Microbiology (2008), 154, 1341–1353
DOI 10.1099/mic.0.2007/016360-0
The S.ma.I2 class C group II intron inserts at
integron attC sites
Cecilia Quiroga,1,2 Paul H. Roy2,3 and Daniela Centrón1
Correspondence
Daniela Centrón
[email protected]
1
Departamento de Microbiologı́a, Inmunologı́a y Parasitologı́a, Facultad de Medicina,
Universidad de Buenos Aires, Buenos Aires, Argentina
2
Centre de Recherche en Infectiologie, Université Laval, Québec, Canada
3
Département de Biochimie et de Microbiologie, Université Laval, Québec, Canada
Received 18 July 2007
Revised
3 January 2008
Accepted 13 January 2008
We previously found the class C S.ma.I2 group II (GII) intron in Serratia marcescens SCH909
inserted into the variable region of a class 1 integron within the attC site of the ant(299)-Ia gene
cassette. Here, we demonstrate that this ant(299)-Ia : : S.ma.I2 gene cassette is a
recombinationally active element despite the presence of the S.ma.I2 intron. In addition, S.ma.I2 is
an active GII intron capable of performing self-splicing and invading specific target sites. Intron
homing to a DNA target site is RecA-independent and recognizes the intron binding site (IBS)1
and IBS3 regions, formed by the 59 TTGTT 39 consensus sequence located within the inverse
core site of attC integrons. Our results also indicate that the process for S.ma.I2 intron
mobilization involves a secondary structure provided by the folding of the complete attC site.
Moreover, phylogenetic analysis of the class C GII introns showed a clear divergent clade formed
by introns that insert within specific sites usually associated with lateral gene transfer.
INTRODUCTION
Group II (GII) introns are mobile genetic units that have
recently been found to be widespread in bacterial genomes
and are mostly inserted within other mobile elements, such
as conjugative plasmids, transposons, integron-associated
gene cassettes, and insertion sequences (Pyle, 2000; Dai &
Zimmerly, 2002). They possess an intron-encoded protein
(IEP) with several activities that include a maturase, a
reverse transcriptase and a site-specific DNA endonuclease
(Endo) (Kennell et al., 1993; Zimmerly et al., 1995a;
Matsuura et al., 1997). GII introns mediate their dissemination by the well-characterized target DNA primed
reverse transcription (TPRT; Zimmerly et al., 1995b;
Cousineau et al., 2000), which involves an RNA–DNA
pairing. This pairing is achieved through two regions: the
exon binding sites (EBSs) in the intron RNA, and the
intron binding sites (IBSs) in the targeted DNA
(Lambowitz & Belfort, 1993; Michel & Ferat, 1995).
These regions vary in sequence and length based upon
the GII intron classification (Dai & Zimmerly, 2002). Based
on their IEP sequences, they have been classified into
Abbreviations: CS, consensus sequence; EBS, exon binding site; Endo,
endonuclease; GII, group II; IBS, intron binding site; IEP, intron-encoded
protein; wt, wild-type.
A supplementary table showing the GII intron and E1 sequences used in
this study, and two supplementary figures showing the structures used
for intron self-splicing and the secondary structures of the target sites
corresponding to class C GII introns, are available with the online version
of this paper.
chloroplast-like classes, mitochondrial-like classes and
bacterial classes A–E (Zimmerly et al., 2001). Their RNAs
and IEPs have largely coevolved; thus, it is possible to
follow the evolution of the ribozyme by understanding the
evolution of the reverse transcriptase (Toor et al., 2001). It
has been proposed that the class C introns are direct
descendants of a common ancestor of GII introns (Rest &
Mindell, 2003). The class C GII introns, which have a novel
RNA secondary structure, lack the Endo domain of the IEP
(Endo2), have a shorter EBS–IBS pairing, and are located
downstream of transcriptional terminators (Granlund et al.,
2001; Dai & Zimmerly, 2002). While Endo+ introns use
the TPRT mechanism, introns lacking the Endo activity use
the host replication machinery to invade novel target sites
(Jiménez-Zurdo et al., 2003; Zhong & Lambowitz, 2003).
RNA–DNA pairing in most GII introns involves EBS
regions 1, 2 and 3, which constitute an 11–12 nt motif
(Matsuura et al., 1997; Mohr et al., 2000); in contrast, the
class C GII introns lack the EBS2 region, resulting in a
shorter RNA–DNA pairing (Toor et al., 2001).
Previously, we reported the presence of a class C group II
intron identified as S.ma.I2 (Figs 1 and 2a) in a class 1
integron in the multiresistant Serratia marcescens strain
SCH909 (Sm909) (Centrón & Roy, 2002). The S.ma.I2 GII
intron is inserted within the attC site of the ant(299)-Ia
gene cassette, in the opposite orientation to the cassette
ORF (Fig. 2a). Cassettes are mobile elements typically
composed of a promoterless structural gene and a
recombination site known as a 59-base element or attC
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
2007/016360 G 2008 SGM Printed in Great Britain
1341
C. Quiroga, P. H. Roy and D. Centrón
Fig. 1. S.ma.I2 secondary structure. Folding of the S.ma.I2 RNA was done based on previous foldings (Toor et al., 2001) using
the MFOLD program. Roman numerals show the conserved domains. Circles, EBS3 or IBS3; asterisk, bulged adenosine
responsible for the lariat structure. Numbers correspond to the intron coordinates.
site (Recchia & Hall, 1997). attC sites are 57–141 bp long,
and consist of two short regions of sequence similarity at
their boundaries (1L–2L and 1R–2R) separated by a stretch
(20–104 bp) of imperfect internal dyad symmetry (Stokes
et al., 1997). Single-stranded forms of the attC sites have
the potential to form a stem–loop structure (Stokes et al.,
1997; Bouvier et al., 2005). The 1L (also known as the
inverse core site) is located at the left-hand end of the attC
and has the 59 RYYYAAC 39 consensus sequence (CS),
while the 1R (or core site) is located at the right-hand end
formed by the 59 GTTRRRY 39 CS (Collis & Hall, 1992;
Stokes et al., 1997). Cassettes can be excised into circular
intermediates and inserted into an integron by integrasemediated site-specific recombination through the cleavage
of the 1R region (Hall et al., 1991; Collis & Hall, 1992). It
has recently been demonstrated that two extrahelicoidal
residues, a G and a T, of the attC stem collaborate in the
affinity of the integrase for the substrate (MacDonald et al.,
2006). Here, we report that the ant(299)-Ia : : S.ma.I2 gene
cassette is capable of excision, although its 1L is disrupted.
Also, the S.ma.I2 intron can self-splice and invade a wide
1342
variety of gene cassettes. The successful insertion of the
intron into a novel DNA involves an adjacent secondary
structure, which is provided by the cassette attC site. In
addition, based on phylogenetic studies, we found that
those introns that also occur within attC sites belong to a
distinct clade within class C group II introns together with
S.ma.I2.
METHODS
Bacterial growth and recombinant clones. The S. marcescens strain
SCH909 (Sm909) and Escherichia coli strains DH5a, JM109 and JM107
(Table 2) were grown at 37 uC overnight with agitation in Luria–Bertani
media (10 g tryptone, 5 g yeast extract, 10 g NaCl), in the presence of
10 mg ampicillin (Ap) ml21 and/or 50 mg chloramphenicol (Cm) ml21,
when necessary. The pUCSmI clone was obtained by cloning a 2590 bp
fragment from Sm909 with the restriction sites SphI and XmaI at
positions 440 and 3033 (GenBank accession no. AF453998) at the SphI
and BspEI sites of the pUC19 vector. The pACDattC and pACDIBS
clones were obtained from the pLQ424 clone (Table 2) by PCR
amplification using the primer combinations pACYC184-59/attCdfrSLR and pACYC184-59/attCdfr-NSR, respectively (Table 1), and Taq
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
Microbiology 154
S.ma.I2 GII intron invades resistance gene cassettes
Fig. 2. Gene cassette excision. (a) Integron
AF453998 carrying the S.ma.I2 GII intron.
White horizontal arrows, ant(299)-Ia, ant(3ml0)Ii_aac(69)-IId, orfO and blaOXA-11-IS1 genes;
grey striped horizontal arrow, intI1 gene; grey
striped vertical rectangle, attI site; rectangles
filled with grey vertical lines, attC sites. The
disrupted attC site is identified as DattC. Grey
rectangle and filled horizontal arrow, S.ma.I2
GII intron with its IEP; thin horizontal arrows,
oligonucleotides described in Table 1. (b)
Invaded attC site of the ant(299)-Ia : : S.ma.I2
gene cassette. Upper-case type represents
the attC site sequence; lower-case type
represents the S.ma.I2 intron sequence; numbers between parentheses indicate the extension of the S.ma.I2 intron. Rectangles indicate
the conserved sequences 1R, 2R, 1L and 2L.
The 1L region is disrupted by the S.ma.I2
intron. Broken line, ANT(299)-Ia protein translation. (c) Scheme showing the excision of
the ant(299)-Ia : : S.ma.I2 cassette carrying the
S.ma.I2 intron. IntI1, type 1 integrase. The
ant(299)-Ia : : S.ma.I2 gene cassette structure is
excised as a circle and the attI1 site is ligated
to the cassette in second position. (d)
Sequencing product showing the ligation of
the attI1 site with the cassette ant(30)Ii_aac(69)-IId located downstream of the
ant(30)-Ik attC site. The grey horizontal line
indicates the 59 CS; the black horizontal line
depicts the ant(30)-Ii_aac(69)-IId cassette with
its start codon (ATG) in bold type; the vertical
arrow shows the recombination site.
polymerase (Promega). The first product carried the complete dfrA1
gene along with 34 bp of the left-hand end of the dfrA1 attC site from
Tn7; the second product carried the same dfrA1 gene with only 17 bp of
the dfrA1 attC. Both products were cloned into the pCR2.1 vector (ApR)
following the manufacturer’s procedures (Invitrogen). Briefly, 4 ml of
the PCR product was incubated with 1 ml of the pCR2.1 vector in the
presence of the manufacturer’s buffer and salt solution for 30 min at
room temperature. An aliquot was transformed into the E. coli Top109
strain. Subcloning of the inserted regions was done into the pACYC184
vector (CmR). The integrity of the inserts was confirmed by sequencing.
The pUatt-dfr and pPatt-dfr clones were obtained by introducing a
95 bp fragment of each into the pCR2.1 vector and subcloning into the
pACYC184 vector at the BamHI and EcoRV restriction sites. The
fragment used for the pUatt-dfr plasmid was obtained using the primers
dfr-att-open_F and dfr-att-open_R, and corresponds to a modification
of the dfrA1 attC site that avoids stem–loop formation (Table 1). The
http://mic.sgmjournals.org
fragment used for the pPatt-dfr clone was obtained using the dfr-attopen_F and dfr-att-comp_R primers, and restores the stem–loop
complementarity of the modified dfrA1 attC from pUatt-dfr. All pLQ
plasmids were obtained by cloning the different gene cassettes into the
EcoRV restriction site of the pACYC184 vector (P. H. Roy, unpublished
results; Table 2).
The pESmIDIEP and pESmIDI-IV clones were generated by deletions
from the wild-type (wt) S.ma.I2 intron (Table 2). The pESmIDIEP
construct was obtained by removing 786 bp of the intron IEP from
the pUCSmI plasmid with BamHI (20 U), and religating with T4
DNA ligase (New England BioLabs) (Supplementary Fig. S1a). The
internally deleted intron with its exons was subcloned into the pET3d vector using the EXL and Smtr-XbaI primers, followed by
transformation into E. coli DH5a, as specified by Sambrook et al.
(1989). The pESmIDI-IV construct was obtained by digestion of the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
1343
C. Quiroga, P. H. Roy and D. Centrón
Table 1. Oligonucleotide sequences used in this study
Primer
aac69Ib
attCdfr-SLR
attCdfr-NSR
aadBR
dfr-att-open_F
dfr-att-open_R
dfr-att-comp_R
EXB1
EXU
EXL
INL
INU
intiF
intiR
IVT-PT7L
IVT-up
orfa-COOH
pACYC184-59
pACYC184-39
SB4
Smtr-XbaI
Sulpro 3
Sequence (5§ to 3§)
Ta (6C)*
cagtgactggtctattccgc
caggtttgcgaatccgtt
tgctgccacttgttaac
gcctgtaggactctatgtgc
gtttaacgccgttacacgattcgatacccaagtgcgcggcttttggtacaaaaggcgtga
ggttaacaagtggcagcaacggactcgccacactgtcacgccttttgtaccaaaagccgcgcact
ggttaacaaggttactacgattcagatacccaagttcacgccttttgtaccaaaagccgcgcact
acatgcatgcatgtcaaatcaatatcactgtatg
cggaaaaggttgaggtcttg
ccgcaagaatgtccttacgc
gcaaatctgtgagctgatga
cgcttagtgatgaacgcagt
ttcgaatgtcgtaaccgc
cgaggcatagactgtac
taatacgactcactatagggagagttgagagc
cttgactgcgaacctgcttg
caaggccttgcatgtttgaa
tgtagcacctgaagtcagcc
atacccacgccgaaac
tattcggggagatctgataaacacgcatcc
caccgtccagtctagagccgtacaa
gcctgacgatgcgtgga
55
52
52
55
53
53
53
55
52
52
52
52
52
52
55
55
52
55
55
55
55
52
Source or reference
This work
This work
This work
Ramı́rez et al. (2005)
This work
This work
This work
This work
This work
This work
This work
This work
Orman et al. (2002)
Orman et al. (2002)
This work
This work
P. H. Roy, unpublished data
Messier & Roy (2001)
Messier & Roy (2001)
This work
This work
Lévesque et al. (1994)
*Annealing temperature.
pESmIDIEP clone with BamHI and NdeI, followed by filling in with
Klenow enzyme and blunt-ended ligation (Sambrook et al., 1989).
The complete ant(299)-Ia : : S.ma.I2 gene cassette was cloned within
the pCR2.1 vector as described above and subcloned in the
pACYC184 vector (clone pACIcass) (Fig. 2c). The insertion fragment
was obtained by PCR amplification using the primers sulpro 3 and
Smtr-XbaI (Table 1).
Nucleic acid extraction. Total DNA isolation of Sm909 was done by
using a phenol/chloroform purification method (Sambrook et al.,
1989). Plasmid DNAs were prepared using either the Miniprep Plasmid
Extraction kit from Qiagen or the plasmid preparation protocol
described by Sambrook et al. (1989). Total RNA extraction was done
using TRIzol Reagent (Invitrogen) following the manufacturer’s
procedures. Once extracted, the total RNA was treated with 10 U
DNase I (RNase free; Epicenter) for 1 h at 37 uC and cleaned up with
the RNeasy Mini Kit from Qiagen.
In vivo recombination. The pACIcass clone was introduced by
transformation into the E. coli DH5a strain (Table 2) along with the
pLQ369 plasmid, which encodes the IntI1 protein fused to the MalE
protein from the pMAL-c2 vector (Messier & Roy, 2001). Cells were
grown overnight at 37 uC. Induction of the ant(299)-Ia : : S.ma.I2
cassette excision was done on an OD600 0.4 culture by the addition of
0.3 mM IPTG and incubation for 3 h at 37 uC. After plasmid DNA
preparation, the detection of cassette excision was done by PCR with
50 ng DNA template and primers pACYC184-59 and pACYC184-39
(Table 1). A shorter amplification product confirmed by sequencing
using the ABI Prism 3300 sequencer was considered evidence of
cassette excision.
Splicing in vitro. A fragment containing the S.ma.I2 intron with its
exons was amplified by PCR with Pfx polymerase (Invitrogen) and the
1344
IVT-up and IVT-PT7L primers (the latter carries the T7 promoter
sequence at the 59 extremity). Of the resulting purified product,
500 ng was added to the in vitro transcription buffer from Invitrogen
and incubated for 1 h at 37 uC with 50 U T7 RNA polymerase and
0.4 mM NTPs. The synthesized RNA was treated with 4 U DNase I
(RNase free; Epicenter) and cleaned up with the RNeasy Mini Kit
from Qiagen. Two microlitres were incubated in the corresponding
splicing buffer (SB) (50 mM Tris/HCl, pH 7.5, 50 mM Mg2+ and
21
RNaseout inhibitor; final
500 mM NHz
4 , 10 mM DTT and 40 U ml
volume 20 ml), as described elsewhere (Matsuura et al., 1997).
Samples were incubated for 5 min at 65 uC and then reduced to
37 uC either for 20 min in a water bath or in the DNA Engine PTC200 Dual thermal cycler from MJ Research (speed of ramping 3 uC
s21). Once splicing was completed, 2 ml of the reaction mixture was
used for the RT-PCR assay.
RT-PCR assay. RT-PCR was performed following the manufac-
turer’s conditions for the Superscript II RNase H2 reverse
transcriptase from Invitrogen. We performed the RT-PCR method
on total RNA from strain Sm909 and on the in vitro splicing products.
For total RNA, we used a concentration of 1 mg ml21 in each reaction.
For the in vitro-synthesized RNA, a one-tenth aliquot of the reaction
mixture was used. In both cases, the reverse transcription reaction was
done by adding the in vitro or in vivo RNA to a mix containing
0.2 mM dNTPs, 0.4 mM of the corresponding primer, 16 manufacturer’s buffer, 0.02 M DTT and 40 U Superscript II RNase H2
reverse transcriptase in a final volume of 20 ml. Incubation was done
in the presence of RNaseout inhibitor from Invitrogen at 45 uC for
1 h and inactivated at 70 uC for 15 min. RNase H (2 U) treatment
was done for 15 min at 37 uC. The subsequent PCR reaction was
done using 2 ml of the reverse-transcription product as template with
0.3 mM of specific primers, 0.2 mM dNTPs, 2 mM MgCl2 and 1.25 U
Taq polymerase from Invitrogen for 94 uC/1 min; 94 uC/1 min,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
Microbiology 154
S.ma.I2 GII intron invades resistance gene cassettes
Table 2. Bacteria, plasmids and clones used in this study
Strain or plasmid
Strains
S. marcescens SCH909
E. coli DH5a
E. coli JM109
E. coli JM107
Plasmids
pUC19
pACYC184
pACIcass
pUCSmI
pESmIDIEP
pESmIDI-IV
pACDattC
pACDIBS
pUatt-dfr
pPatt-dfr
pLQ423
pLQ424
pLQ425
pLQ426
pLQ427
pLQ428
pLQ429
pLQ430
pLQ431
pLQ437
pLQ439
pLQ440
pLQ441
pLQ442
pLQ443
pLQ444
pLQ445
pLQ446
Description
Strain carrying three integrons [AF453998 (S.ma.I2), AF453999, pLMO229]; also identified as Sm909
F9/endA1 hsdR17 (rk mk ) glnV44 thi-1 recA1 gyrA (Nalr) relA1 D(lacIZYA-argF)U169 deoR [w80dlacD(lacZ)M15]
F9 traD36 proA+B+ lacI D(lacZ)M15/D(lac-proAB) glnV44 e142 gyrA96 recA1 relA1 endA1 thi hsdR17
F9 traD36 proA+B+ lacI D(lacZ)M15/D(lac-proAB) glnV44 e142 gyrA96 relA1 endA1 thi hsdR17
Cloning vector, ampicillin resistance (Ampr), ori ColE1
Cloning vector, chloramphenicol resistance (Cmr), ori 15A
3026 bp fragment from the Sm909 strain containing part of intI1, the ant(299)-Ia : : S.ma.I2 gene cassette and a few
nucleotides of the downstream cassette cloned at the XbaI and NcoI sites of pACYC184 vector
2593 bp fragment from Sm909 containing 94 bp from E1, the full-size S.ma.I2 and 529 bp from E2 cloned into the
pUC19 vector at restriction sites SphI and XmaI
786 bp deleted at the BamHI restriction sites removing most of the IEP and cloned into the pET3-d vector
698 bp deleted from pESmIDIEP with BamHI and NdeI restriction enzymes; this clone lacks DII, DIII and most of DId
and DIV domains
attI2-dfrA1 fragment carrying only 76 bp of the attC of dfrA1 from Tn7 cloned into the pCR2.1 vector and subcloned
into the pACYC184 vector
attI2-dfrA1 fragment carrying only 17 bp of the attC of dfrA1 from Tn7 cloned into the pCR2.1 vector and subcloned
into the pACYC184 vector
97 nt cloned into the pCR2.1 vector and subcloned into the pACYC184 vector, carrying a modified version of the attC
site from dfrA1
97 nt cloned into the pCR2.1 vector and subcloned into the pACYC184 vector, carrying a modified version of the attC
site from pUatt-dfr
attI1- ant(399)-Ia- 162 bp 39 CS from Tn21 cloned into the pACYC184 vector
attI2- dfrA1 55 bp sat2 fragment from Tn7 cloned into the pACYC184 vector
attI3- blaIMP-1- 105 bp aac(69)-Ib fragment from the class 3 integron cloned into the pACYC184 vector
attC dfrA1– ant(399)-Ia- 163 bp 39 CS fragment cloned into the pACYC184 vector
attI1- dfrA1– 83 bp 39CS cloned into the pACYC184 vector
attC ant(399)-Ic- aac(69)-Ia_orfG- orfH- 130 bp orfI cloned into the pACYC184 vector
attI1- ant(399)-Ic- 82 bp catB2 from Tn2424 cloned into the pACYC184 vector
attC dfrA1– sat2- 72 bp ant(399)-Ia cloned into the pACYC184 vector
attC aac(69)-Ib- blaOXA-10- 70 bp ant(399)-Ic cloned into the pACYC184 vector
attC ant(399)-Ic- dfrA1- 55 bp sat2 cloned into the pACYC184 vector
attC ant(399)-Ia- blaIMP-1- 105 bp aac(69)-Ib cloned into the pACYC184 vector
attI1- aac(69)-Ia_orfG- orfH- 130 bp orfI cloned into the pACYC184 vector
attI2- aac(69)-Ia_orfG- orfH- 130 bp orfI cloned into the pACYC184 vector
attI3- aac(69)-Ia_orfG- orfH- 130 bp orfI cloned into the pACYC184 vector
attC ant(399)-Ic- ant(399)-Ia- 162 bp 39 CS cloned into the pACYC184 vector
attC dfrA1- ant(399)-Ia_orfG- orfH- 130 bp orfI cloned into the pACYC184 vector
attC aac(69)-Ia_ orfG- ant(399)-Ia- 174 bp 39 CS cloned into the pACYC184 vector
attC blaIMP-1- aac(69)-Ia_orfG- orfH- 130 bp orfI cloned into the pACYC184 vector
followed by 30 s at the annealing temperature (Ta) of the primers
(Table 1), 72 uC/5 min for 35 cycles; then 72 uC/10 min in a final
volume of 50 ml. The products of the amplification were sequenced
and analysed with Sequencher (Gene Codes Corporation) and GCG
(Genetics Computer Group, Accelrys) software.
Mobility assay. The pUCSmI (ApR) clone was co-transformed into
E. coli JM109 (recA2) and JM107 (recA+) strains with each pLQ clone
(CmR) (Table 2). The competent cells were obtained using the CaCl2
technique (Ausubel et al., 1994). The different co-transformants
obtained were grown in the presence of both antibiotics at 37 uC
overnight. An aliquot from the preculture was inoculated in 5 ml LB
medium with the addition of 1 mM IPTG after 1 h incubation at
37 uC to induce the expression of the S.ma.I2 GII intron, followed by
http://mic.sgmjournals.org
incubation for 3 h. The co-transformant DNAs were extracted and
the mobility tested by PCR with the following combination of
primers: a specific primer for the intron (INU or INL for the donor
plasmid) and a specific primer for the recipient plasmid (primers
pACYC184-59 and pACYC184-39, and primer orfa-COOH for the
pLQ428 plasmid) (Table 2). The amplification reaction was
performed as described above with the following cycling steps:
94 uC/1 min; 94 uC/1 min, 52 uC/1 min, 72 uC/2 min for 35 cycles;
72 uC/5 min. Amplification products were confirmed by sequencing.
Nucleic acid folding. S.ma.I2 RNA secondary structure, the DNA
secondary structures of the attC sites, and E1 region folding were
done using the MFOLD program from Zuker (2003), available at the
Rensselaer bioinformatics website (http://frontend.bioinfo.rpi.edu/
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
1345
C. Quiroga, P. H. Roy and D. Centrón
applications/mfold/). We used previous intron structures as a
reference for the S.ma.I2 RNA secondary structure folding
(www.fp.ucalgary.ca/group2introns/).
For the attC sites, we considered each sequence as beginning with the
inverse core site (59-RYYYAAC-39) and ending with the core site (59GTTRRRY-39). We selected the most probable structure for their
folding based on previous descriptions of attC structures (Stokes et al.,
1997). Conditions for the DNA folding used with the MFOLD
program were a flat exterior loop and natural algorithm.
Phylogenetic tree reconstruction. The phylogeny studies of the
class C GII intron were done using the amino acid sequences of 45
intron proteins. Several introns were retrieved from the Mobile GII
intron database (www.fp.ucalgary.ca/group2introns/) and others by
performing a BLASTP search at the NCBI site (www.ncbi.nlm.nih.gov/
BLAST). Supplementary Table S1 summarizes the introns used for
this purpose. The first alignment of the sequences was done with the
CLUSTAL_X version 1.83 software using the neighbour-joining method
(Thompson et al., 1997). We refined the alignment using the MEGA
version 3 software (Kumar et al., 2004). The conditions used for the
alignment were a gap open penalty of 10 (gap extension penalty 0.1)
for the pairwise alignment and a gap open penalty of 10 (gap
extension penalty 0.2) for the multiple alignments using a Blosum
matrix. Phylogenetic tree reconstruction was done using the
neighbour-joining method with 1050 bootstraps and a seed of
71 829; the maximum-likelihood method and the maximumparsimony method were also tested to validate the tree topology.
The following introns were used as outgroups: the mitochondrial class
Ll.LtrB intron (U50902), the class D RmInt1 intron (Y11597), the
class D intron from E. coli (AB024946), the chloroplast–like intron
from Xylella fastidiosa (AE003999), the class E intron from S.
marcescens (BX664015) and the class B intron from Enterococcus
faecium (AAAK03000117).
RESULTS
The ant(2§§)-Ia : : S.ma.I2 gene cassette conserves
its excision ability and antimicrobial resistance
properties
The ant(299)-Ia : : S.ma.I2 gene cassette from Sm909 has an
unusual structure formed by the ant(299) gene, the S.ma.I2
GII intron, and the ant(399)-Ik (aadA11) attC site (Centrón
& Roy, 2002). The insertion of S.ma.I2 at the 1L of the
ant(399)-Ik attC site modifies the well known 59 GCCTAAC
39 DNA CS to the 59 GCCTAAT 39 sequence (1L, top
strand; Fig. 2b). This insertion occurs at the ant(299)-Ia
stop codon (Fig. 2b), but since the intron left-hand end is
an A, the protein translation was not modified and the
ant(299)-Ia gene conferred resistance to gentamicin, as was
confirmed by disc susceptibility assay of the pACIcass
plasmid, which has the complete ant(299)-Ia : : S.ma.I2 gene
cassette cloned into the pACYC184 vector (zone diameter
of 8 mm for gentamicin). In order to test the recombination activity of the ant(299)-Ia : : S.ma.I2 gene cassette, we
analysed its excision ability by co-transforming the
pACIcass plasmid along with the pLQ369 plasmid that
provides the IntI1 integrase in trans (Fig. 2c; Messier &
Roy, 2001). PCR amplification resulted in two products of
3000 and 400 bp before and after excision of the ant(299)Ia : : S.ma.I2 gene cassette, respectively. Sequencing of the
1346
400 bp excised band confirmed the junction between the
attI1 site and the attC site of the second cassette inserted
within the variable region, which corresponded to the
ant(399)-Ii-aac(69)-IId gene cassette (Fig. 2d); however, we
did not test for the presence of the predicted ant(299)Ia : : S.ma.I2 gene cassette circle. From an integron
functional perspective, these results showed that despite
the disruption of the 1L of the ant(299)-Ia gene cassette by
the S.ma.I2 GII intron, the attC was still functional during
cassette excision, indicating that the ant(299)-Ia : : S.ma.I2
gene cassette had not been immobilized.
S.ma.I2 is an active intron capable of self-splicing
Splicing of the S.ma.I2 intron and transcription of the
surrounding genes in the original host Sm909 were tested
by RT-PCR. Transcription of the integron genes intI1,
ant(299)-Ia and ant(399)-Ii_aac(69)-IId was detected using
the primers intiF/intiR, EXU/SB4 and EXU/EX1B, respectively, in order to obtain the first-strand cDNA (Fig. 2a).
The S.ma.I2 intron precursor mRNA or its religated exons
were not detected with the EXU primer for the first-strand
cDNA synthesis followed by PCR with primers EXU/EXL.
These results suggest that the S.ma.I2 intron RNA is not
transcribed in Sm909 under these conditions.
We analysed the self-splicing ability of the S.ma.I2 intron
under regulated conditions (Robart et al., 2004). The study
was carried out using three different constructs: (i) the wt
intron obtained directly from strain Sm909; (ii) the clone
pESmIDIEP, which has the S.ma.I2 intron with 786 bp
deleted (DIEP; Supplementary Fig. S1b); and (iii) the clone
pESmIDI-IV, which has the S.ma.I2 intron deleted from
DId up to the DIV region (DDI-IV; Supplementary Fig.
S1c). First, each structure was amplified with the primers
IVT-up and IVT-PT7L (Table 1). The latter carries the T7
promoter in its sequence so that transcription will be
regulated by the T7 RNA polymerase. Purification of the in
vitro-synthesized RNA was done independently for each
assay. An aliquot was incubated in the presence of SB
buffer, which contains high concentrations of Mg2+ and
NHz
4 (50 and 500 mM, respectively). We then performed
an RT-PCR assay using the primer IVT-PT7L for first
strand synthesis, and the IVT-up and IVT-PT7L primers
for the PCR reaction. As expected, the DDI-IV construct
showed no exon religation. The controls used in every selfsplicing assay included a reaction containing an aliquot of
the wt intron exposed to standard conditions but without
the RNA polymerase, to ascertain that each amplification
reaction was the product of transcription and not due to
DNA contamination (Fig. 3, -pol lane); a DNA-free sample
exposed to standard conditions (Fig. 3, -DNA lane); and an
in vitro-transcribed wt aliquot whose RNA was also
purified but for which no reverse transcriptase was added
to the RT-PCR mixture (Fig. 3, -RT lane). We observed
four bands of 1100 (not shown), 550, 400 and 350 bp for
the wt and DIEP constructs (Fig. 3). The products that
corresponded to sizes 1100, 550 and 350 bp were
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
Microbiology 154
S.ma.I2 GII intron invades resistance gene cassettes
Fig. 3. Self-splicing of the S.ma.I2 GII intron. Self-splicing of the wt and the DIEP-mutated S.ma.I2 GII intron was assayed with
an aliquot of the in vitro RNA and incubated in the presence of SB solution. -DNA, splicing reaction without the in vitrosynthesized RNA of the wt Sm909; HS, in vitro-synthesized S.ma.I2 intron RNA from strain Sm909 at high salt concentration;
NS, HS sample without Mg2+; DIEP, in vitro-synthesized IEP-less S.ma.I2 intron RNA at high salt concentration; -pol, HS
sample without T7 RNA polymerase; -RT, HS sample without the Superscript II reverse transcriptase; M, molecular mass
marker. Schematic diagrams of the amplification products are shown to the left of the gel. Filled grey rectangles indicate
the S.ma.I2 intron and white rectangles indicate the adjacent exons E1 and E2. The strong 400 bp product corresponded to the
predicted E1–E2 junction obtained after self-splicing as shown. Other products represent non-specific primer binding to the
RNA template. The dotted lines indicate the splicing site of the S.ma.I2 intron. The residues below indicate the RNA 59 and 39
extremities of the intron.
sequenced, and this showed that they did not correspond
to any cognate intermediate seen for other in vitro splicing
events of class C GII introns (Toor et al., 2006).
Consequently, we considered these bands as artefacts of
the methodology (Fig. 3). Sequence analysis of the 400 bp
fragment showed the ligation of exons E1 and E2,
confirming the correct splicing of S.ma.I2 (Fig. 3).
The S.ma.I2 GII intron invades the attC sites that
have the proper IBS1–IBS3 target sequences
To further characterize the S.ma.I2 GII intron, we proceeded
to test its mobility by co-transforming the pUCSmI plasmid
with each pLQ plasmid into E. coli JM109 (recA2) or JM107
(recA+). The pLQ plasmids provided different gene cassette
arrays. Since the S.ma.I2 intron was found within an attC
site, we evaluated the ability of this intron to insert into
other gene cassette structures (Table 2). Upon induction
with 1 mM ITPG at 37 uC, plasmid DNA was used to detect
the intron insertion event. The presence or absence of a PCR
product and the corresponding sequences that provided the
intron–exon junctions confirmed positive or negative intron
insertion. Gene cassettes that showed a positive intron
insertion were: ant(399)-Ia, ant(399)-Ic, aac(69)-Ia_orfG,
blaIMP-1, blaOXA-10 (blaPSE-2), sat2 and dfrA1 (Fig. 4a).
Analysis of the exon sequence alignment delineated the
conserved regions, which were found to be consistent with
the putative IBS1 suggested by Toor et al. (2001). One of
these regions is formed by only 4 nt (59 TTGT 39)
complementary to the proposed EBS1 site for the class C
GII introns (59 AACA 39, residues 204–207; Fig. 1). We also
observed a conserved region, 59 TAR 39, at the E2 (Fig. 4b
and positions +1 to +3 from Fig. 1). The thymidine
residue T+1 corresponds to the IBS3 site complementary to
the adenosine at position 242 in S.ma.I2 that has been
proposed as the EBS3 for class C GII introns (Figs 1 and 4b).
http://mic.sgmjournals.org
The EBS2 region is apparently absent, and the IBS2 region
was not seen in the CS obtained from the target sites invaded
by the S.ma.I2 intron nor was a convincing EBS2 region
observed in the intron sequence (Fig. 1). Only two gene
cassettes [aac(69)-Ib and orfH] were negative for the
insertion of the S.ma.I2 GII intron. Analysis of the potential
targets showed that their attC sites have a modification in
their IBS1 sequences. Instead of the conserved 59 TTGT 39,
the aac(69)-Ib and orfH gene cassettes possess the 59 TGGT
39 and 59 AGGT 39 sequences, respectively (Fig. 4a). These
findings suggest that modifications in this region disrupt the
interaction between the IBS1 site and its complementary
EBS1 in the intron RNA. Since the recognition site of intron
S.ma.I2 provided by IBS1 and IBS3 is 5 nt long, we searched
for other copies of the conserved sequence in the plasmid
sequences using the Findpatterns program from the GCG
software, including the 59 AR 39 nucleotides that were also
conserved (59 TTGTTAR 39, Fig. 4b). We found that this
region is present in every pLQ plasmid at position 1597 (in
the pACYC184 vector backbone; Rose, 1988). PCR analysis
showed no insertion into the recipient plasmid at this site. In
addition, a second 59 TTGTTAR 39 sequence copy was seen
only for two plasmids, pLQ425 and pLQ439 (Table 2), both
carrying the blaIMP-1 gene cassette. Although they contain a
second putative target site in the middle of the gene, using
the PCR technique we observed that none of these putative
DNA target sites showed intron invasion, which suggested
that the short primary sequence provided by the IBS1–IBS3
DNA sequence (59 TTGTT 39) is not on its own sufficient for
intron mobility.
A DNA secondary structure is required for S.ma.I2
mobility
Recently, it has been shown that stem–loop structures are
involved in the self-splicing and in vitro mobility of the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
1347
C. Quiroga, P. H. Roy and D. Centrón
Fig. 4. Mobility assay. The wt pUCSmI carrying the intron was co-transformed with plasmids carrying different target sites. (a)
Agarose gel showing the products of the mobility assay. The left-hand gel corresponds to the 39 intron–exon junction. N,
negative control; L, 100 bp ladder. The right-hand gel corresponds to the 59 intron–exon junction. H, 1 kb ladder. Each lane has
the respective target site assayed. Schemes represent the PCR products obtained with their respective combination of primers
showing the invasion of the intron. Horizontal arrows indicate the PCR product size. Grey shape, S.ma.I2 intron; striped
rectangle, attC site; white shape, gene cassette. (b) Letters in bold type above the curved line correspond to the EBS1 region
from the S.ma.I2 RNA. Letters in bold type with a grey background show the IBS sites in the recipient plasmid. The centre and
bottom groups of sequences show the bottom-strand DNA sequence alignment of the tested target sites; p_dfrA1 and u_dfrA1
correspond to the unpaired and restored stem–loop of the dfrA1 attC site, respectively (plasmids pUatt-dfr and pPatt-dfr in
Table 1). The upper sequence corresponds to the bottom-strand sequence of the donor DNA ant(299)-Ia : : S.ma.I2 gene
cassette from Sm909. Residue conservation is depicted using sequence logos (weblogo.uberkeley.edu/).
class C GII intron B.h.I1 from Bacillus halodurans (Toor et
al., 2006; Robart et al., 2007). We addressed the same
question for S.ma.I2 by testing in vivo the dependence of
the S.ma.I2 intron upon the stem–loop structure of the
attC site for invasion of novel target DNAs. We repeated
the mobility assay described above using as recipient
1348
plasmids (i) the pACDattC clone, which has 59 bp deleted
from the left-hand end of the dfrAI attC site; (ii) the
pACDIBS clone, which has 76 bp deleted from the lefthand end of the dfrAI attC site; (iii) the pUatt-dfr clone,
which has lost the stem–loop pairing; and (iv) the pPatt-dfr
clone, which has a restored complementation of the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
Microbiology 154
S.ma.I2 GII intron invades resistance gene cassettes
Fig. 5. Modifications of the dfrA1 attC for the
mobility assay. (a) Structure of the wt and
deleted dfrA1 attC sites. The white horizontal
arrow indicates the dfrA1 gene; the black
vertical rectangle depicts the 1L (59
GGTTAAC 39) region of the attC site; the
vertically striped rectangle shows the remaining dfrA1 attC site; the small vertical arrowheads depict the S.ma.I2 intron putative
insertion site. The pLQ424 carries the wt
dfrA1 attC site (93 bp). pACDattC has a
59 bp deletion from the right-hand end of the
attC; pACDIBS has a 76 bp deletion from the
right-hand end of the attC; pUatt-dfr has point
mutations that abolish the stem–loop pairing;
and pPatt-dfr has the complementary mutations that restore stem–loop formation of
pUatt-dfr (horizontally striped rectangle). (b)
Secondary structure of the modified drfA1
attCs. The empty rectangles indicate the IBS1
and IBS3 regions. 1R and 1L are highlighted
with black lines. The grey broken lines indicate
the deleted region of the attC site. The
coordinates indicate the position of the residues. The dfrA1 attC corresponds to the
pLQ424 plasmid; the DattC fragment corresponds to the pDattC plasmid; the IBS DattC
fragment corresponds to the pACDIBS plasmid; and u_dfrA1 attC and p_dfrA1 attC
correspond to pUatt-dfr and pPatt-dfr,
respectively. (c) Agarose gel with the mobility
assay for the modified attC sites. Lanes: 1,
pPatt-dfr; 2, pUatt-dfr; 3, pACDattC; 4,
pACDIBS; 5, negative control; 6, pLQ424
(positive control); H, 1 kb ladder.
modified dfrA1 attC from pUatt-dfr (Fig. 5a, b, Table 2)
Each clone was used for the mobility assay in the presence
of the pUCSmI plasmid, which carries the S.ma.I2 intron.
Our results showed that both attC deletions were negative
for intron mobility (Fig. 5c, lanes 3 and 4). Consistent with
this result, when the attC stem–loop was unpaired (pUattdfr clone), the S.ma.I2 intron did not invade the target site
(Fig. 5c, lane 2); on the contrary, when the stem–loop was
recovered, the intron inserted itself in the attC site (Fig. 5c,
lane 1).
These results confirmed that the S.ma.I2 intron, in
addition to the IBS1–IBS3 DNA sequence, also needs the
secondary structure provided by the attC site for successful
invasion of novel target sites.
Significantly, S.ma.I2 belonged to a strongly supported
group by three independent methods (neighbour-joining,
maximum-likelihood and maximum-parsimony). This
group comprises introns inserted within attC sites (Fig. 6,
thick black line; Supplementary Table S1). This implies that
the capacity to recognize attC sites arose in the common
ancestor of this clade, which has probably developed a
specific strategy for the recognition of a particular target
DNA (Supplementary Fig. S2a). We refer to this clade as the
class C-attC GII introns. Other class C GII introns that are
not inserted within attCs also showed strong bootstrap
support in their evolutionary lineages (Fig. 6). However, in
contrast to the class C attC intron lineage, their E1 showed a
wide variety of DNA secondary structures, such as the
Pseudomonas syringae and Azotobacter vinelandii intron
target sites (Supplementary Fig. S2b).
Bacterial introns that insert within attC target
sites show a distinctive evolutionary lineage
The phylogenetic analysis of the IEPs from a representative
set of class C GII introns revealed a tree topology with
a number of well-supported subgroups (Fig. 6).
http://mic.sgmjournals.org
DISCUSSION
Class C GII introns have been described as possessing
several properties, among them their ability for self-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
1349
C. Quiroga, P. H. Roy and D. Centrón
splicing. We have shown that the S.ma.I2 intron can selfsplice in the absence of its IEP at high salt concentrations
(50 mM Mg2+ and 500 mM NHz
4 ), which indicates that it
1350
is an active retrotransposon. Different deletions in key
regions of the intron sequence, DDIV and DDId-DIV,
suggest that S.ma.I2 functions similarly to other described
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
Microbiology 154
S.ma.I2 GII intron invades resistance gene cassettes
Fig. 6. Phylogenetic tree for the intron IEPs. The phylogram was obtained with the CLUSTAL_X software and refined with the
MEGA V3 program. The tree was obtained using the neighbour-joining method with 1050 bootstraps. Numbers in branches
indicates bootstrap values. The thick black branches depict those class C attC GII introns that have been reported in GenBank
(see Supplementary Table S1 for accession numbers and full species names); the attC sites invaded by these GII introns are
indicated within brackets. n.i., Not indicated; the grey branches show other class C introns; the thin black branches indicate
outgroups belonging to other bacterial intron classes.
GII introns (Noah & Lambowitz, 2003; Guo et al., 2000; Su
et al., 2005).
In addition, GII introns have a common genetic organization, being inserted in the opposite direction to transcription, and after intrinsic transcriptional terminators that
usually yield low levels of transcripts (Dai & Zimmerly,
2002; Robart et al., 2007). These properties probably favour
their survival in bacterial genomes for a long period of
time. Although our results provide evidence that the
S.ma.I2 intron is not transcribed in its natural host, the
possibility of a sporadic transcription from its right-hand
boundary should be considered. Taking into account our
results, it is likely that S.ma.I2 was acquired from a
different and unknown genome, in which it is probably
expressed and active. The passive transfer of S.ma.I2 is
suggested by the ability of the ant(299)-Ia : : S.ma.I2 gene
cassette to excise from the integron (Fig. 2d). The
disruption of the 1L region generated by the intron does
not affect the excision mediated by the integrase. Different
modifications within attC sites have been assayed in vitro
and in vivo (Johansson et al., 2004; Stokes et al., 1997).
Although a CAT substitution in the 1L has not been
described, we can see here that the ant(299)-Ia : : S.ma.I2
cassette is recombinationally active. Further studies should
be done in order to determine whether this cassette can
also integrate and be considered a fully functional element
(Stokes et al., 1997); however, the ant(299)-Ia : : S.ma.I2
gene cassette has guaranteed its own mobilization since it is
inserted in a class 1 integron within a conjugative plasmid
(Centrón & Roy, 2002).
When we analysed the mobility properties of the S.ma.I2
intron, we found that its DNA target sequence (59 TTGTT
39), represented by the IBS1 and IBS3 regions, partially
overlaps with the 1L region of the attC sites (59 GTTRRRY
39 at the bottom strand; Supplementary Fig S2a; Fig. 4b),
which can be found in all gene cassettes (Orman et al.,
2002; Ramı́rez et al., 2005; Senda et al., 1996; RoweMagnus et al., 1999). Retrohoming and retrotransposition
of GII introns are carried out by DNA and RNA pairings
between EBS1, EBS2 and EBS3 in the intron RNA and
IBS1, IBS2 and IBS3, respectively, in the target DNA. Since
the S.ma.I2 GII intron, like other class C GII introns, lacks
EBS2 (Dai & Zimmerly, 2002; Toor et al., 2001), the
interaction is reduced to the EBS1 (59 ACAA 39) and EBS3
regions (A+242; Fig. 1). Hence, the complete CS is formed
by only 5 nt, 59 TTGTT 39. Our results showed that there
are three highly conserved nucleotides (59 TAR 39) at the 59
end of the E2 region (Fig. 4b), containing the T+533
(AF453998) of the putative IBS3 proposed by Toor et al.
http://mic.sgmjournals.org
(2001), and two downstream nucleotides overlapping with
the attC 1L. Since the EBS3–IBS3 pairing probably occurs
between their respective A and T residues, the extra
nucleotides of this E2 region are a simple consequence of
sharing a common DNA structure with the integrase target
site.
Our mobility assays showed negative results when the
S.ma.I2 targeted a dfrA1 attC site that has been deleted or
modified by unpairing its stem–loop. On the other hand,
positive results were obtained when S.ma.I2 targeted attC
sites that were different in sequence and length. The
compensation of the mutations of the pUatt-dfr clone that
restore the stem–loop gave positive results for intron
invasion, confirming that the secondary structure provided
by the attC site is required for recognition of the target site,
regardless of the DNA sequence beyond IBS1 (Fig. 5). Toor
et al. (2006) implicated a stem–loop structure in the
recognition site for the B. halodurans class C GII intron
B.h.I1, and in a subsequent work Robart et al. (2007)
strongly suggested that this requirement is generic across
class C GII introns. These studies are in agreement with our
finding that S.ma.I2 requires not only the specific sequences
of the IBS1 and IBS3 regions but also the presence of a stem–
loop for intron invasion of a new target DNA.
Dependence on the secondary structure of DNA has recently
been reported in several studies. The phage CTX requires a
stem–loop for integration into the genome of Vibrio cholerae
(Val et al., 2005), while the TnpA transposase of ISHp608
uses an imperfect stem–loop for transposon end recognition
(Ronning et al., 2005). In this regard, the attC site belongs to
this group of ssDNA structures that act as a signal for a DNA
process. However, the attC site is the target not only of the
site-specific recombination event mediated by the integrases
but also for the insertion of the S.ma.I2 intron, by a process
that involves an RNA–DNA pairing. The phylogeny of these
introns also shows a recent branch formed by the class C attC
clade, suggesting a recent acquisition through a horizontal
gene transfer event. The selection of this event might be
biased by the fact that the exons for these introns correspond
to antimicrobial resistance gene cassettes. This evolutionary
strategy, which enhances the dispersal of mobile elements to
novel DNA niches by sharing the target site of other mobile
elements, may be a common process in nature.
ACKNOWLEDGEMENTS
We thank Steven Zimmerly for useful comments on the manuscript.
This study was supported by grant BID 1728 OC-AR ANPCyT 13431
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
1351
C. Quiroga, P. H. Roy and D. Centrón
from the Agencia Nacional de Promoción de Ciencia y Técnica to
D. C. and grant MT-13564 from the Canadian Institutes for Health
Research to P. H. R. C. Q. is a recipient of a Consejo Nacional de
Investigaciones Cientı́ficas y Técnicas (CONICET) fellowship. D. C. is
member of Carrera de Investigador Cientı́fico from CONICET.
bacterial group II intron encoding reverse transcriptase, maturase,
and DNA endonuclease activities: biochemical demonstration of
maturase activity and insertion of new genetic information within the
intron. Genes Dev 11, 2910–2924.
Messier, N. & Roy, P. H. (2001). Integron integrases possess a unique
additional domain necessary for activity. J Bacteriol 183, 6699–6706.
Michel, F. & Ferat, J. L. (1995). Structure and activities of group II
REFERENCES
introns. Annu Rev Biochem 64, 435–461.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,
Smith, J. A. & Struhl, K. (1994). E. coli, plasmids and bacteriophages.
Chapter 1 in Current Protocols in Molecular Biology, pp. 2.4.1–2.4.2.
NY: Greene Publishing Associates and Wiley Interscience.
Bouvier, M., Demarre, G. & Mazel, D. (2005). Integron cassette
insertion: a recombination process involving a folded single strand
substrate. EMBO J 24, 4356–4367.
Centrón, D. & Roy, P. H. (2002). Presence of a group II intron in a
multiresistant Serratia marcescens strain that harbors three integrons
and a novel gene fusion. Antimicrob Agents Chemother 46, 1402–1409.
Collis, C. M. & Hall, R. M. (1992). Gene cassettes from the insert region
of integrons are excised as covalently closed circles. Mol Microbiol 6,
2875–2885.
Cousineau, B., Lawrence-Cavanagh, S., Smith, D. & Belfort, M.
(2000). Retrotransposition of a bacterial group II intron. Nature 404,
1018–1021.
Dai, L. & Zimmerly, S. (2002). Compilation and analysis of group II
intron insertions in bacterial genomes: evidence for retroelement
behavior. Nucleic Acids Res 30, 1091–1102.
Granlund, M., Michel, F. & Norgren, M. (2001). Mutually exclusive
distribution of IS1548 and GBSi1, an active group II intron identified
in human isolates of group B streptococci. J Bacteriol 183, 2560–2569.
Guo, H., Karberg, M., Long, M., Jones, J. P., III, Sullenger, B. &
Lambowitz, A. M. (2000). Group II introns designed to insert into
therapeutically relevant DNA target sites in human cells. Science 289,
452–457.
Hall, R. M., Brookes, D. E. & Stokes, H. W. (1991). Site-specific insertion
of genes into integrons: role of the 59-base element and determination
of the recombination cross-over point. Plasmid 26, 10–19.
Jiménez-Zurdo, J. I., Garcı́a-Rodriguez, F. M., Barrientos-Durán, A. &
Toro, N. (2003). DNA target site requirements for homing in vivo of a
bacterial group II intron encoding a protein lacking the DNA
endonuclease domain. J Mol Biol 326, 413–423.
Johansson, C., Kamali-Moghaddam, M. & Sundström, L. (2004).
Integron integrase binds to bulged hairpin DNA. Nucleic Acids Res 32,
4033–4043.
Kennell, J. C., Moran, J. V., Perlman, P. S., Butow, R. A. & Lambowitz,
A. M. (1993). Reverse transcriptase activity associated with maturase-
encoding group II introns in yeast mitochondria. Cell 73, 133–146.
MEGA3: integrated software
for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5, 150–163.
Kumar, S., Tamura, K. & Nei, M. (2004).
Lambowitz, A. M. & Belfort, M. (1993). Introns as mobile genetic
elements. Annu Rev Biochem 62, 587–622.
Lévesque, C., Brassard, S., Lapointe, J. & Roy, P. H. (1994). Diversity
and relative strength of tandem promoters for the antibioticresistance genes of several integrons. Gene 142, 49–54.
MacDonald, D., Demarre, G., Bouvier, M., Mazel, D. & Gopaul, D. N.
(2006). Structural basis for broad DNA-specificity in integron
Mohr, G., Smith, D., Belfort, M. & Lambowitz, A. M. (2000). Rules for
DNA target-site recognition by a lactococcal group II intron enable
retargeting of the intron to specific DNA sequences. Genes Dev 14,
559–573.
Noah, J. W. & Lambowitz, A. M. (2003). Effects of maturase binding
and Mg2+ concentration on group II intron RNA folding investigated
by UV cross-linking. Biochemistry 42, 12466–12480.
Orman, B. E., Piñeiro, S. A., Arduino, S., Galas, M., Melano, R., Caffer,
M. I., Sordelli, D. O. & Centrón, D. (2002). Evolution of multi-
resistance in nontyphoid Salmonella serovars from 1984 to 1998 in
Argentina. Antimicrob Agents Chemother 46, 3963–3970.
Pyle, A. M. (2000). New tricks from an itinerant intron. Nat Struct Biol
7, 352–354.
Ramı́rez, M. S., Quiroga, C. & Centrón, D. (2005). Novel
rearrangement of a class 2 integron in two non-epidemiologically
related isolates of Acinetobacter baumannii. Antimicrob Agents
Chemother 49, 5179–5181.
Recchia, G. D. & Hall, R. M. (1997). Origin of the mobile gene
cassettes found in integrons. Trends Microbiol 5, 389–394.
Rest, J. S. & Mindell, D. P. (2003). Retroids in archaea: phylogeny and
lateral origins. Mol Biol Evol 20, 1134–1142.
Robart, A. R., Montgomery, N. K., Smith, K. L. & Zimmerly, S. (2004).
Principles of 39 splice site selection and alternative splicing for an
unusual group II intron from Bacillus anthracis. RNA 10, 854–862.
Robart, A. R., Seo, W. & Zimmerly, S. (2007). Insertion of group II
intron retroelements after intrinsic transcriptional terminators. Proc
Natl Acad Sci U S A 104, 6620–6625.
Ronning, D. R., Guynet, C., Ton-Hoang, B., Perez, Z. N., Ghirlando, R.,
Chandler, M. & Dyda, F. (2005). Active site sharing and subterminal
hairpin recognition in a new class of DNA transposases. Mol Cell 20,
143–154.
Rose, R. E. (1988). The nucleotide sequence of pACYC184. Nucleic
Acids Res 16, 355.
Rowe-Magnus, D. A., Guerout, A. M. & Mazel, D. (1999). Super-
integrons. Res Microbiol 150, 641–651.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory.
Senda, K., Arakawa, Y., Ichiyama, S., Nakashima, K., Ito, H., Ohsuka, S.,
Shimokata, K., Kato, N. & Ohta, M. (1996). PCR detection of metallo-
beta-lactamase gene (blaIMP) in Gram-negative rods resistant to broadspectrum beta-lactams. J Clin Microbiol 34, 2909–2913.
Stokes, H. W., O’Gorman, D. B., Recchia, G. D., Parsekhian, M. &
Hall, R. M. (1997). Structure and function of 59-base element
recombination sites associated with mobile gene cassettes. Mol
Microbiol 26, 731–745.
Su, L. J., Waldsich, C. & Pyle, A. M. (2005). An obligate intermediate
along the slow folding pathway of a group II intron ribozyme. Nucleic
Acids Res 33, 6674–6687.
recombination. Nature 440, 1157–1162.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. &
Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible
Matsuura, M., Saldanha, R., Ma, H., Wank, H., Yang, J., Mohr, G.,
Cavanagh, S., Dunny, G. M., Belfort, M. & Lambowitz, A. M. (1997). A
strategies for multiple sequence alignment aided by quality analysis
tools. Nucleic Acids Res 25, 4876–4882.
1352
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
Microbiology 154
S.ma.I2 GII intron invades resistance gene cassettes
Toor, N., Hausner, G. & Zimmerly, S. (2001). Coevolution of group II
intron RNA structures with their intron-encoded reverse transcriptases. RNA 7, 1142–1152.
Toor, N., Robart, A. R., Christianson, J. & Zimmerly, S. (2006). Self-
Zimmerly, S., Guo, H., Eskes, R., Yang, J., Perlman, P. S. &
Lambowitz, A. M. (1995a). A group II intron RNA is a catalytic
component of a DNA endonuclease involved in intron mobility. Cell
83, 529–583.
splicing of a group IIC intron: 59 exon recognition and alternative 59
splicing events implicate the stem–loop motif of a transcriptional
terminator. Nucleic Acids Res 34, 6461–6471.
Zimmerly, S., Guo, H., Perlman, P. S. & Lambowitz, A. M. (1995b).
Val, M. E., Bouvier, M., Campos, J., Sherratt, D., Cornet, F., Mazel, D.
& Barre, F. X. (2005). The single-stranded genome of phage CTX is
Zimmerly, S., Hausner, G. & Wu, X.-C. (2001). Phylogenetic
the form used for integration into the genome of Vibrio cholerae. Mol
Cell 19, 559–566.
Group II intron mobility occurs by target DNA-primed reverse
transcription. Cell 82, 545–554.
relationships among group II intron ORFs. Nucleic Acids Res 29,
1238–1250.
Zuker, M. (2003). Mfold web server for nucleic acid folding
Zhong, J. & Lambowitz, A. M. (2003). Group II intron mobility using
hybridization prediction. Nucleic Acids Res 31, 3406–3415.
nascent strands at DNA replication forks to prime reverse
transcription. EMBO J 22, 4555–4565.
Edited by: A. Holmes
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:31:24
1353