Endogenous KLF4 Expression in Human Fetal Endothelial
Cells Allows for Reprogramming to Pluripotency With Just
OCT3/4 and SOX2—Brief Report
Pai-Jiun Ho, Men-Luh Yen, Jhong-De Lin, Lan-Sun Chen, Hsin-I Hu, Chun-Kai Yeh, Chiu-Ying Peng,
Chen-Yu Lin, Shaw-Fang Yet, B. Linju Yen
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Objective—The introduction of 4 transcription factors— c-MYC, OCT3/4, SOX2, and KLF4 — can reprogram somatic
cells back to pluripotency. However, some of the factors used are oncogenic, making therapeutic application unfeasible.
Although the use of adult stem cells expressing high endogenous levels of some of these factors allows for
reprogramming with fewer exogenous genes, such cells are rare and may have accumulated genetic mutations. Our goal
was to reprogram human somatic cells without oncogenic factors. We found that high endogenous expression of KLF4
in human umbilical vein endothelial cells (HUVECs) allows for generation of induced pluripotent stem cells (iPSCs)
with just 2 nononcogenic factors, OCT3/4 and SOX2.
Methods and Results—HUVECs were infected with lentivirus containing OCT4 and SOX2 for generation of iPSCs. These
2-factor HUVEC iPSCs were morphologically similar to embryonic stem cells, express endogenous pluripotency
markers postreprogramming, and can differentiate toward lineages of all 3 germ layers both in vitro and in vivo.
Conclusion—iPSCs can be generated from HUVECs with only 2 nononcogenic factors. The use of fetal cells for
reprogramming without oncogenic factors may provide an efficient in vitro model for human iPSC research, as well as
a novel source for possible therapeutic use. (Arterioscler Thromb Vasc Biol. 2010;30:1905-1907.)
Key Words: endothelium 䡲 KLF4 䡲 OCT3/4 䡲 SOX2 䡲 fetal 䡲 induced pluripotent stem cells
T
he discovery that somatic cells can be reprogrammed to
pluripotency with the addition of 4 transcription factors—
c-Myc, Oct3/4, Sox2, and Klf4 —is revolutionary.1,2 These
induced pluripotent stem cells (iPSCs) are similar to embryonic
stem cells but can be generated without ethical concern and
transplanted without immune rejection. Although this method of
reprogramming is straightforward, efficiency is still quite low
even in the best system.3 Subsequent reports reveal that oncogenic factors increase efficiency,4 but in anticipation of clinical
use, exclusion of such factors is necessary.
See accompanying article on page 1880
proliferative and at an earlier stage of development than adult
cells, we hypothesized that reprogramming of FDCs may
require fewer factors and obviate oncogenes. As proof of
principle, we used an easily obtainable source of FDCs for
iPSC generation: human umbilical vein endothelial cell
(HUVECs). We found that HUVECs endogenously express
high levels of KLF4 and can be reprogrammed with just
OCT3/4 and SOX2. Our data may have important implications in terms of providing an efficient in vitro model for
human iPSCs research and possibly open up a new cell source
for reprogramming.
To date, the generation of human iPSCs from adult somatic
cells has been reported5,6 but generally with 3 or more factors,
because reprogramming of human cells is less efficient than
reprogramming of mouse cells3 and may require immortalization in some instances.6 Recent reports have shown that
some human adult stem cells can be reprogrammed with
relatively few factors because of endogenous expression of
SOX2.7 However, the rarity of adult stem cells makes this a
difficult option. Because fetal-derived cells (FDCs) are more
HUVECs (Bioresource Collection and Research Center, Hsinchu,
Taiwan) were infected with lentivirus containing OCT3/4 and SOX2
and monitored for iPSC formation as previously reported.1 Reprogrammed HUVECs were assayed for in vitro and in vivo differentiation capacity and characterized. For detailed methodology, please
see the Supplemental Materials and Methods, available online at
http://atvb.ahajournals.org.
Methods
Received on: March 19, 2010; final version accepted on: July 20, 2010.
From the Regenerative Medicine Research Group (P.-J.H., J.-D.L., L.-S.C., H.-I.H., C.-K.Y., and B.L.Y.) and Cardiovascular Medicine Research
Group (C.-Y.P., C.-Y.L., and S.-F.Y.), Institute of Cellular and System Medicine, National Health Research Institutes, Zhunan, Taiwan; and the
Department of Primary Care Medicine and Department of Obstetrics/Gynecology, National Taiwan University Hospital and College of Medicine National
Taiwan University, Taipei (M.-L.Y.).
Correspondence to B. Linju Yen, MD, Regenerative Medicine Research Group, Institute of Cellular and System Medicine, National Health Research
Institutes, No. 35 Keyan Road, Zhunan, Miaoli County, 350, Taiwan. E-mail [email protected]
© 2010 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
1905
DOI: 10.1161/ATVBAHA.110.206540
1906
Arterioscler Thromb Vasc Biol
October 2010
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 1. Reprogramming of HUVECs by OCT3/4 and SOX2. A, Endogenous pluripotency gene expression in FDCs before reprogramming. B to D, Characterization of iHUV2F by morphology (phase-contrast; magnification, ⫻50) (B), alkaline phosphatase (C), and immunofluorescence staining for pluripotent markers SSEA-4 and OCT3/4 (FITC) with 4⬘,6-diamidino-2-phenylindole (Dapi) (blue) for nuclear
staining (⫻100) (D). E and F, Gene expression of pluripotency genes (passage 18 iHUV2Fs) (E) and endogenous gene and transgene
expression of OCT3/4 and SOX2 (F) in HUVECs (before lentiviral infection), 6 days after infection (HUVEC ⫹2F), and after reprogramming (iHUV2F). hTERT, telomerase; hES, human embryonic stem cells; WJMSC, Whartons’ jelly-derived mesenchymal stromal cells;
PMSCs, placenta-derived mesenchymal stromal cells. NTERA indicates human teratocarcinoma cell line.
Results
Before reprogramming, FDCs including HUVECs and mesenchymal stromal cells from Wharton’s jelly and placenta do
not express the pluripotency genes OCT3/4, SOX2, REX1,
NANOG, or telomerase (Figure 1A). However, FDCs do
express KLF4, with HUVECs having the highest levels of all.
Based on the high levels of KLF4 in HUVECs, we attempted
to generate iPSCs by introducing only 2 factors, OCT3/4 and
SOX2. HUVECs infected with lentiviruses containing human
OCT3/4 and SOX2 showed embryonic stem cell–like colonies
after 2 weeks (Figure 1B), and the efficiency can reach
0.024%, which is comparable to previous reports of reprogramming with 4 factors.1 The 2-factor HUVEC iPSCs
(iHUV2F) cells were characterized for pluripotency by ALP,
SSEA-4, and OCT3/4 (Figure 1C and 1D) staining, along
with expression of pluripotency genes (Figure 1E). Transgene
expression of OCT4 and SOX2 was found in virally infected
HUVECs at day 6 (HUVEC ⫹2F) but not in iHUV2F clones
(Figure 1F), indicating transgene silencing and initiation of
endogenous gene expression. Further characterization of
HUVEC before reprogramming and postreprogramming as
iHUV2Fs in terms of proliferative potential and karyotype
analysis can be found in the Supplemental Material.
To evaluate in vitro differentiation capacity, iHUV2Fs were
cultured either as embryoid bodies before differentiation
(iHUV2F-EBs) or differentiated directly (iHUV2F-DD).
RT-PCR showed that endothelial markers were expressed highly
in HUVECs but minimally or not at all after reprogramming in
iHUV2Fs (Figure 2A). Postdifferentiation, endodermal markers
(␣-fetoprotein [AFP], cytokeratin-8, and cytokeratin-18) and
ectodermal markers (MAP2, NG2, and nestin) were expressed
by all clones of iHUV2F-EB and iHUV2F-DD, but mesodermal markers brachyury and PPAR␥ were expressed by all
clones except iHUV2F-EB clone 3 (C3). Protein expression
of AFP, vimentin, and nestin can be seen in all iHUV2F-DD
clones (Figure 2B).
In vivo differentiation capacity of iHUV2Fs by teratoma
formation was evaluated. All clones except iHUV2F-C3
formed teratomas; these results correspond to the lower
expression of mesodermal markers for the in vitro differen-
Figure 2. In vitro and in vivo differentiation of iHUV2Fs. A, Expression of genes representing 3 germ layers in iHUV2Fs, iHUV2F-EB,
and iHUV2F-DD. The genes assessed include PECAM/CD31, FLK,
VCAM, and von Willebrand Factor (vWF) for endothelium; AFP,
cytokeratin-8 (CK8), and CK18 for endoderm; brachyury and
PPAR␥ for mesoderm; and MAP2, NG2, and nestin for ectoderm.
B and C, Immunofluorescent staining of iHUV2F-DDs (B) and
iHUV2F-derived teratomas (C) for germ-layer specific markers
(4⬘,6-diamidino-2-phenylindole, nuclear staining).
Ho et al
Reprogramming of HUVECs by OCT3/4 and SOX2
tiation of the same clone (Figure 2A, lane 8). Sections of
teratomas stain positive for AFP, vimentin, and nestin (Figure
2C), indicating development of all 3 germ layers.
Discussion
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Generation of iPSCs by transcription factor reprogramming is
currently widely investigated for regenerative medicine. To
create less manipulated iPSCs, one approach is to decrease
the number of reprogramming factors used, especially oncogenes.8 With the exception of adult stem cells, there have
been no reports of human cells reprogrammed with 1 or 2
factors. Indeed, we were unable to reprogram adult mesenchymal stromal cells with only OCT3/4 and SOX2 (data not
shown). We hypothesized that human FDCs would be efficient sources for reprogramming, being more proliferative
than adult cells,9 which is a critical issue for reprogramming
of human cells.5 Two recent studies show iPSC generation
from amniotic fluid– derived cells10 and HUVECs,11 but with
4 factors. We demonstrate that only 2 nononcogenic factors,
OCT3/4 and SOX2, were required to reprogram HUVECs,
likely because of the high endogenous expression of KLF4 in
these cells,12 as well as the proliferative advantage inherent to
fetal cells.
We show for the first time that human somatic cells can be
reprogrammed with the use of only 2 nononcogenic factors
without compromising efficiency. Although using FDCs such
as HUVECs may appear to obviate the attractiveness of
iPSCs in terms of donor specificity, adult cells are more likely
to accumulate mutations with known tumorigenic consequences after reprogramming.13 The relative lack of mutational damage in FDCs, along with the clinical experience of
fewer immunologic events with fetal compared with adult
hematopoietic stem cell transplantation, lends support to the
possibility of using FDC-derived iPSCs in clinical settings.14
Further investigation on the tumorigenicity and immunogenicity of FDC-derived iPSCs and differentiated progeny will
be crucial in facilitating possible therapeutic use.
Sources of Funding
This work was supported by grants from the National Science
Council of Taiwan (NSC 97-3111-B-002-009, NSC97-3111-B-400005, and NSC97-3111-B-400-001).
1907
Disclosures
None.
References
1. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K,
Yamanaka S. Induction of pluripotent stem cells from adult human
fibroblasts by defined factors. Cell. 2007;131:861– 872.
2. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from
mouse embryonic and adult fibroblast cultures by defined factors. Cell.
2006;126:663– 676.
3. Amabile G, Meissner A. Induced pluripotent stem cells: current progress
and potential for regenerative medicine. Trends Mol Med. 2009;15:
59 – 68.
4. Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, Aoi T,
Okita K, Mochiduki Y, Takizawa N, Yamanaka S. Generation of induced
pluripotent stem cells without Myc from mouse and human fibroblasts.
Nat Biotechnol. 2008;26:101–106.
5. Aasen T, Raya A, Barrero MJ, Garreta E, Consiglio A, Gonzalez F,
Vassena R, Bilic J, Pekarik V, Tiscornia G, Edel M, Boue S, Izpisua
Belmonte JC. Efficient and rapid generation of induced pluripotent stem
cells from human keratinocytes. Nat Biotechnol. 2008;26:1276 –1284.
6. Park IH, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA, Lerou PH,
Lensch MW, Daley GQ. Reprogramming of human somatic cells to
pluripotency with defined factors. Nature. 2008;451:141–146.
7. Kim JB, Greber B, Arauzo-Bravo MJ, Meyer J, Park KI, Zaehres H,
Scholer HR. Direct reprogramming of human neural stem cells by OCT4.
Nature. 2009;461:649 – 643.
8. Huangfu D, Osafune K, Maehr R, Guo W, Eijkelenboom A, Chen S,
Muhlestein W, Melton DA. Induction of pluripotent stem cells from
primary human fibroblasts with only Oct4 and Sox2. Nat Biotechnol.
2008;26:1269 –1275.
9. Butler MG, Tilburt J, DeVries A, Muralidhar B, Aue G, Hedges L,
Atkinson J, Schwartz H. Comparison of chromosome telomere integrity
in multiple tissues from subjects at different ages. Cancer Genet
Cytogenet. 1998;105:138 –144.
10. Galende E, Karakikes I, Edelmann L, Desnick RJ, Kerenyi T, Khoueiry
G, Lafferty J, McGinn JT, Brodman M, Fuster V, Hajjar RJ, Polgar K.
Amniotic fluid cells are more efficiently reprogrammed to pluripotency
than adult cells. Cloning Stem Cells. 2009.
11. Lagarkova MA, Shutova MV, Bogomazova AN, Vassina EM, Glazov
EA, Zhang P, Rizvanov AA, Chestkov IV, Kiselev SL. Induction of
pluripotency in human endothelial cells resets epigenetic profile on
genome scale. Cell Cycle. 2010;9:937–946.
12. Yet SF, McA’Nulty MM, Folta SC, Yen HW, Yoshizumi M, Hsieh CM,
Layne MD, Chin MT, Wang H, Perrella MA, Jain MK, Lee ME. Human
EZF, a Kruppel-like zinc finger protein, is expressed in vascular endothelial cells and contains transcriptional activation and repression
domains. J Biol Chem. 1998;273:1026 –1031.
13. Miura K, Okada Y, Aoi T, Okada A, Takahashi K, Okita K, Nakagawa M,
Koyanagi M, Tanabe K, Ohnuki M, Ogawa D, Ikeda E, Okano H,
Yamanaka S. Variation in the safety of induced pluripotent stem cell
lines. Nat Biotechnol. 2009;27:743–745.
14. Grewal SS, Barker JN, Davies SM, Wagner JE. Unrelated donor hematopoietic cell transplantation: marrow or umbilical cord blood? Blood.
2003;101:4233– 4244.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Endogenous KLF4 Expression in Human Fetal Endothelial Cells Allows for
Reprogramming to Pluripotency With Just OCT3/4 and SOX2−−Brief Report
Pai-Jiun Ho, Men-Luh Yen, Jhong-De Lin, Lan-Sun Chen, Hsin-I Hu, Chun-Kai Yeh,
Chiu-Ying Peng, Chen-Yu Lin, Shaw-Fang Yet and B. Linju Yen
Arterioscler Thromb Vasc Biol. 2010;30:1905-1907; originally published online August 5, 2010;
doi: 10.1161/ATVBAHA.110.206540
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2010 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/30/10/1905
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2010/08/05/ATVBAHA.110.206540.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
SUPPLEMENTAL INFORMATION
SUPPLEMENTAL METHODS AND MATERIALS
Plasmid construction and lentivirus production
The open reading frames of human OCT3/4 and SOX2 were first amplified by
PCR using pMXs-hOCT3/4 and pMXs-hSOX2 plasmids (Addgene, Cambridge, MA,
http://www.addgene.org), respectively, as templates and cloned into the Gateway entry
vector pENTR2B (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). The lentiviral
constructs pLenti4-V5-hOCT3/4 and pLenti4-V5-hSOX2 were then generated by
recombination between entry clones and a Gateway destination vector
pLenti4/TO/V5-DEST (Invitrogen). For packaging of virus, AD293 cells (Stratagene,
Cedar Creek, TX, http://www.strategene.com) were co-transfected with pCMVΔ8.91,
pMDG, and pLenti4-V5-hOCT3/4 or pLenti4-V5-hSOX2 plasmids by Lipofectamine
2000 (Invitrogen). The virus-containing medium was harvested 48 hours after
transfection, filtered to remove cell debris, and used for infection.
iPS cell formation and culture
HUVECs were seeded onto 6-well tissue culture plates (Corning, Lowell, MA,
http://www.corning.com/lifesciences) at a density of 1.2 x 105 cells per well and cultured
for 24 hours. For transduction of OCT3/4 and SOX2, the culture medium was replaced by
lentiviral medium supplemented with 8 μg/ml polybrene (Sigma-Aldrich, St. Louis, MO,
http://www.sigmaaldrich. com). After incubation for 6 hours, equal volume of fresh
culture medium was added to the cells and incubation was sustained for another 72 hours.
The cells were subsequently trypsinized and seeded onto MEF feeders and medium was
then replaced with hES cell culture medium as previously reported1 and monitored for
iPS formation. Reprogramming was performed on three separate occasions using
different HUVEC donors, with efficiency ranging from 0.001% to 0.024%. Purity of
HUVECs were assessed by surface marker CD31(+) and CD14(-) as well as functional
tube formation capacity in Matrigel (Supplemental Figure I).
In vitro differentiation of iPS cells
Differentiation of iHUV2F cells was conducted both by embryoid body (EB)
formation as well as direct differentiation. For EB formation, iPS cells were trypsinized
and resuspended in hES cell medium in non-adherent culture plates for 15 days. For
direct differentiation, iHUV2F cells were trypsinized, seeded onto tissue culture plates,
and cultured with differentiation medium. Germ layer-specific differentiation was
performed as previously reported1.
In vivo teratoma formation
Four- to six-week old SCID mice were obtained from Biolasco Taiwan Co. Ltd.
(Taipei, Taiwan, http://www.biolasco.com.tw).
All animal work was performed in
accordance with protocols approved by the institutional Animal Care and Use Committee.
Cells (1~2 x 106 cells) were injected subcutaneously into the middorsal intrascapular
region. Mice were followed for tumor formation, and sacrificed with tumors extracted
and taken for embedding.
Alkaline phosphatase (ALP) staining
ALP expression was characterized by staining with the Alkaline Phosphatase Kit
(Sigma-Aldrich) according to the manufacturer’s protocol.
Reverse transcription and real-time polymerase chain reaction (PCR)
RNA extraction, reverse transcription (RT) to cDNA, and PCR was performed
as previously reported2. Real-time PCR was performed on an ABI 7500 Real-Time PCR
System (Applied Biosystems Inc., Foster City, CA, http://www.appliedbiosystems.com)
instrument using SYBR green (Applied Biosystems Inc.). Dissociation curve analyses
were performed using the instrument’s default setting immediately after each PCR run
according to the standard protocol provided by manufacturer. All primers are listed in
Supplemental Table I.
Immunofluorescence staining
Cultured cells were fixed with 4% paraformaldehyde (Sigma-Aldrich) and
permeabilized with 0.1% Triton-X 100 (Sigma-Aldrich). Primary antibodies against
human OCT3/4 and SSEA-4 were purchased from R&D Systems (Minneapolis, MN,
http:// www.rndsystems.com). For staining of teratomas, tumors were embedded in
Tissue-Tek O.C.T. compound (Sakura Finetek USA Inc, Torrance, CA,
http://www.sakuraus.com) for frozen sectioning. Primary antibody against human
α-fetoprotein (AFP) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA,
http://www.scbt.com); nestin from Millipore (Billerica, MA, http:// www.millipore.com);
and vimentin from Dako (Glostrup, Denmark, http://www.dako.com/). Samples were first
incubated with the primary antibodies at 4°C overnight, rinsed three times with PBS, and
incubated at room temperature with FITC- or PE-conjugated secondary antibodies (Dako).
All samples were stained with DAPI (4',6-diamidino -2-phenylindole; Invitrogen) for 5
minutes. Visualization was done with a fluorescence microscope (Olympus, Tokyo, Japan,
http://www.olympus-global.com).
SUPPLEMENTAL DISCUSSION
Retention of Gene Expression of Starting Cell of Origin
The phenomenon that reprogrammed iPSCs somehow retain the “memory” of the
cell of origin is now being reported more and more, as seen by having a gene expression
pattern after reprogramming which is still retains some similarity to the starting cell of
origin3-5. This is similar to our findings of expression of some endothelial markers in
some of the iHUV2F clones (Figure 2A). This pattern of inconsistent cell-of-origin
marker expression in the background of consistent functional pluripotency has now been
increasingly reported, and is believed to be attributed to ‘memory’ of the epigenetic
program in the starting cell used for reprogramming.
Reprogramming and Karyotypic Change
Our karyotyping analysis (Supplemental Figure II) show that the iHUV2F cells have
a euploid complement of 46 chromosomes with a reciprocal translocation (between
chromosome 15 and 20), which is the most common type of chromosomal abnormality
(found in 1/500 of the population) and nearly always phenotypically normal6. There are
increasing reports of karyotypic abnormalities in iPSCs found in the literature, including
phenotypically abnormal karyotypes of trisomy 8 in a mouse iPSCs study7 and an
apparently unbalanced translocation in a human iPSCs study8. Interestingly, both studies
utilized lentiviral vectors for reprogramming, thus this method may not be the best
method for introducing exogenous genes for therapeutic use. However, as proof of
principle, our findings show that reprogramming with two non-oncogenic factors using
the appropriate cell of origin is possible, and while it appears that a karyotypic
abnormality has occurred, it is one that still maintains euploidy and nearly always
associated with a normal phenotype.
SUPPLEMENTAL REFERENCES
1.
2.
3.
4.
5.
6.
7.
Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka
S. Induction of pluripotent stem cells from adult human fibroblasts by defined
factors. Cell. 2007;131:861-872.
Yen ML, Chien CC, Chiu IM, Huang HI, Chen YC, Hu HI, Yen BL. Multilineage
differentiation and characterization of the human fetal osteoblastic 1.19 cell line: a
possible in vitro model of human mesenchymal progenitors. Stem Cells.
2007;25:125-131.
Ghosh Z, Wilson KD, Wu Y, Hu S, Quertermous T, Wu JC. Persistent donor cell
gene expression among human induced pluripotent stem cells contributes to
differences with human embryonic stem cells. PLoS One;5:e8975.
Lagarkova MA, Shutova MV, Bogomazova AN, Vassina EM, Glazov EA, Zhang
P, Rizvanov AA, Chestkov IV, Kiselev SL. Induction of pluripotency in human
endothelial cells resets epigenetic profile on genome scale. Cell Cycle;9:937-946.
Marchetto MC, Yeo GW, Kainohana O, Marsala M, Gage FH, Muotri AR.
Transcriptional signature and memory retention of human-induced pluripotent
stem cells. PLoS One. 2009;4:e7076.
Scriven PN, Handyside AH, Ogilvie CM. Chromosome translocations:
segregation modes and strategies for preimplantation genetic diagnosis. Prenat
Diagn. 1998;18:1437-1449.
Sommer CA, Sommer AG, Longmire TA, Christodoulou C, Thomas DD, Gostissa
M, Alt FW, Murphy GJ, Kotton DN, Mostoslavsky G. Excision of reprogramming
8.
transgenes improves the differentiation potential of iPS cells generated with a
single excisable vector. Stem Cells;28:64-74.
Mali P, Ye Z, Hommond HH, Yu X, Lin J, Chen G, Zou J, Cheng L. Improved
efficiency and pace of generating induced pluripotent stem cells from human adult
and fetal fibroblasts. Stem Cells. 2008;26:1998-2005.
SUPPLEMENTAL LEGEND
Supplemental Table I. Primer sequences.
Supplemental Table II. Population doubling time of HUVEC and iHUV2F cells
Supplemental Figure I. Characterization of HUVECs. (A) Flow cytometry analysis of
endothelial marker CD31 and hematopoietic marker CD14 in HUVECs and fibroblasts (B)
morphology of HUVECs and fibroblasts (phase contrast, 50x); (C) tube formation
capability of HUVECs versus fibroblasts.
Supplemental Figure II. Karyotyping of iHUV2F cells, 46-XX with a reciprocal
translocation between the long arms of chromosome 15 and chromosome 20 (arrow).
Supplemental Table I: Primer sequences
Gene
Oct4
Sox2
Klf4
c-Myc
Nanog
Rex1
Lin28
Oct4Transgene
Sox2Transgene
hTERT
PECAM-1
FLK-1
VCAM
vWF
AFP
CK8
CK18
Brachyury
PPARγ
MAP2
NG2
Nestin
β-actin
Forward Primer
Reverse Primer
GACAGGGGGAGGGGAGGAGCTAGG
GGGAAATGGGAGGGGTGCAAAAGAGG
ACGATCGTGGCCCCGGAAAAGGACC
ACCGAGGAGAATGTCAAGAG
ATGCCTCACACGGAGACTGT
AGAAAGGCCTGGGTGGAAGA
CGGATCACAAGGTCACGAG
CCCCAGGGCCCCATTTTGGTACC
CTTCCCTCCAACCAGTTGCCCCAAAC
TTGCGTGAGTGTGGATGGGATTGGTG
TGATTGTAGTGCTTTCTGGCTGGGCTCC
TGCTTGGACGGACAGGATG
AGGGCTGTCCTGAATAAGCA
GGGAGCTTGCTTCGAAAACC
TTCAAGCGATTCCCCTGCC
ACCGAGGAGAGGGTTAGGGAT
GGCACCCCTGGCATGGCTCTTGGCTC
ACCGAGGAGAGGGTTAGGGAT
CACGCGAAAACCTTCCTC
CCCGAACTGGAATCTTCCTT
GTGACCAACATGGAGTCGTG
GCTGAAGGAAAACCAGAAGAAGC
GAGGCTGAGTTTGAAGTGC
GAATGCTGCAAACTGACCACGCTGGAAC
CCTGGAAGGGCTGACCGACGAGATCAA
AGCTCAACGGGATCCTGCTGCACCTTG
GCCCTCTCCCTCCCCTCCACGCACAG
CGATGGGGATGCTCATAA
CCAGGTGGCGGACGTGTGAA
GCTGTGGCTGTGTCTTTTGA
AACAGCGACGGAGGTCTCTA
TGGCACCACACCTTCTACAATGAGC
ACCACTGTCTTCCGCAAGTT
GGGTTTGCCCTCTTTTTCTC
CCAGAGATTCCATGCCACTT
TCGTGATTATCCGTGAGGGTAAAG
CTGCTCCAGCTCATCCAC
TGGCATTCAAGAGGGTTTTCAGTCTGGA
CTTCCCAGCCAGGCTCTGCAGCTCC
CACTATCCGGCGGGTGGTGGTCTTTTG
CGGCGCCGTTGCTCACAGACCACAGG
CTTTTGGCATACTCTGTGAT
GCCACGCTGGATCTGCCTGG
CTGTGTGACCTGGAAGAGCA
TTCTCTTGTCCCGCAGACTT
GCACAGCTTCTCCTTAATGTCACGC
Supplemental Table II. Population doubling time of HUVEC and iHUV2F cells
HUVEC
iHUV2F-C1
iHUV2F-C3
Passages 3-8
Passages 15-20
31.18 ± 2.23
49.61 ± 8.40
48.22 ± 4.43
Cease growing
47.00 ± 3.40
50.24 ± 5.62
Supplemental Figure I
Supplemental Figure II