque formation and expression of this cytokine was
correlated with clinical dementia [14]. IL-1b augments
29
amyloid b-peptide cytotoxicity in rat pheochromocytoma
cells [9]. IL-1b and IL-6 enhanced APP mRNA expression
in neurons, and the b-amyloid fragment 25–35 increased
expression of IL-1b in astrocytes [5]. It has been reported
that b-amyloid protein and interferon (IFN)-g activate
microglia to produce neurotoxic levels of TNF-a and
reactive nitrogen intermediates and this may have a role in
the pathogenesis of neuronal degeneration observed in
aging and AD [17]. Moreover, Ab alone, and Ab plus
IFN-g, triggered the production of chemotactic factors that
are specific for mononuclear phagocytes, and this effect
was mediated in an autocrine fashion by endogenous
TNF-a [18].
As summarized in the Introduction, we previously
demonstrated alterations in biochemical parameters relevant to synaptic fragility in SAMP8 brains in comparison
to SAMR1 during aging. In addition, the increased in
cerebral cortical and hippocampal amyloid precursor protein (APP) mRNA expression was shown in SAMP8 at 6
months old. Immunoblot analysis revealed an increase in
the reaction of 27 kDa proteins with antibody against the
C-terminal peptide fragment of APP, but not in the reaction
of 90–130 kDa APP (probably APP695 ) in SAMP8 brains,
indicating abnormal formation of APP-like proteins in
SAMP8 brains [16]. We also observed more granular
structures stained with anti-APP antibody in SAMP8
brains than in SAMR1 [23]. B /A4 protein-like immunoreactive granular structures were observed in various brain
regions and increased markedly in number with age [36].
The increase in the levels of the pro-inflammatory cytokine, IL-1b in SAMP8 brain may be involved in the
development of abnormal formation of APP-like proteins
and neuronal damage in SAMP8 brains.
It has been reported that expressions of cytokines such
as IL-1b TNF-a and IL-6 in response to LPS were altered
with age. Leukocytes of elderly persons produce higher
amounts of IL-1, IL-6 and TNF-a after induction with LPS
than do leukocytes from young donors [28]. LPS-stimulated alveolar macrophages from aged rats produced 50%
less TNF-a than those from young rats [4]. Aged monocytes from purified blood displayed a decrease in IL-6
(30% decrease) and TNF-a (50% decrease) after activation
by LPS than young monocytes [6]. IL-1b levels in the
hippocampus of C57BL / 6 mice showed age-related
changes in responses to acute LPS treatment [34]. In the
present study, however, no significant differences in the
expression of these cytokines in response to LPS were
observed in SAMP8 brains in comparison with agematched SAMR1.
In summary, expressions of IL-1b mRNA and protein
levels of IL-1b TNF-a and IL-6 were elevated, especially
in the hippocampus of 10 months old SAMP8. An increase
in the level of IL-1b was also observed with age in both
strains of SAMs. The protein levels of TNF-a and IL-6
were significantly higher in the cerebral cortex and the
hippocampus of 10 months old SAMP8 than age matched
30
K.K. Tha et al. / Brain Research 885 (2000) 25 – 31
SAMR1. These findings suggest that increases in the
expressions of proinflammatory cytokines in the brain may
be involved in the age-related neural dysfunction and / or
learning and memory deficiency in the SAMP8. Further
investigations regarding pro-inflammatory cytokines during
aging in SAMP8 are the subject of ongoing studies.
Acknowledgements
The authors would like to thank Dr T. Takeda (Kyoto
University) for the original provision of SAM. This study
was supported in part by Grants-in-Aid from the Ministry
of Education, Science, Sports and Culture, Japan and by
Joint-Research Project for Regional Intensive from Japan
Science and Technology Corporation.
References
[1] H.O. Besedovsky, A. del Rey, Immune–neuro-endocrine interactions: facts and hypotheses, Endocr. Rev. 17 (1996) 64–102.
[2] D. Blum-Degen, T. Muller, W. Kuhn, M. Gerlach, H. Przuntek, P.
Riederer, IL-1b and IL-6 are elevated in the cerebrospinal fluid of
Alzheimer’s and de novo Parkinson’s disease patients, Neurosci.
Lett. 202 (1995) 17–20.
[3] J.C.S. Breitner, B.A. Gau, K.A. Welsh, B.L. Plassman, W.M.
McDonald, M.J. Helms, J.C. Anthony, Inverse association of antiinflammatory treatments and Alzheimer’s disease: initial results of a
co-twin control study, Neurology 44 (1994) 227–232.
[4] E. Corsini, F. Battaini, L. Lucchi, M. Marinovich, M. Racchi, S.
Govoni, C.L. Galli, A defective protein kinase C anchoring system
underlying age associated impairment in TNF-a production in rat
macrophages, J. Immunol. 163 (1999) 3468–3473.
[5] R. Del Bo, N. Angeretti, E. Lucca, M. Grazia De Simoni, G.
Forloni, Reciprocal control of inflammatory cytokines, IL-1 and
IL-6, and b-amyloid production in cultures, Neurosci. Lett. 188
(1995) 70–74.
[6] A.D. Delpedro, M.J. Barjavel, Z. Mamdouh, S. Faure, O. Bakouche,
Signal transduction in LPS-activated aged and young monocytes, J.
Interferon Cytokine Res. 18 (1998) 429–437.
[7] C.A. Dinarello, Biologic basis for interleukin-1 in disease, Blood 87
(1996) 2095–2147.
[8] P. Eikelenboom, S.S. Zhan, W.A. Van Gool, D. Allsop, Inflammatory
mechanisms in Alzheimer’s disease, Trends. Pharmacol. Sci. 15
(1994) 447–450.
[9] M.O. Fagarasan, P.S. Aisen, IL-1 and anti-inflammatory drugs
modulate Ab cytotoxicity in PC12 cells, Brain Res. 723 (1996)
231–234.
[10] H. Fillit, W.H. Ding, L. Buee, J. Kalman, L. Altstiel, B. Lawlor, G.
Wolf-Klein, Elevated circulating TNF levels in Alzheimer’s disease,
Neurosci. Lett. 129 (1991) 318–320.
[11] W.S.T. Griffin, J.G. Sheng, G.W. Roberts, R.E. Mark, Interleukin-1
expression in different plaque types in Alzheimer’s disease: significance in plaque evolution, J. Neuropathol. Exp. Neurol. 54 (1995)
276–281.
[12] H.S. Haas, K. Schauenstein, Neuroimmunomodulation via limbic
structures. The neuroanatomy of psychoimmunology, Prog. Neurobiol. 51 (1997) 195–222.
[13] C.J. Heyser, E. Masliah, A. Samimi, I.L. Campbell, L.H. Gold,
Progressive decline in avoidance learning paralleled by inflammatory neurodegeneration in transgenic mice expressing interleukin 6
in the brain, Proc. Natl. Acad. Sci. USA 94 (1997) 1500–1505.
[14] M. Huell, S. Stauss, B. Volk, M. Berger, J. Bauer, Interleukin-6 is
present in early stages of plaque formation and is restricted to the
brains of Alzheimer’s disease patients, Acta Neuropathol. 89 (1995)
544–551.
[15] Y. Kitamura, X.H. Zhao, T. Ohnuki, M. Takei, Y. Nomura, Agerelated changes in transmitter glutamate and NMDA receptor / channels in the brain of senescence-accelerated mouse, Neurosci. Lett.
137 (1992) 169–172.
[16] Y. Kitamura, Y. Yamanaka, K. Nagashima, Y. Nomura, The agerelated increase in markers of astrocytes and amyloid precursor
proteins in the brain of senescence-accelerated mouse (SAM), in: T.
Takeda (Ed.), The SAM Model of Senescence, Excerpta Medica,
Amsterdam, 1994, pp. 359–362.
[17] L. Meda, M.A. Cassatella, G.I. Szendrei, L.J. Otvos, P. Baron, M.
Villalba, D. Ferrari, F. Rossi, Activation of microglial cells by
b-amyloid protein and interferon-g, Nature 374 (1995) 647–650.
[18] L. Meda, S. Bernasconi, C. Bonaiuto, S. Sozzani, D. Zhou, L. Otvos
Jr., A. Mantovani, F. Rossi, M.A. Cassatella, b-amyloid (25–35)
peptide and IFN-g synergistically induce the production of the
chemotactic cytokine MCP-1 / JE in monocytes and microglial cells,
J. Immunol. 157 (1996) 1213–1218.
[19] M. Miyamoto, Y. Kiyota, M. Nishiyama, A. Nagaoka, T. Masuo, Y.
Nagawa, T. Takeda, Age-related changes in learning and memory in
the senescence-accelerated mouse (SAM), Physiol. Behav. 38
(1986) 399–406.
[20] C.A. Murray, M.A. Lynch, Evidence that increased hippocampal
expression of the cytokine interleukin-1b is a common trigger for
age- and stress-induced impairments in long-term potentiation, J.
Neurosci. 18 (1998) 2974–2981.
[21] Y. Nagata, T. Uehara, Y. Kitamura, Y. Nomura, K. Horiike, D-serine
content and D-[ 3 H] serine binding in the brain regions of the
senescence-accelerated mouse, Mech. Ageing Dev. 104 (1998) 115–
124.
[22] Y. Nomura, Y. Kitamura, X.H. Zhao, Aging in the glutamatergic
system with special reference to the NMDA receptor / ion channel
complex in the brains of senescence accelerated mice, in: T.
Kameyama, T. Nabeshima, E.F. Domino (Eds.), NMDA Receptor
Related Agents: Biochemistry, Pharmacology and Behavior, NPP
Books, Ann Arbor, MI, 1991, pp. 287–298.
[23] Y. Nomura, Y. Kitamura, X.H. Zhao, T. Ohnuki, M. Takei, Y.
Yamanaka, Y. Kitayama, T. Nishiya, Neurochemical studies on
aging in SAM brain, in: T. Takeda (Ed.), The SAM Model of
Senescence, Excerpta Medica, Amsterdam, 1994, pp. 83–88.
[24] Y. Nomura, Y. Kitamura, T. Ohnuki, T. Arima, Y. Yamanaka, K.
Sasaki, Y. Oomura, Alterations in acetylcholine, NMDA, benzodiazepine receptors and protein kinase C in the brain of the
senescence-accelerated mouse: an animal model useful for studies
on cognitive enhancers, Behav. Brain Res. 83 (1997) 51–55.
[25] A. Ohta, T. Hirano, H. Yagi, S. Tanaka, M. Hosokawa, T. Takeda,
Behavioral characteristics of the SAM-P/ 8 strain in Sidman active
avoidance task, Brain Res. 498 (1989) 195–198.
[27] P.H. Patterson, Cytokines in Alzheimer’s disease and multiple
sclerosis, Curr. Opin. Neurobiol. 5 (1995) 642–646.
[28] L. Rink, I. Cakman, H. Kirchner, Altered cytokine production in the
elderly, Mech. Ageing Dev. 102 (1998) 199–209.
[29] J. Rogers, L.C. Kirby, S.R. Hempelman, D.L. Berry, P.L. McGeer,
A.W. Kaszniak, J. Zalinski, M. Cofield, L. Mansukhani, P. Willson,
F. Kogan, Clinical trail of indomethacin in Alzheimer’s disease,
Neurology 43 (1993) 1609–1611.
[30] N.J. Rothwell, S.J. Hopkins, Cytokines and the nervous system II:
Actions and mechanisms of action, Trends Neurosci. 18 (1995)
130–136.
[31] H. Schneider, F. Pitossi, D. Balschun, A. Wagner, A. del Rey, H.O.
Besedovsky, A neuromodulatory role of interleukin-1b in the
hippocampus, Physiology 95 (1998) 7778–7783.
[32] P.E. Slagboom, W.J. de Leeuw, J. Vijg, Messenger RNA levels and
methylation patterns of GAPDH and beta-actin genes in rat liver,
K.K. Tha et al. / Brain Research 885 (2000) 25 – 31
[33]
[34]
[35]
[36]
spleen and brain in relation to aging, Mech. Ageing Dev. 53 (1990)
243–257.
S. Strauss, J. Bauer, U. Ganter, U. Jonas, M. Berger, B. Volk,
Detection of interleukin-6 and 2-macroglobulin immunoreactivity in
cortex and hippocampus of Alzheimer’s disease patients, Lab.
Invest. 66 (1992) 223–230.
T. Takao, I. Nagano, C. Tojo, T. Takemura, S. Makino, K.
Hashimoto, E.B. De Souza, Age-related reciprocal modulation of
interleukin-1 beta and interleukin-1 receptors in the mouse brain–
endocrine–immune axis, Neuroimmunomodulation 3 (1996) 205–
212.
T. Takeda, M. Hosokawa, S. Takeshita, M. Irino, K. Higuchi, T.
Matsushita, Y. Tomita, K. Yasuhira, H. Hamamoto, K. Shimizu, M.
Ishii, T. Yamamuro, A new murine model of accelerated senescence,
Mech. Ageing Dev. 17 (1981) 183–194.
M. Takemura, N. Shinichi, I. Akiguchi, M. Ueno, N. Oka, S.
31
Ishikawa, S. Nakamura, J. Kimura, T. Takeda, b /A4 protein like
immunoreactive granular structures in the brain of senescenceaccelerated mouse (SAM), Am. J. Pathol. 142 (1993) 1887–1897.
[37] H. Yagi, S. Katoh, I. Akiguchi, T. Takeda, Age-related deterioration
of ability of acquisition in memory and learning in senescence
accelerated mouse: SAM-P/ 8 as an animal model of disturbances in
recent memory, Brain Res. 474 (1988) 86–93.
[38] X.H. Zhao, A. Awaya, H. Kobayashi, T. Ohnuki, Y. Tokumitsu, Y.
Nomura, Age-related changes in uptake and release on L-[ 3 H]
noradrenaline in brain slices of senescence accelerated mouse, Int. J.
Dev. Neurosci. 8 (1990) 267–272.
[39] X.H. Zhao, Y. Kitamura, Y. Nomura, Age-related changes in
NMDA-induced [ 3 H]acetylcholine release from brain slices of
senescence-accelerated mouse, Int. J. Dev. Neurosci. 10 (1992)
121–129.