0022-3565/01/2992-753–759$3.00
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright © 2001 by The American Society for Pharmacology and Experimental Therapeutics
JPET 299:753–759, 2001
Vol. 299, No. 2
4018/938681
Printed in U.S.A.
Phosphodiesterase 4 Inhibitors Prevent Cytokine Secretion by
T Lymphocytes by Inhibiting Nuclear Factor-␬B and Nuclear
Factor of Activated T Cells Activation
JOSÉ LUIS JIMENEZ,1 CARMEN PUNZÓN,1 JOAQUÍN NAVARRO, M. ANGELES MUÑOZ-FERNÁNDEZ, and
MANUEL FRESNO
Centro de Biologı́a Molecular, Consejo Superior de Investigaciones Cientificas, Universidad Autónoma de Madrid, Cantoblanco, Madrid, Spain
(C.P., M.F.); and Department of Immunology, Hospital Universitario Gregorio Marañón, Madrid, Spain (J.L.J., J.N., M.A.M.-F.)
Received April 2, 2001; accepted July 23, 2001
This paper is available online at http://jpet.aspetjournals.org
Activated T cells, mostly through the secretion of cytokines, play an important role in the pathogenesis of inflammatory diseases by initiating, sustaining, and terminating
inflammation (Feldmann et al., 1996; Berridge, 1997). There
are two basic types of T helper cells: Th1 characterized by
(IL)-2 and IFN-␥ production and Th2 characterized by IL-4,
-5, -6, and -10 production (Crabtree and Clipstone, 1994). Th1
cells are proinflammatory, whereas Th2 cells promote B cell
responses and are able to down-regulate inflammatory responses mainly via IL-10 production. T-cell activation and
cytokine secretion are controlled through the combined action of nuclear transcription factors. Among these factors,
nuclear factor-␬B (NF-␬B), nuclear factor of activated T cells
(NFAT), and activator protein (AP-1) play a prominent role
(Fraser et al., 1993; Crabtree and Clipstone, 1994). T-cell
This work was supported by grants from Fondo de Investigación Sanitaria,
Ministerio de Educación y Cultura, Comunidad Autónoma de Madrid and
Fundación Ramón Areces to M.F.; and Programa Nacional de Salud (SAF
99-0022), Comunidad Autónoma de Madrid, Fondo de Investigación Sanitaria
(FIS 00/0207), and Fundación para la Investigación y Prevención del SIDA in
Spain (FIPSE 3008/99) to M.A.M.-F.
1
These authors contributed equally to this work.
transcription of IL-2 and TNF-␣ promoters in transiently transfected normal T cells. Moreover, they inhibited the activation of
nuclear factor-␬B (NF-␬B) and nuclear factor of activated T
cells (NFAT) and stimulated activator protein-1 (AP-1) and
cAMP response element-binding proteins (CREBs). In contrast,
dibutyryl cAMP inhibited NF-␬B but not NFAT activation. Thus,
our data indicate that blockade of phosphodiesterase 4 regulates transcription of a particular cytokine through inhibition of
NF-␬B and NFAT, and stimulation of AP-1 and CREB.
activation induces NF-␬B (Molitor et al., 1990) and NFAT
(Rao et al., 1997) translocation to the nucleus where they
bind to specific sequences in the promoters of many genes. In
contrast, AP-1 becomes activated mainly by phosphorylation
(Karin et al., 1997).
On the other hand, the role of cAMP as second messenger
in the immune system has been the subject of intensive
research for the past two decades. As a result, it is well
established that cAMP modulates the response of immune
cells to a variety of stimuli (Haraguchi et al., 1995). Elevation
of intracellular cAMP has been generally associated with
inhibition of lymphocyte activation (Haraguchi et al., 1995).
cAMP binds to and activates protein kinase A (PKA) that in
turn phosphorylates several transcription factors that bind
to cAMP response elements (CREs) in the DNA, named CREbinding proteins (CREBs) (Sassone-Corsi, 1995).
The net intracellular concentration of cAMP is the result of
synthesis by adenyl cyclases and degradation by phosphodiesterases (PDEs). Several PDE isoenzymes have been described, distinguished by their selectivity toward substrate
(cGMP as cAMP) and their sensitivity to pharmacological
ABBREVIATIONS: IL, interleukin; Th, T helper; IFN-␥, interferon-␥; NF-␬B, nuclear factor-␬B; NFAT, nuclear factor of activated T cells; AP-1,
activator protein-1; PKA, protein kinase A; CRE, cAMP response element; CREB, cAMP response element-binding proteins; PDE, phosphodiesterase; RP, rolipram; DMEM, Dulbecco’s modified Eagle’s medium; FCS, fetal calf serum; dBcAMP, dibutyryl cAMP; CMV, cytomegalovirus;
PMA, phorbol-12-myristate-13-acetate; Io, ionomycin; PTX, pentoxifylline; RLU, relative luciferase units; EMSA, electrophoretic mobility shift
assay.
753
Downloaded from jpet.aspetjournals.org at ASPET Journals on June 18, 2017
ABSTRACT
Blockade of phosphodiesterase 4 with rolipram reduced the
production of tumor necrosis factor (TNF)-␣, interleukin (IL)-5,
IL-10, and IL-2 but poorly inhibited cell proliferation and interferon-␥ (IFN-␥) production by activated human T cells. Addition
of dibutyryl cAMP mimicked rolipram inhibitions on proliferation, IL-2, TNF-␣, and IFN-␥ but not on IL-10 or IL-5 production.
Moreover, the inhibitory effects of rolipram on proliferation,
IFN-␥, and TNF-␣ but not of IL-10 production can be prevented
by a specific protein kinase A inhibitor. Rolipram and pentoxifylline, a nonspecific phosphodiesterase inhibitor, decreased
754
Jimenez et al.
Materials and Methods
Cell Cultures. Human mononuclear cells were obtained from
heparinized venous blood of healthy volunteers through Ficoll
Hypaque (Pharmacia Fine Chemicals, Uppsala, Sweden) centrifugation. The layer containing mononuclear cells was taken and the cells
washed thoroughly by centrifugation in DMEM and finally resuspended in DMEM 2% fetal calf serum (FCS). Monocytes were separated by adherence to plastic disks for 2 h at 37°C. T cells were
further purified by passing the nonadherent population through a
nylon fiber wool column as described (Pimentel-Muiños et al., 1994).
The purity of this population (detected by flow cytometry) was always greater than 95% CD3⫹ cells.
Purified T cells (106/ml in DMEM medium containing 10% FCS)
were seeded in 96-well U-bottom microtiter plates (105/100 ␮l/well)
and stimulated with immobilized (1 ␮g/ml-coated wells) anti-CD3
antibody (SPV3Tb kindly provided by Dr. J. E. de Vries; DNAX, Palo
Alto, CA), in the presence of different concentrations of RP (Schering,
Madrid, Spain), dBcAMP (Sigma, St. Louis, MO), and/or the protein
kinase A-specific inhibitor KT 5720 (Kamiya Biomedical, Thousand
Oaks, CA). The cultures were incubated for 72 h at 37°C and cell
proliferation was evaluated by incorporation of [3H]thymidine
(PerkinElmer Life Science Products, Boston, MA) into DNA during
the last 16 h of culture. For cytokine assays, supernatants were
harvested after 3 days of culture and cytokines quantified using
commercially available specific enzyme-linked immunosorbent assays: (IL-2; R & D Systems, Minneapolis, MN; IL-10, IL-12, and
TNF-␣, Bender MedSystems, Vienna, Austria; and IFN-␥ and IL-5,
Endogen Corporation, Woburn, MA). The effect of PDE inhibitors on
cell viability was assessed by propidium iodide staining. Briefly, cells
were lysed with Triton X-100 (1.5%) and propidium iodide (5 ␮g/ml)
and incubated for 20 min at room temperature in the dark and
immediately analyzed in a cytoflourometer.
Transcription Assays. Transcriptional activity was measured
using reporter gene assay in transiently transfected normal resting
T cells. The plasmid TNF-␣-luc contains a region 850-base pairs
upstream from the transcriptional initiation site of human TNF-␣
promoter. The NFAT-luc, containing three tandem copies of the
NFAT binding site of the IL-2 promoter, and IL-2-luc, containing the
⫺326 to ⫹45 region of the human IL-2 promoter plasmids, were a
generous gift from Dr. G. Crabtree (Durand et al., 1988). The AP-1Luc plasmid includes the 73/⫹63-base pair region of the human
collagenase promoter fused to the luciferase gene (Deng and Karin,
1993). The pNF-␬B-luc contains three tandem copies of the NF-␬B
site of the conalbumin promoter driving the luciferase reporter gene
(Navarro et al., 1998). The CRE-luc plasmid contains four copies of
the CRE site of the human choriogonadotropin ␣ gene promoter
(⫺147 to ⫺129) (Schwaninger et al., 1993). CMV-luc contains the
luciferase gene under control of the CMV promoter.
For transfection assays, resting purified T cells were resuspended
in RPMI supplemented with 10% FCS and electroporated at 320 V,
1500 ␮F by using a Bio-Rad Gene Pulser II (Bio-Rad, Hercules, CA)
with 1 ␮g/106 cells of purified plasmid (Navarro et al., 1998). After
transfection the cells were cultured at 37°C for 14 h before being
activated with phorbol-12-myristate-13-acetate (PMA) (10 ng/ml)
plus ionomycin (Io) in the presence of RP, PTX (Sigma Chemical, St.
Louis, MO), or dbcAMP (1 ␮M). Cells were incubated for an additional 12-h period, harvested, and lysed. The efficiency of transfection determined by cotransfection with a CMV-␤-galactosidase expression plasmid varied between 5 and 10% of the cells. Luciferase
activity was measured in a luminometer and expressed as relative
luciferase units (RLU), calculated as light emission from experimental sample-light emission from untransfected cells/106 cells. Data are
represented as fold induction (observed experimental RLU/basal
RLU in absence of any stimulus).
Electrophoretic Mobility Shift Assays (EMSAs). Nuclear extracts were obtained from activated T cells in the different conditions
essentially by the previously described method (Pimentel-Muiños et
al., 1994). The binding assays were performed as reported using as
labeled probes: the double-stranded ␬B element of IL-2R␣ promoter
(5⬘ GCAGGGGAATCTCCCTCT 3⬘), the CRE consensus element (5⬘
AGAGATTGCCTGACGTCAGAGACCTAG 3⬘), the distal NFAT site
from the IL-2 promoter (5⬘ GGAGGAAAAACTGTTTCATACAGAAGGCGT 3⬘), or an AP-1 consensus site (5⬘ CGCTTGATGAGTCAGCGGAA 3⬘). The binding complexes were separated in a 5% acrylamide
gel and their specificity was determined by competition with 50⫻
molar excess of the same unlabeled oligonucleotide (PimentelMuiños et al., 1994). Supershifting assay with anti-p65 NF-␬B antibodies (a generous gift from Dr. Nancy Rice, Frederick Cancer Research and Development Center, National Cancer Institute,
Frederick, MD) was carried out as described (Pimentel-Muiños et al.,
1994).
Results
Effect of PDE4 Inhibition on T-Cell Activation. To
study the contribution of PDE4 to immune function, we have
tested the effect of its blockade by RP in the activation of
purified T cells. For this, purified T cells, depleted of the
majority of monocytes, were activated through the T-cell
receptor with immobilized anti-CD3 in the presence or absence of RP. In these cultures, no spontaneous secretion of
cytokines was found. Upon activation, cell proliferation as
well as IL-2, IL-5, IL-10, IFN-␥, and TNF-␣ secretion was
induced (Fig. 1A). The addition of RP inhibited all of these
T-cell activities, although their sensitivity to inhibition was
clearly different. Thus, RP inhibited with similar potency
IL-10, IL-5, and TNF-␣ secretion by activated T cells (IC50 of
⬇0.5–2 ␮M). IL-2 synthesis was somewhat less sensitive
Downloaded from jpet.aspetjournals.org at ASPET Journals on June 18, 2017
inhibitors (Soderling and Beavo, 2000). PDE4 is the predominant isoenzyme expressed in myeloid and lymphoid cells. T
lymphocytes also express PDE3 and PDE7 (Giembycz et al.,
1996). PDE4 and PDE7 are selective for cAMP, whereas
PDE3 degrades cAMP or cGMP with similar kinetics (Beavo
et al., 1994). Moreover, recent reports indicate that PDE4
(Jiang et al., 1998) and PDE7 (Li et al., 1999) are induced in
T lymphocytes upon mitogenic stimulation, suggesting that
they play a role in T-cell activation.
The PDE4 inhibitor rolipram (RP), (⫾) 4-(3⬘-cyclopentyloxy-4⬘-methoxyphenyl)-2-pyrrolidone, has been used in
clinical trials as an antidepressant drug with safety and
efficacy. More recently, RP and other PDE4 inhibitors have
been shown to suppress the in vitro functional responses of
many inflammatory cells and thus, they have been considered promising anti-inflammatory drugs (for review, see
Teixeira et al., 1997). Thus, they have been investigated for
the treatment of asthma, multiple sclerosis, ischemia, arthritis, adult respiratory distress syndrome, endotoxic shock, and
in acute and chronic models of inflammation. Some of the
anti-inflammatory actions of PDE4 inhibitors have been
linked to the ability to down-regulate TNF-␣ synthesis in
vitro and in vivo. Due to the potential therapeutic effect of
PDE4 inhibitors in various diseases it is important to better
understand the mechanism of action of PDE4 inhibitors at
the molecular levels to determine how PDE4 inhibition affects cytokine secretion by T cells. Our results indicate that
PDE4 blockade controls cytokine secretion by T cells through
inhibition of NF-␬B and NFAT and activation of AP-1 and
CREB.
Phosphodiesterase 4 Controls NF-␬B and NFAT Activation
755
(IC50 of ⬇7 ␮M). In contrast, RP poorly affected IFN-␥ secretion and T-cell proliferation (IC50 of ⬇100 –200 ␮M). These
effects were not due to nonspecific toxicity, because no sig-
nificant decrease in viable cell number (tested by trypan blue
exclusion) up to 1 mM was observed (data not shown). Besides, RP neither induced apoptosis in normal unstimulated
Downloaded from jpet.aspetjournals.org at ASPET Journals on June 18, 2017
Fig. 1. Effect of RP and dBcAMP on T-cell
activation. A, T cells were stimulated
with anti-CD3 antibody in presence of RP
and dBcAMP at the indicated concentration, and cytokine production and proliferation were evaluated as indicated under Materials and Methods. Unstimulated T cells did not produce detectable
amounts of cytokines or proliferated (data
not shown). B, apoptosis in T-cell cultures. T cells unstimulated or stimulated
with anti-CD3 as described above were
checked for apoptosis by propidium iodide
staining. Results shown are the mean ⫾
S.D. from three experiments with different donors, each one carried out in duplicate.
756
Jimenez et al.
Fig. 2. Effect of PKA inhibitors on RP activities. RP (100 ␮M), KT 5720
(200 nM) alone or in combination were added to the cultures of T cells
stimulated with anti-CD3 and TNF-␣, IL-10, and IFN-␥ secretion were
evaluated. Results shown (mean ⫾ S.D. of two experiments) are standardized as percentage of stimulated control in the absence of drugs.
Control values were TNF-␣ (350 ⫾ 53 pg/ml), IFN-␥ (2358 ⫾ 220 pg/ml),
and IL-10 (170 ⫾ 35 pg/ml) in T cells. 䡺, RP; _, KT5720; f, KT5720 ⫹ RP.
Fig. 3. Effect of RP on the transcriptional activity of TNF-␣ and IL-2
promoters. Human resting T cells were transfected with: pTNF-luc or
pIL-2-luc and stimulated or not with PMA (10 ng/ml) plus Io (1 ␮M) in
presence or absence of RP, dBcAMP, or PTX at the indicated millimolar
concentration and/or KT 5720. Results shown are the mean ⫾ S.D. of two
experiments by using T cells from two different donors and normalized to
fold induction values (observed experimental RLU/basal RLU in absence
of any stimulus). 䡺, untreated; f, ⫹ KT5720.
500 ␮M. Interestingly, KT 5720 did not prevent RP inhibition
on IL-2 promoter and only partially reversed inhibition of
TNF-␣ promoter. This reversion was more evident at low
doses of RP. In contrast, KT 5720 completely prevented inhibition caused by dBcAMP.
The transcription of TNF-␣ and IL-2 is dependent on several nuclear factors induced by T-cell activation, such as
NFAT, AP-1, and NF-␬B (Fraser et al., 1993; Crabtree and
Clipstone, 1994). So, we tested the effect of RP on primary T
cells, transiently transfected with reporter genes under control of NF-␬B, NFAT, and AP-1 elements. Again, a good
activation of these reporter genes can be detected in transfected normal resting T cells upon activation with PMA plus
Io (Fig. 4A). RP (100 ␮M) was able to inhibit by 60 to 80%,
depending of the experiment, the induction of NFAT activity.
This inhibition of NFAT by RP was not prevented by KT 5720
(data not shown). It also inhibited the activation of NF-␬B. In
contrast, AP-1 activity was enhanced by RP over the low
levels already induced by PMA plus Io. The activity of a
reporter gene under the control of a CRE was enhanced by
RP (Fig. 4A), indicating that RP was increasing intracellular
cAMP levels. Interestingly, PTX had similar effects to RP on
the activation of these transcription factors. In contrast to
RP, dBcAMP minimally affected the induction of NFAT-dependent promoter activity, although it similarly inhibited the
Downloaded from jpet.aspetjournals.org at ASPET Journals on June 18, 2017
T cells nor potentiated the small one induced by anti-CD3
stimulation (Fig. 1B). Similar effects, although requiring
higher doses of the drug, were observed with a nonspecific
PDE inhibitor PTX (data not shown).
So far, all the actions of RP have been attributed to increases in intracellular cAMP due to its ability to block its
degradation by PDE4 (Teixeira et al., 1997). To test whether
cAMP elevation was responsible for the above-mentioned
effects, we studied the effect of a permeable analog, dBcAMP,
in our system. dBcAMP added to the cultures strongly inhibited TNF-␣ secretion (IC50 of ⬇10 ␮M) and with lesser potency T-cell proliferation, and IL-2 and IFN␥ secretion by
activated T cells (IC50 of ⬇100 ␮M). In contrast, dBcAMP had
a weak inhibitory effect on IL-10 and IL-5 secretion by activated T-cell cultures (Fig. 1).
Involvement of Protein Kinase A in RP Activities. To
corroborate the involvement of the cAMP-PKA pathway in
RP activities, we tested the ability of KT 5720, a selective
PKA inhibitor, to overcome the inhibitory effect of RP. Although KT 5720 had some effect by itself (enhancing TNF-␣
and IFN-␥ but decreasing IL-10 secretion), this effect was not
statistically significant. However, it prevented in a large
percentage RP inhibition of TNF-␣ production and the small
inhibitory effects on cell proliferation and IFN-␥ production
by activated T cells. However, it did not alter RP inhibition of
IL-10 secretion in the same cell cultures (Fig. 2). Another
PKA inhibitor, H-8, had similar effects (data not shown). As
expected, KT 5720 reverted dBcAMP inhibition of TNF-␣
production.
Effect of PDE4 Inhibition on Cytokine Transcription
of T Cells. To determine whether the effect of RP on IL-2 and
TNF-␣ was at the transcriptional level, we transfected reporter genes controlled by the IL-2 and TNF-␣ promoter
regions in normal resting T cells. Stimulation with PMA plus
Io, a treatment that mimics T-cell activation through the
T-cell receptor, enhanced several times the activity of both
TNF-␣ and IL-2 promoter reporter plasmids (Fig. 3). Interestingly, RP and to a lesser extent PTX inhibited the transcriptional activity of both promoters in a dose-dependent
manner. dBcAMP partially affected their transcription at
Phosphodiesterase 4 Controls NF-␬B and NFAT Activation
757
is the transcriptionally active one. dBcAMP produced a partial inhibition of NF-␬B binding (around 40% in agreement
with the reporter data) (Fig. 5). Activation by immobilized
anti-CD3 also induced the appearance of a NFAT complex in
the nucleus of T cells that can be outcompeted by the specific
oligonucleotide. Its induced expression was completely inhibited by RP 100 ␮M (Fig. 5). In contrast, dBcAMP did not
inhibit NFAT activation. The inhibition observed by RP on
NFAT and NF-␬B was observed at any time after anti-CD3
activation (data not shown). As expected, both RP and dBcAMP increased the nuclear proteins bound to both AP-1 and
to a CRE DNA probe over the levels induced by anti-CD3
stimulation (Fig. 5, C and D). Similar results on transcription
factors were found when T cells were stimulated with PMA
plus Io (data not shown).
Discussion
Fig. 4. Effect of PDE4 inhibition on nuclear factor driven-transcription. T
cells were transfected with reporter plasmids NF-␬B-luc, NFAT-luc, AP1-luc, or CRE-luc (A) or CMV-luc (B). Cells were stimulated or not with
PMA (10 ng/ml) plus Io (1 ␮M) in presence or absence of RP (0.1 or 0.5
mM), dBcAMP (0.5 mM), or PTX (0.5 mM) as indicated. Results shown
are the mean ⫾ S.D. of three experiments by using T cells from three
different donor and normalized to fold induction values.
activation of the NF-␬B-driven reporter and enhanced the
AP-1 and CRE reporter genes. All the above-mentioned effects on promoter transcription observed with PTX and RP
were specific, because these drugs as well as dBcAMP did not
affect the transcription of a luciferase gene under control of
CMV promoter (Fig. 4B).
To corroborate the observed inhibition of NF-␬B and NFAT
activity by RP, we analyzed the presence of active transcription factors in the nucleus of activated T cells in the presence
of RP or dBcAMP by EMSA. As expected, resting T cells have
a low amount of specific complex(es) in the nucleus able to
bind to specific oligonucleotide probe and anti-CD3 activation
induced the appearance of active NF-␬B. Careful examination of the gels indicates the presence of two complexes. The
upper one was supershifted by anti-p65 NF-␬B antibodies,
and the lower band probably represents p450 homodimers as
it has been described (Baeuerle and Henkel, 1994; PimentelMuiños et al., 1994). Addition of RP into the culture strongly
inhibited (around 80%) NF-␬B-active complexes. Interestingly, this inhibition was complete in the upper band, which
Fig. 5. Inhibition of NF-␬B and NFAT activation by RP. T cells were
unstimulated (uns) or stimulated with immobilized anti-CD3 antibody in
the presence of RP (0.1 mM), dBcAMP (0.3 mM) as indicated. The binding
activity of NFAT (A), NF-␬B (B), AP-1 (C), and CREB (D) in the nucleus
of T cells was assayed 14 h later, by using a ␬B-IL-2R␣, CRE, AP-1, or
distal IL-2 NFAT site-labeled probes as described. Control specific binding was detected by using as competitor 50-fold excess of unlabeled
corresponding oligonucleotides. In B, extracts from anti-CD3-stimulated
control T cells were incubated with anti-p65 NF-␬B antibody to identify
the specific complexes, where indicated.
Downloaded from jpet.aspetjournals.org at ASPET Journals on June 18, 2017
PDE4-specific inhibitors are considered promising antiinflammatory drugs for many diseases. However, their pharmacological actions have been restricted by their side effects.
758
Jimenez et al.
1994; Haraguchi et al., 1995) as well as CREB (Haraguchi et
al., 1995). Our results with dBcAMP in primary T cells are in
agreement with those. However, we have found here that, in
contrast to cAMP, PDE4 blockade with RP or PTX inhibits
NFAT. RP and PTX also inhibit NF-␬B and stimulate AP-1
and CRE-binding factors as cAMP does.
Evidence indicates that type 2 cytokines are controlled by
a subset of transcription factors different from those that
control proinflammatory TNF-␣ and IL-2 transcription.
Thus, NF-␬B does not seem to be required for IL-10 (Platzer
et al., 1994) and IL-5 (Lee et al., 1995; Stranick et al., 1997)
transcription, whereas it is required for IL-2 and TNF-␣
transcription (Baeuerle and Henkel, 1994). In contrast,
NFAT is clearly required for IL-5 (Lee et al., 1995; Rao et al.,
1997), IL-2, IL-10, and TNF-␣ transcription (Rao et al., 1997).
Type 2 cytokines such as IL-10 and IL-5 (Platzer et al., 1994;
Lee et al., 1995), but not IL-2 (Crabtree and Clipstone, 1994),
also have CRE elements in their promoters. TNF-␣ promoter
contains several AP-1/CRE-like binding sites that may bind
to those factors and are stimulated by PTX treatment (Newell et al., 1994). For these reasons, cAMP will be effective
against NF-␬B-dependent cytokines (TNF-␣ and IL-2),
whereas PDE4 inhibitors will also affect cytokines that require NFAT, as do type 2 cytokines. cAMP has been shown to
induce IL-10 and IL-5 secretion in several cell types probably
through binding to the CRE sites of their promoters. It is
likely that the weak inhibition of type 2 cytokines secretion
by dBcAMP may be secondary to the inhibition on cell proliferation, because all those parameters have similar sensitivity to cAMP and cytokine production in T cells is dependent on proliferation. Therefore, the unique NFAT inhibition
by RP may explain why this drug and not dBcAMP inhibits
IL-5 and IL-10 production. The smaller inhibitory effect of
cAMP compared with RP on TNF-␣ transcription may be due
to its exclusive inhibitory effect on NF-␬B and not on NF-␬B
and NFAT as in the case of RP or partially compensated by
enhanced AP-1/CRE binding (Newell et al., 1994). On the
other hand, IL-2-dependent transcription in normal human T
cells is more dependent on NFAT/AP-1 than on NF-␬B (Tsuruta et al., 1995). This may explain why IL-2 transcription is
poorly inhibited by cAMP and why PKA inhibitors did not
prevent RP inhibition. Thus, the relative contribution of the
different nuclear factors to transcription of the various cytokines and the sensitivity of those factors to inhibition by the
different drugs will determine the outcome.
The strong inhibitory effect of RP on type 2 cytokines and
not of IFN-␥ is somewhat surprising, because RP has been
proven effective to treat inflammatory diseases, such as multiple sclerosis, which are thought to be Th1-mediated and in
which type 2 cytokines play a beneficial role (Muñoz-Fernández and Fresno, 1998). However, although RP ameliorates the disease, it had no effect on IFN-␥ production by
autoimmune Th1 cells ex vivo (Sommer et al., 1995), in
agreement with our results. Neither NFAT nor NF-␬B are
required for IFN-␥ transcription, whereas AP-1 is stimulatory (Barbulescu et al., 1997). This would explain why IFN-␥
secretion is rather insensitive to RP.
It is generally thought that pharmacological agents that
increase cAMP, such as cholera toxin, PGE2, and forskolin
inhibited type 1 cytokine production (IL-2 and IFN-␥) but
had no effect on type 2 cytokine (IL-4, IL-5, and IL-10) production (Muñoz et al., 1990; Katamura et al., 1995). How-
Downloaded from jpet.aspetjournals.org at ASPET Journals on June 18, 2017
Therefore, there is challenge to identify the molecular mechanism by which PDE4 inhibitors exert their anti-inflammatory activities. Here, we have used primary T-cell cultures
and efficient systems of transfection of normal resting peripheral blood T cells. These systems provide a sensitive and
physiologically relevant model for study of the molecular
mechanism resulting from PDE4 inhibition and to clarify its
role in the regulation of cytokine secretion.
We have found that the specific inhibition of PDE4 by RP
reduces the production of several cytokines such as IL-5,
IL-10 (type 2 cytokines), TNF-␣, and IL-2 but poorly affects
IFN-␥ (a type 1 cytokine) and T-cell proliferation in response
to activation by anti-CD3. Similar poor sensitivity of T-cell
proliferation (Essayan et al., 1994) and IFN-␥ secretion
(Sommer et al., 1995) to RP has been reported previously.
Interestingly, our results show that PDE inhibitors exert an
inhibitory effect on transcriptional activity of TNF-␣ and IL-2
promoters. Furthermore, our results indicate that RP suppresses not only NF-␬B but also NFAT activation. Because
both transcription factors are required for cytokine synthesis
(Fraser et al., 1993; Crabtree and Clipstone, 1994), our results strongly suggest that the effect of PDE inhibitors on
cytokine transcription may be attributed to their ability to
inhibit NF-␬B and NFAT activation.
PDE4 inhibition by RP increased intracellular cAMP in
many systems (Teixeira et al., 1997) as well as in ours
(J. L. Jiménez, R. A. Muñoz-Fernández, and M. Fresno, data
not shown). Previous reports have assigned all activities of
PDE4 inhibitors to elevations on cAMP. Thus, at the molecular level, the most obvious mechanism leading to the effects
caused by RP may involve cAMP-dependent pathways. However, our results indicate that exogenous addition of permeable cAMP analogs cannot completely mimic RP activities.
Thus, secretion of type 2 cytokines, IL-10 and IL-5, by activated T cells was poorly inhibited by dBcAMP, compared
with TNF-␣ and IL-2, in agreement with other reports (Benbernou et al., 1997). In addition, dBcAMP showed no inhibition of NFAT activation in primary T cells, in contrast to RP.
Besides we have found that other PDE inhibitors, although
not specific of PDE4, such as PTX, behaved similarly to RP
and not like cAMP. Because T lymphocytes contain PDE3
and PDE4 but PDE3 inhibition has no effect on cell function
(Giembycz et al., 1996; Essayan et al., 1997) it is likely that
the effects of PTX in T cells can be mostly attributed to PDE4
inhibition. Inhibition by RP of TNF-␣ but not of IL-10 production by activated T cells can be reverted (at least partially) by the PKA inhibitor KT 5720. Furthermore, the inhibition of TNF-␣ but not IL-2 promoter activity (or NFAT
activity) observed in the presence of RP can be reverted by
KT 5720. Taken together, our results clearly indicate that
IL-10 inhibition by PDE inhibitors, such as RP, cannot be
accounted for their ability to increase cAMP and are indicative that PDE inhibition may affect some activities independent of a cAMP-PKA pathway.
At the molecular level elevated cAMP has been shown to
inhibit NF-␬B activation in transformed T cells, measured
both by EMSA and transient transfection of reporter genes
(Chen and Rothenberg, 1994; Haraguchi et al., 1995). In
contrast, dBcAMP did not inhibit NFAT activation (Chen and
Rothenberg, 1994; Haraguchi et al., 1995), except when used
at very high concentration (Tsuruta et al., 1995). On the
contrary, cAMP stimulated AP-1 (Chen and Rothenberg,
Phosphodiesterase 4 Controls NF-␬B and NFAT Activation
Acknowledgments
We are grateful to those who helped us with different reagents as
mentioned under Materials and Methods and to Marı́a Chorro and
Lucı́a Horrillo for excellent technical assistance.
References
Baeuerle PA and Henkel T (1994) Function and activation of NF-kappa B in the
immune system. Annu Rev Immunol 12:141–179.
Barbulescu K, Meyer zum Buschenfelde KH and Neurath MF (1997) Constitutive
and inducible protein/DNA interactions of the interferon-gamma promoter in vivo
in CD45RA and CD45R0 T helper subsets. Eur J Immunol 27:1098 –1107.
Beavo JA, Conti M, and Heaslip RJ (1994) Multiple cyclic nucleotide phosphodiesterases. Mol Pharmacol 46:399 – 405.
Benbernou N, Esnault S, Shin HC, Fekkar H, and Guenounou M (1997) Differential
regulation of IFN-gamma, IL-10 and inducible nitric oxide synthase in human T cells
by cyclic AMP-dependent signal transduction pathway. Immunology 91:361–368.
Berridge MJ (1997) Lymphocyte activation in health and disease. Crit Rev Immunol
17:155–178.
Crabtree GR and Clipstone NA (1994) Signal transmission between the plasma
membrane and nucleus of T lymphocytes. Annu Rev Biochem 63:1045–1083.
Crocker IC, Townley RG, and Khan MM (1996) Phosphodiesterase inhibitors suppress proliferation of peripheral blood mononuclear cells and interleukin-4 and -5
secretion by human T-helper type 2 cells. Immunopharmacology 31:223–235.
Chan SC, Li SH, and Hanifin JM (1993) Increased interleukin-4 production by atopic
mononuclear leukocytes correlates with increased cyclic adenosine monophosphate-phosphodiesterase activity and is reversible by phosphodiesterase inhibition. J Invest Dermatol 100:681– 684.
Chen D and Rothenberg EV (1994) Interleukin 2 transcription factors as molecular
targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles. J Exp Med 179:931–942.
Deng T and Karin M (1993) JunB differs from c-Jun in its DNA-binding and
dimerization domains, and represses c-Jun by formation of inactive heterodimers.
Genes Dev 7:479 – 490.
Durand DB, Shaw JP, Bush MR, Replogle RE, Belagaje R, and Crabtree GR (1988)
Characterization of antigen receptor response elements within the interleukin-2
enhancer. Mol Cell Biol 8:1715–1724.
Essayan DM, Huang SK, Kagey-Sobotka A, and Lichtenstein LM (1995) Effects of
nonselective and isozyme selective cyclic nucleotide phosphodiesterase inhibitors
on antigen-induced cytokine gene expression in peripheral blood mononuclear
cells. Am J Respir Cell Mol Biol 13:692–702.
Essayan DM, Huang SK, Undem BJ, Kagey-Sobotka A and Lichtenstein LM (1994)
Modulation of antigen- and mitogen-induced proliferative responses of peripheral
blood mononuclear cells by nonselective and isozyme selective cyclic nucleotide
phosphodiesterase inhibitors. J Immunol 153:3408 –3416.
Essayan DM, Kagey-Sobotka A, Lichtenstein LM, and Huang SK (1997) Differential
regulation of human antigen-specific Th1 and Th2 lymphocyte responses by
isozyme selective cyclic nucleotide phosphodiesterase inhibitors. J Pharmacol Exp
Ther 282:505–512.
Feldmann M, Brennan FM, and Maini RN (1996) Role of cytokines in rheumatoid
arthritis. Annu Rev Immunol 14:397– 440.
Foissier L, Lonchampt M, Coge F, and Canet E (1996) In vitro down-regulation of
antigen-induced IL-5 gene expression and protein production by cAMP-specific
phosphodiesterase type 4 inhibitor. J Pharmacol Exp Ther 278:1484 –1490.
Fraser JD, Straus D, and Weiss A (1993) Signal transduction events leading to T-cell
lymphokine gene expression. Immunol Today 14:357–362.
Giembycz MA, Corrigan CJ, Seybold J, Newton R, and Barnes PJ (1996) Identification of cyclic AMP phosphodiesterases 3, 4 and 7 in human CD4⫹ and CD8⫹
T-lymphocytes: role in regulating proliferation and the biosynthesis of interleukin-2. Br J Pharmacol 118:1945–1958.
Haraguchi S, Good RA, and Day NK (1995) Immunosuppressive retroviral peptides:
cAMP and cytokine patterns. Immunol Today 16:595– 603.
Jiang X, Paskind M, Weltzien R, and Epstein PM (1998) Expression and regulation
of mRNA for distinct isoforms of cAMP-specific PDE-4 in mitogen-stimulated and
leukemic human lymphocytes. Cell Biochem Biophys 28:135–160.
Karin M, Liu Z, and Zandi E (1997) AP-1 function and regulation. Curr Opin Cell
Biol 9:240 –246.
Katamura K, Shintaku N, Yamauchi Y, Fukui T, Ohshima Y, Mayumi M, and
Furusho K (1995) Prostaglandin E2 at priming of naive CD4⫹ T cells inhibits
acquisition of ability to produce IFN-gamma and IL-2, but not IL-4 and IL-5.
J Immunol 155:4604 – 4612.
Lee HJ, Masuda ES, Arai N, Arai K, and Yokota T (1995) Definition of cis-regulatory
elements of the mouse interleukin-5 gene promoter. Involvement of nuclear factor
of activated T cell-related factors in interleukin-5 expression. J Biol Chem 270:
17541–17550.
Li L, Yee C, and Beavo JA (1999) CD3- and CD28-dependent induction of PDE7
required for T cell activation. Science (Wash DC) 283:848 – 851.
Molitor JA, Walker WH, Doerre S, Ballard DW, and Greene WC (1990) NF-kappa B:
a family of inducible and differentially expressed enhancer-binding proteins in
human T cells. Proc Natl Acad Sci USA 87:10028 –10032.
Muñoz E, Zubiaga AM, Merrow M, Sauter NP, and Huber BT (1990) Cholera toxin
discriminates between T helper 1 and 2 cells in T cell receptor-mediated activation:
role of cAMP in T cell proliferation. J Exp Med 172:95–103.
Muñoz-Fernández MA and Fresno M (1998) The role of tumour necrosis factor,
interleukin 6, interferon-gamma and inducible nitric oxide synthase in the development and pathology of the nervous system. Prog Neurobiol 56:307–340.
Navarro J, Punzon C, Jimenez JL, Fernandez-Cruz E, Pizarro A, Fresno M, and
Munoz-Fernandez MA (1998) Inhibition of phosphodiesterase type IV suppresses
human immunodeficiency virus type 1 replication and cytokine production in
primary T cells: involvement of NF-kappaB and NFAT. J Virol 72:4712– 4720.
Newell CL, Deisseroth AB, and Lopez-Berestein G (1994) Interaction of nuclear
proteins with an AP-1/CRE-like promoter sequence in the human TNF-alpha gene.
J Leukoc Biol 56:27–35.
Pimentel-Muiños FX, Muñoz-Fernández MA, and Fresno M (1994) Control of T
lymphocyte activation and IL-2 receptor expression by endogenously secreted
lymphokines. J Immunol 152:5714 –5722.
Platzer B, Meisel C, Vogt K, Platzer M, and Volk HD (1994) Up-regulation of monocytic
IL-10 by tumor necrosis factor-␣ and cAMP elevating drugs. Int Immunol 4:517.
Rao A, Luo C, and Hogan PG (1997) Transcription factors of the NFAT family:
regulation and function. Annu Rev Immunol 15:707–747.
Sassone-Corsi P (1995) Transcription factors responsive to cAMP. Annu Rev Cell Dev
Biol 11:355–377.
Schwaninger M, Blume R, Oetjen E, Lux G, and Knepel W (1993) Inhibition of
cAMP-responsive element-mediated gene transcription by cyclosporin A and
FK506 after membrane depolarization. J Biol Chem 268:23111–23115.
Soderling SH and Beavo JA (2000) Regulation of cAMP and cGMP signaling: new
phosphodiesterases and new functions. Curr Opin Cell Biol 12:174 –179.
Sommer N, Làschmann PA, Northoff GH, Weller M, Steinbrecher A, Steinbach JP,
Lichtenfels R, Meyermann R, Riethmüller R, Fontana A, et al. (1995) The antidepressant rolipran suppresses cytokine production and prevents autoimmune encephalomyelitis. Nature Medicine 3:244.
Stranick KS, Zambas DN, Uss AS, Egan RW, Billah MM, and Umland SP (1997)
Identification of transcription factor binding sites important in the regulation of
the human interleukin-5 gene. J Biol Chem 272:16453–16465.
Teixeira MM, Gristwood RW, Cooper N, and Hellewell PG (1997) Phosphodiesterase
(PDE)4 inhibitors: anti-inflammatory drugs of the future? Trends Pharmacol Sci
18:164 –171.
Tsuruta L, Lee HJ, Masuda ES, Koyano-Nakagawa N, Arai N, Arai K, and Yokota T
(1995) Cyclic AMP inhibits expression of the IL-2 gene through the nuclear factor
of activated T cells (NF-AT) site, and transfection of NF-AT cDNAs abrogates the
sensitivity of EL-4 cells to cyclic AMP. J Immunol 154:5255–5264.
Yang KD, Chuen HL, and Shaio MF (1995) Pentoxifylline augments but does not
antagonize TNF alpha-mediated neuroblastoma cell differentiation: modulation of
calcium mobilization but not cAMP. Biochem Biophys Res Commun 211:1006 –1014.
Address correspondence to: Dr. Manuel Fresno, Centro de Biologı́a Molecular
“Severo Ochoa”, Consejo Superior de Investigaciones Cientificas, Universidad
Autónoma de Madrid, E-28049 Madrid, Spain. E-mail: [email protected].
Downloaded from jpet.aspetjournals.org at ASPET Journals on June 18, 2017
ever, in agreement with our results, an increasing number of
recent reports indicate that PDE inhibitors, such as PTX and
RP, also inhibit type 2 cytokine (IL-4, IL-5, and IL-10) secretion
by T cells (Chan et al., 1993; Essayan et al., 1995; Crocker et al.,
1996; Foissier et al., 1996). These apparent discrepancies could
be now explained by our results on the inhibition of NFAT and
NF-␬B by PDE4 inhibitors and only NF-␬B by cAMP.
Taken together, our results may provide a molecular explanation for the described apparently discrepant results of
PDE inhibitors on the synthesis of several cytokines and the
lack of correlation with cAMP. It is likely that the effect of
PDE4 inhibitors in the in vitro transcription of a particular
cytokine may depend on the relative contribution of AP-1 and
CREB (enhanced by RP) versus NF-␬B and NFAT (inhibited
by RP) to the transcriptional activation of their respective
promoters. Some activities resulting from PDE4 inhibition
(i.e., TNF-␣ and NF-␬B suppression) are likely due to stimulation of the cAMP-PKA pathway, whereas others are due to
its ability to block other cellular functions such as NFAT
activation, which does not seem to involve this pathway. Our
experiments with KT 5720 indicate, indirectly in the case of
the IL-2 promoter or directly with NFAT-reporter genes, that
these effects are not mediated by PKA. Experiments are in
progress to elucidate the molecular link between PDE4 inhibition and decreased NFAT activity. Reported cellular
changes induced by the PDE inhibitor PTX include not only
cAMP elevation but also alterations in Ca2⫹ intracellular
content (Yang et al., 1995). This latter effect may contribute
to explain its effect on NFAT, because ts activation is
strongly dependent on Ca2⫹ (Rao et al., 1997) Besides, our
results confirm the role of PDE4 in T-cell activation (Jiang et
al., 1998) and indicate that PDE4 might be an additional
therapeutic target for treatment of immune dysfunctions.
759