From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
Expression of Human Blood Coagulation Factor XI: Characterization of the
Defect in Factor XI Type I11 Deficiency
By Joost C.M. Meijers, Earl W. Davie, and Dominic W. Chung
Human factor XI (FXI) is a blood coagulation factor participating in the early phase of the intrinsic pathway of blood
coagulation. It circulates in blood as a glycoprotein composed of two identical chains held together by a single
disulfide bond between the fourth apple domains. FXI has
been expressed in baby hamster kidney (BHK) cells, where it
was synthesized as a single-chain molecule that was converted to the dimer before secretion. The recombinant protein was fully active in a clotting assay, indicating that it
interacted readily with other components of the coagulation
cascade. A mutant FXI in which Phe283 was converted to Leu
(Phe283Leu)was also expressed in BHK cells. This amino acid
F
ACTOR XI (FXI) is a zymogen of a serine protease
that participates in the intrinsic or contact phase of
the blood coagulation cascade.’ Human FXI is a glycoprotein that consists of two identical polypeptide chains held
together by a single disulfide bond. It is converted to FXIa,
a serine protease, by thrombin in the presence of a
negatively charged surface: or by FXIIa in the presence of
high molecular weight kininogen and a polyanionic surface.’ During the activation of FXI, a single internal
ArgJle peptide bond in each of the two polypeptide
chains is cleaved. FXIa is composed of two heavy and two
light chains, which are held together by three disulfide
bonds? Each of the light chains contains the catalytic
portion of the enzyme and is homologous to the trypsin
family of serine proteases. Each of the heavy chains consists
of four apple domains of 90 (or 91) amino acids: with
characteristic disulfide bonds.’ The first apple domains are
responsible for the binding of FXI to high molecular weight
kininogen?6 while the second apple domains are involved in
the calcium-dependent binding of FXI to FIX.7s8
FXI deficiency is a disorder characterized by a mild or no
bleeding tender~cy.~.”
The vast majority of the FXI deficiencies have been found in the Ashkenazi Jewish population.
Recently, the occurrence of three point mutations in the
gene for FXI in Ashkenazi Jewish patients has been
described.””’ The type I mutation was rare and involved a
nucleotide change at an intronlexon splice junction in the
last intron (intron N) of the gene. This mutation interferes
with the splicing of the messenger RNA (mRNA). The two
most prevalent mutations were type 11, resulting in the
conversion of Glu 117 to a stop codon in the second apple
domain, and type 111, an amino acid substitution of Leu for
Phe at position 283 (Phe283Leu) in the fourth apple
domain. Although the Phe283Leu conversion was the only
change found in the coding region of the gene, it was not
certain whether this mutation caused the FXI deficiency
directly or was linked to an unidentified mutation. Therefore, the in vitro expression of normal human FXI has been
investigated and compared with the expression of the
Phe283Leu mutant FXI in baby hamster kidney (BHK)
cells. Characterization of both the normal and mutant FXI
proteins showed that the Phe283Leu mutation caused an
impaired dimerization and secretion of FXI.
Blood, Vol79, No 6 (March 15), 1992: pp 1435-1440
change occurs in the fourth apple domain of FXI and corresponds to the type 111 deficiency in Ashkenazi Jews. The
mutant protein was secreted at reduced levels (about 8%)
compared with normal FXI. This was due to a defect in the
dimerization of the molecule rather than a decrease in the
transcription of type 111 messenger RNA. Once secreted,
however, the mutant protein consisted of a dimer with full
biologic activity. The in vitro expression of FXI indicatedthat
the impaired dimerization and secretion of the Phe283Leu
mutant can account for the defect found in patients who are
homozygousfor the type 111 FXI deficiency.
Q 1992by The American Society of Hematology.
MATERIALS AND METHODS
Construction of qression vectors. Human FXI cDNA was
subcloned from the original pBR322 vector4into the EcoRI site of
pZEM229R for expression, and into M13mp18 for mutagenesis.
The pZEM229R was kindly provided by Dr E.R. Mulvihill,
(Zymogenetics Inc, Seattle, WA).14 The oligonucleotide primer
PXI-M3 (GACACTGATCTCTTGGGAGAA)was synthesized on
an Applied Biosystems Synthesizer (Foster City, CA) and used for
mutagenesis of amino acid residue 283 from Phe to Leu. Mutagenesis was performed using T7-GEN (US Biochemicals, Cleveland,
OH) by the method of Vandeyar et al.” The mutation in the cDNA
was confirmed by dideoxy sequencing and the new construct was
then cloned into pZEM229R.
Plasmids were transformed in Escherichia coli RR1 cells and
grown in Terrific Broth for large-scale preparation.16Alkaline lysis
and CsCl banding were performed according to standard procedures,16with the addition of phenol-chloroformextractions before
and after CsCl banding. The authenticity of the FXI cDNA inserts
was verified by dideoxy sequencingof the transfection plasmids.
Cell culture. A thymidine kinase-deficientBHK cell line, BHK570 (ATCC no. CRL 10314), was used as the host cell for the
transfection experiments. Cells were grown in Dulbecco’smodified
Eagle medium (DMEM), 5% fetal bovine serum (FBS), 50 kg/mL
penicillin, 50 pg/mL streptomycin, and 100 pg/mL neomycin
(GIBCO, Grand Island, NY)in a 5% CO, atmosphere at 37°C. For
transfection, BHK-570 cells were plated at 1:25 split ratios in
150-mm plates (Falcon, Oxnard, CA) overnight and transfected for
4 hours in 10 mL of medium with 30 kg of plasmid precipitated
with calcium phosphate. After a 1-minute shock in 15% glycerol in
Tris-phosphate-buffered saline (PBS) (25 mmol/L Tris-HC1, pH
7.4, 0.14 mol/L NaCl, 5 mmol/L KCl, 0.7 mmol/L CaCI,, 0.5
mmol/L MgCI,, and 0.6 mmol/L Na,HPO,),” the cells were grown
From the Department of Biochemisty, University of Washington,
Seattle.
Submitted August 22,1991; accepted November 1,1991.
Supported by Research Grant No. HL16919 from the National
Institutes of Health.
Address mprint requests to Earl W. Davie, PhD, Dept. of Bwchemistry SI-70, University of Washington, Seattle, WA 98195.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
8 1992 by The American Society of Hematology.
0006-4971I92 I 7906-0021$3.00/0
1435
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1436
for 24 hours in normal medium. The cells were then subjected to
selective medium containing 1 pmol/L methotrexate for 7 to 10
days. Random clones were picked and propagated.
For studies of intracellular biosynthesis and secretion of recombinant FXI (rFXI), the clones were grown to confluence in 100- or
150-mm plates. At confluence,the cells were washed twice with 120
mmol/L NaCI, 2.7 mmol/L KCl, 10mmol/L sodium phosphate, pH
7.4 (PBS). Serum-free medium was then added, and collected after
24 hours. The cells were washed twice with PBS, and treated with
RIPA (10 mmol/L HEPES, pH 7.5, 50 mmol/L NaCl, 5 mmol/L
EDTA, 0.3 mol/L sucrose, 1%Triton X-100,0.5% sodium deoxycholate, 0.2% sodium dodecyl sulfate [SDS]) for 1 minute. The
RIPA fraction was used as an intracellular pool for protein and
FXI determinations.
To purify secreted rFXI, the FXI-secretingcell line rFXI-24 was
grown in 20 150-mm plates. Confluent monolayers were washed
twice with PBS containing 0.01% CaCl, and 0.01% MgCl,. Serumfree medium was added, and collected every 24 hours for 4 to 5
days. Daily collections were made, 10 mmol/L in benzamidine and
0.1 mmol/L in DFP, stirred for 15 minutes at room temperature,
and centrifuged at 10,OOOgfor 20 minutes at 4°C. The supernatant
was diluted with an equal volume of water and then applied to a
CM-Sephadex column (2.5 X 10 cm), previously equilibrated with
phosphate buffer (20 mmol/L sodium phosphate, pH 7.0, 50
mmol/L NaCl, 0.02% sodium azide). rFXI was eluted with 20
mmol/L sodium phosphate buffer, pH 7.0, containing 0.6 mol/L
NaCl. The eluted protein was then applied to a high molecular
weight kininogen peptide IV column,'8 as described by Naito and
Fujikawa? The yield of purification of rFX1 varied between 15%
and 30%.
rFXI (300 pmol) was desalted on an HPLC C3 column, and
sequenced using a Model 477A Applied Biosystems protein sequencer.
RNA extraction, Northem blotting and hybridization. Total cytoplasmic RNA was prepared from control or transfected BHK cells
by the single-step method of Chomczynsky and Sacchi.'' RNA
samples were denatured in a formamidelformaldehydesolution as
described by Sambrook et all6 for 15 minutes at 55"C, and
separated by electrophoresis in a denaturing 1.2% agarose gel.
Transfer of the RNA to nitrocellulose was performed with a
Vacuum Blotting System (Pharmacia-LKB, Piscataway, NJ). After
transfer, the RNA was crosslinked to the membrane by a W
Stratalinker (Stratagene, La Jolla, CA). Blots were then prehybridized for 4 hours and hybridized for 20 hours at 42°C in a solution
containing 50% deionized formamide, 6X SSC (1X SSC is 150
mmol/L NaCl, 15 mmol/L sodium citrate), 50 mmol/L sodium
phosphate, 0.1 mg/mL yeast total RNA, and 2X Denhardt's
solution (1X Denhardt's is 0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin). Posthybridization washes
were performed to a final stringency of 0.2X SSC/O.l% SDS at
65°C for the FXI cDNA probe and 0.1X SSC/O.l% SDS at 65°C for
the 28s RNA cDNA probe. The density of autoradiographic
signals was quantitated with a laser scanningdensitometerequipped
with an integrator (DU-79 Spectrophotometer; Beckman, Fullerton, CA). Values of 28s RNA were used to correct for differences
in the loading of RNA.
Preparation of DNA probes. The FXI cDNA probe was the
full-length cDNA obtained from the pBR322 plasmid." A 280-bp
bovine 28s ribosomal subunit cDNA probe (kindly provided by Dr
E. H. Sage, University of Washington) was used for normalization
of the RNA concentrations. DNA fragments were nick-translated
with a Multiprime DNA labeling system (Amersham, Arlington
Heights, IL) in the presence of [32P]-d(TP(Amersham).
MEIJERS, DAVIE, AND CHUNG
Metabolic labeling studies. Metabolic labeling studies were performed in 6- or 24-well plates in cysteine-free minimum essential
medium (MEM) or DMEM, 50 pg/mL penicillin, 50 pg/mL
streptomycin, 100 pg/mL neomycin, and 50 to 100 pCi/mL
[3sS]-L-cysteine (Amersham) in a 5% COzatmosphere at 37°C for
24 hours. The intracellular proteins were obtained by RIPA
treatment as described above. The supernatants and RIPA fractions were precleared for 1 hour at 4°C with 10 pL of a 1:l
suspension of goat antimouse Igs coupled to agarose (Sigma, St
Louis, MO). After centrifugation, the supernatant was transferred
to a tube containing 1 pg of an FXI monoclonal antibody (XI-5)"
and incubated on ice for 1hour. Ten microliters of a 1:l suspension
of goat antimouse Igs coupled to agarose was then added and the
mixture was incubated for 2 hours at 4°C with rotation. The agarose
was washed four times by centrifugation (three times with 50
mmol/L Tris, pH 7.4, 0.5 mol/L NaCl, 0.1% NP-40 followed by a
wash with 50 mmol/LTris, pH 7.4,0.15 mol/L NaCl). After the last
wash, 50 pL of Laemmli-buffer containing 5% SDS was added and
incubated for 60 minutes at 37°C before SDS-polyacrylamidegel
electrophoresis (SDS-PAGE). After electrophoresis, the gel was
fixed and treated with Amplify (Amersham) according to the
instructionsof the manufacturer before autoradiography.
Analytical methods. Protein determinations were performed
with the BCA-assay (Pierce, Rockford, IL) using bovine serum
albumin as reference.
SDS-PAGE and immunoblotting were performed as described
by Laemmli" and Towbin et al,= respectively. Prestained and
[14C]-labeled molecular weight markers were obtained from Bethesda Research Laboratories (Bethesda, MD). The loading per
lane was adjusted to the amount of cellular protein.
FXI activity was determined in a one-stage clotting assay using
FXI-deficient bovine plasma.I8 FXI antigen was determined with
an enzyme-linked immunosorbent assay (ELISA), using a monoclonal antibody to FXI as primary antibody, and immunopurified
rabbit antibodies to Flu as secondary antibody.20Normal human
plasma (George King Biomedical, Overland Park, KS) was used as
reference for both the clotting and the ELISA assays.
Oxidation of rFXI was performed according to Himz3and the
amino acid composition of the oxidized sample was determined
with a Waters Picotag system (Waters, Milford, MA) as described
by Bidlingmeyer et al.%
RESULTS AND DISCUSSION
Expression vectorsfor human rFXI. An expression vector
was constructed by cloning the cDNA coding for human
FX14 into pZEM229R.14 This plasmid, designated
pZEM229R-XI, is a pUC-based vector that includes a
dihydrofolate reductase cDNA as selectable marker (Fig
1). The FXI cDNA was placed under the control of a
modified version of the metallothionein promoter that was
in juxtaposition to the SV40 enhancer. The metallothionein
promoter has nearly full induced transcriptional activity in
this construct. The SV40 terminator was used to insure
proper termination of the FXI mRNA. The normal FXI
cDNA was also subjected to site-specific mutagenesis by
converting nucleotide 944 from T to C. This resulted in an
amino acid change of Phe283 to Leu that is characteristicof
the type I11 FXI deficiency in Ashkenazi Jews." This
construct was also cloned into pZEM229R for expression,
and designated pZEM229R-XI-Phe283Leu.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1437
FACTOR XI TYPE 111 DEFICIENCY
SV40
DHFR
Fig 1. Expressionvector for human FXI. The FXI cDNA was cloned
into the EcoRl site of pZEM229R under the control of the modified
methallathionein(MT-1) promoter. The dlhydrofolate reductase(DHFR)
cDNA was used as selectable marker.
Expression of rFXI in BHK cells. The BHK cell line
BHK-570 that is deficient in thymidine kinase was used as
the host cell line for transfection, because it readily expresses many proteins of the coagulation and fibrinolytic
pathways, and allows amplification of expression vectors
containing the dihydrofolate reductase selectable marker.
Transfection of BHK-570 cells with pZEM229R-XI or
pZEM229R-XI-Phe283Leu and selection with 1 pmol/L
methotrexate resulted in numerous FXI-secreting colonies
as measured by ELISA. The cell lines used in characterization of the proteins were called rFXI and rFXI-Phe283Leu.
rFXI was then isolated from a large-scale cell culture
preparation by affinity chromotography using a peptide
derived from high molecular weight kininogen." The purified rFXI was indistinguishable from plasma-derived FXI
on slab gel electrophoresis, under reducing and nonreducing conditions (Fig 2). In addition, rFXI was biologically
active with a specific clotting activity of 250 U h g .
An amino-terminal sequence analysis of the first eight
residues of rFXI showed the following: Glu-X-Val-Thr-GlnLeu-Leu-Lys. This sequence was identical to the aminoterminal sequence of human FXI,4.25with X being Cys. It
was distinctly different from the bovine sequence of Glu-CysVal-Thr-Thr-Leu-Phe-Gln.26
Accordingly, the purified FXI
was the human protein and not derived from bovine serum
used during tissue culture.
Recently, McMullen et al' reported that Cys-11 was not
involved in dimer formation of FXI, but was bound to a
single Cys residue. To investigate whether rFXI also had a
Cys residue bound to Cys-11, the cysteic acid contents of
oxidized intact rFXI (without sample hydrolysis) was analyzed. rFXI contained 0.6 moles of cysteic acid per mole of
subunit of FXI. These data show that rFXI was essentially
identical in structure and function to the plasma-derived
FXI.
Characterizationof FXI Phe283ku. Recently, Asakai et
all' reported the defects in six FXI-deficient patients of
Ashkenazi Jewish origin. Three point mutations were
identified. Two of the mutations could account for the
observed deficiency, because they resulted in the formation
of a premature stop-codon, or a change that disrupted an
intron-exon splice boundary. The third mutation was an
amino acid substitution of Leu for Phe at position 283. This
mutant was also characterized using the in vitro expression
system. Cells transfected with the FXI-Phe283Leu expression vector secreted about 8% of the level of cells expressing the normal factor XI (Table 1). This level was similar to
that observed in patients homozygous for type 111 FXI
defi~iency.'~''This secretion level was consistent with the
conclusion that the substitution of Leu for Phe at position
283 was responsible for the type I11 FXI deficiency. It also
implies that the in vitro expression system for FXI type I11
accurately represents the defect found in these patients and
provides a good system for studying the molecular mechanism.
Western blot analysis of secreted rFXI and rFXIPhe283Leu showed that both molecules were dimers with
molecular weights identical to plasma-derived FXI on
1
2
1
2
10068-
43-
2718-
+ SH
SH
Fig 2. SDS-PAGE analysis of rFXI. rFXl (lanes 1) and plasmapurifiedFXI (lanes 2) were analyzedon a 10% gel in the absence (-SH)
or presence (+SH) of a reducing agent. The proteinswere visualized
by Coomassie staining. The molecular weights of the prestained
markers are indicated in kilodakons.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1438
MEIJERS, D A W , AND CHUNG
Table 1. Charactedzatlon of rFXl and rFXI-Phe283LeccRoducing
Cell Uner
Specific Activity
(U/U)t
Expression Levels
IUlmL)’
rFXl
rFXI-Phe283Leu
0.20 c 0.09 (n = 9)
0.017 2 0.01 (n = 4)
0.71
0.68
z 0.24 (n = 9)
1 2 3
A
(n = 1)
*Expression levels were determined from 24-hour serum-free medium collections (10 mL) of 10-cm confluent plates. Antigen was
determined with an ELSA as described in Materials and Methods.
Confluent plates contained 0.88 z 0.07 mg of cellular protein. Data are
expressed as mean c SD, with 1 U being the amount of FXI present in 1
mL of normal plasma. n represents the number of FXCsecreting cell
lines.
TSpecific activity is expressed as clotting activity per unit of antigen.
--
-28s
-18s
SDS-PAGE (Fig 3). The minor band visible in Fig 3 with an
apparent molecular weight of 60 Kd represents monomeric
FXI under nonreducing conditions. These data suggested
that the secreted proteins were fully processed. Both
recombinant proteins were also active in clotting assays
(Table 1). Normal rFXI had a specific clotting activity to
antigen ratio of 0.71 k 0.24 (mean -c SD of nine different
FXI-producing clones) compared with 0.68 for the
Phc283Leu mutant protein.
Northern analyses were also performed to investigate
whether the difference in secretion between normal rFXI
1
2
4
5 4. Nod”a n a w of wlh ..arting rFXland rFXI-ph.283L.u.
Total RNA from BHK cells (lane 1). rFXl-secmtlng cells (lane 2), and
rFXI-Phe283Leu-secreting cells (lane 3) were electrophoresed and
blotted t o a nitrocellulose membrane. The membrane was hybridized
with an FXI cDNA probe (A) or a 28s RNA cDNA probe (6). The
positions of the 18s and 28s RNA bands are indicated.
-160
- 60
5 3. Wostem analysis of rFXl and rFXI-Phe283L.u. Serum-fme
medium from cells was analyzed by SDS-PAGE and Western blotting.
A monoclonal antibody t o FXI was used as primary antibody. The
sampler used were purlfled plasma FXI (lane l),media from BHK cells
(lane 2). media from cells secreting rFXl (lane 3). and the media from
cells secreting rFXI-Phe283Leu (lane 4). The apparent molecular
weights of the bands are indicated in kilodattons.
and rFXI-Phe283Leu was caused by a decrease in the
mRNA level. Figure 4 shows that comparable levels of FXI
mRNA were present in both the FXI and FXI-Phe283Leuproducing cell lines. BHK-570 cells, which were not transfected, did not show any detectable mRNA for FXI. When
the mRNA was normalized to 28s ribosomal RNA (Fig 4,
lower panel), the level in the FXI-Phe283Leu clone was
34% higher than the mRNA level of the normal FXI clone.
This indicates that the decreased secretion by the FXI type
I11 mutant clone was not due to differences in steady-state
levels of FXI mRNA.
Metabolic labeling studies of intracellular, normal FXI
also showed that the major portion of FXI was present as a
dimeric molecule (Fig 5). The molecular weight, however,
was slightly less than the secreted FXI, suggesting that a
posttranslational step, such as glycosylation, was still necessary before secretion would occur. The mutant protein
showed a marked decrease in the amount of dimeric FXI,
together with an increase in monomeric FXI. Densitometric scanning of the autoradiographs showed that the intracellular mutant FXI was about equal in dimeric FXI
compared with monomeric FXI, while in the normal cell
line the amount of dimeric FXI was 30-fold higher than
monomeric FXI.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
FACTOR XI TYPE 111 DEFICIENCY
1439
Pulse-chase labeling experiments with the FXI and
FXI-Phe283Leu-producing cell lines indicated that secretion of normal FXI was relatively slow, resulting in cellular
accumulation of the dimeric form of FXI (Fig 6). In the
Phe283Leu mutant a significant amount of FXI was monomeric. In time, however, the monomer was converted to a
dimer and was secreted (Fig 6). The presence of an
increased amount of monomeric FXI in the type 111 mutant
implies that dimerization of the mutant protein was impaired. Once the dimer was formed, it was secreted and was
biologically active. The increased amount of monomeric
FXI in the mutant suggested that some accumulation
occurred before the formation of the dimer. It was also
possible that a portion of the monomer was degraded,
because no extensive accumulation occurred. These data
further indicate that the type 111 mutation can account
for the defect in FXI-deficient patients. It is also in
agreement with studies that found a strict correlation
between antigen and activity levels in FXI-deficient individual~?'~
There are several possible reasons for a decreased
secretion of the mutant FXI compared with wild-type FXI.
Fig 6. Pulse-chase labeling of cells secreting rFXl and +XIPhe283Leu. Cells were metabolically labeled with PSI-cysteine in
cysteine-free DMEM for 16 hours. Then the cells were washed and
chased with regular medium for the indicated times in hours. Cells
secreting rFXl (A and B), and cells secreting rFXI-Phe283Leu (C and D)
were used. The secreted proteins were immunoprecipitatedfrom the
supernatants (B and D),while the intracellular proteins were obtained
by immunoprecipitation of the RIPA-treated cells (A and C). The
proteins were separated by SDS-PAGE on 7.5% gels. The molecular
weights of the marker proteins are indicated in kilodaltons.
For instance, the mutation may interfere with the correct
folding of the fourth apple domains. Also, it may retard the
dimerization of the two chains, which involves the formation of a disulfide bond between the fourth apple domains.
This explanation seems quite likely, because the intracellular level of dimeric FXI was markedly reduced in the
mutant as compared with that of the normal molecule.
The in vitro expression system provides a unique tool for
studying the assembly and processing of FXI. Furthermore,
it provides a system by which mutations in the FXI
molecule may be selectively introduced to study structurefunction relationships.
ACKNOWLEDGMENT
Fig 5. Characterization of intracellular rFXl and rFXI-Phe283Leu.
Cells were metabolically labeled with ["Sl-cysteine in cysteine-free
MEM medium. After 24 hours, the intracellular proteins were obtained
by RlPA treatment of the cells and immunoprecipitated. The proteins
were separated by SDS-PAGEon a 7.5% gel. Lane 1, BHK cells; lane 2,
rFXl-secreting cells; lane 3, rFXI-Phe283Leu-secreting cells. The molecular weights of the marker proteins are indicated in kilodaltons.
The authors thank Brad A. McMullen for the amino acid
sequencing and the cysteic acid determinations, Dr Paula Hasselaar for help with the Northern analysis, and Drs Eileen R.
Mulvihill and E. Helene Sage for their donations of the pZEMplasmid and the 28s cDNA probe, respectively.We also thank Drs
David H. Farrell and Kazuo Fujikawa for helpful suggestions and
discussions.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1440
MEIJERS, DAVIE, AND CHUNG
REFERENCES
1. Davie EW, Fujikawa K, Kisiel W: The coagulation cascade:
Initiation, maintenance, and regulation. Biochemistry 3010363,
1991
2. Naito K, Fujikawa K Activation of human blood coagulation
factor XI independent of factor XII. Factor XI is activated by
thrombin and factor XIa in the presence of negatively charged
surfaces. J Biol Chem 2667353,1991
3. McMullen BA, Fujikawa K, Davie E W Location of the
disulfide bonds in human coagulation factor XI: The presence of
tandem apple domains. Biochemistry 30:2056,1991
4. Fujikawa K, Chung DW, Hendrickson LE, Davie E W Amino
acid sequence of human factor XI, a blood coagulation factor with
four tandem repeats that are highly homologous with plasma
prekallikrein. Biochemistry25:2417, 1986
5. Van der Graaf F, Greengard JS, Bouma BN, Kerbiriou DM,
Griffin JH: Isolation and functional characterization of the active
light chain of activated human blood coagulation factor XI. J Biol
Chem 258:9669,1983
6. Baglia FA, Jameson BA, Walsh PN: Localization of the high
molecular weight kininogen binding site in the heavy chain of
human factor XI to amino acids Phenylalanine 56 through Serine
86. J Biol Chem 265:4149,1990
7. Sinha D, Koshy A, Seaman FS, Walsh PN: Functional
characterization of human blood coagulation factor XIa using
hybridoma antibodies. J Biol Chem 260:10714,1985
8. Baglia FA, Jameson BA, Walsh PN: Identification and
chemical synthesis of a substrate-binding site for factor IX on
coagulation factor XIa. J Biol Chem 266:24190,1991
9. Schmaier AH, Silverberg M, Kaplan AP, Colman R W
Contact activation and its abnormalities, in Colman RW, Hirsh J,
Marder VJ, Salzman EW (eds): Hemostasis and Thrombosis (ed
2). Philadelphia, PA, Lippincott, 1987, p 18
10. Fujikawa K, Saito H: Contact activation, in Scriver CR,
Beaudet AL, Sly WS, Valle D (eds): The Metabolic Basis of
Inherited Disease (ed 6). New York, NY, McGraw-Hill, 1988, p
2189
11. Asakai R, Chung DW, Ratnoff OD, Davie E W Factor XI
(plasma thromboplastin antecedent) deficiency in Ashkenazi Jews
is a bleeding disorder that can result from three types of point
mutations. Proc Natl Acad Sci USA 86:7667,1989
12. Asakai R, Chung DW, Davie EW, Seligsohn U: Factor XI
deficiency in Ashkenazi Jews in Israel. N Engl J Med 325:153,1991
13. Hancock JF, Wieland K, Pugh RE, Martinowitz U, Schulman S, Kakkar VJ, Kernoff PBA, Cooper D N A molecular genetic
study of factor XI deficiency. Blood 771942,1991
14. Mulvihill ER, Berkner K, Foster D, Kumar A, McKay V,
Parker G: Co-expression in eukaryotic cells. European patent no.
0319944,1988
15. Vandeyar MA, Weiner MP,Hutton CJ,Batt C A A simple
and rapid method for the selection of oligodeoxynucleotidedirected mutants. Gene 65129,1988
16. Sambrook J, Fritsch EF, Maniatis T Molecular Cloning. A
Laboratory Manual (ed 2). Cold Spring Harbor, NY,Cold Spring
Harbor Laboratory, 1989
17. Parker BA, Stark GR: Regulation of simian virus 40 transcription: Sensitive analysis of the RNA species present early in
infections by virus or viral DNA. J Virol31:360,1979
18. Tait JF, Fujikawa K Primary structure requirements for the
binding of human high molecular weight kininogen to plasma
prekallikrein and factor XI. J Biol Chem 262:11651,1987
19. Chomczynski P, Sacchi N Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroformextraction. Anal Biochem 162156,1987
20. Meijers JCM Structure-function studies of human blood
coagulation factor XI using monoclonal antibodies. The inactivation of factor XIa studied with enzyme-linked immunosorbent
assays for factor XIa-inhibitor complexes, in Regulation of the
Blood Coagulation Mechanism by Plasma Proteinase Inhibitors.
Doctoral thesis, State University of Utrecht, The Netherlands,
1988, p 93
21. Laemmli U K Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227680,1970
22. Towbin H, Staehelin T, Gordon J: Electrophoretic transfer
of proteins to nitrocellulose sheets: Procedures and some applications. Proc Natl Acad Sci USA 764350,1979
23. Hirs CHW Determination of cystine as cysteic acid. Methods Enzymol11:59,1967
24. Bidlingmeyer BA, Cohen SA, Tarvin T L Rapid analysis of
amino acids using pre-column derivatization.J Chromatogr 336:93,
1984
25. Kurachi K, Davie E W Activation of human factor XI
(plasma thromboplastin antecedent) by factor XIIa (activated
Hageman factor). Biochemistry 165831,1977
26. Kurachi K, Fujikawa K, Davie EW: Mechanism of activation
of bovine factor XI by factor XI1 and factor XIIa. Biochemistry
19:1330,1980
27. Saito H, Ratnoff OD, Bouma BN, Seligsohn U Failure to
detect variant (CRM+) plasma thromboplastin antecedent (factor
XI) molecules in hereditary plasma thromboplastin antecedent
deficiency: A study of 125 patients of several ethnic backgrounds. J
Lab Clin Med 106:718,1985
28. Ragni M V , Sinha D, Seaman F, Lewis JH, Spero JA, Walsh
P N Comparison of bleeding tendency, factor XI coagulant activity,
and factor XI antigen in 25 factor XI-deficiency kindreds. Blood
65719,1985
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1992 79: 1435-1440
Expression of human blood coagulation factor XI: characterization of
the defect in factor XI type III deficiency
JC Meijers, EW Davie and DW Chung
Updated information and services can be found at:
http://www.bloodjournal.org/content/79/6/1435.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.