In Vitro Assessment of the
Cytocompatibility of MagnesiumBased Implant Materials with
Osteoclasts
Dissertation with the aim of achieving a doctoral degree
at the Faculty of Mathematics, Informatics and Natural
Sciences
Department of Chemistry
of Universität Hamburg
submitted by
Lili Wu
2015 in Hamburg
The following evaluators recommend the admission of the
dissertation:
Prof. Dr. Regine Willumeit-Römer
Prof. Dr. Ulrich Hahn
Date of disputation: 27th, Nov., 2015
Declaration on Oath
I hereby declare that except where reference to the literature as well as acknowledgement of
collaborative research and discussions have been made, this PhD dissertation entitled ―In
Vitro Assessment of the Cytocompatibility of Magnesium-Based Implant Materials with
Osteoclasts‖ represents my own original research work and effort and it has not been
previously submitted, in whole or in part, to qualify for any other academic award.
Signed:
16.09.2015, Geesthacht
Abstract
Peripheral blood mononuclear cells (PBMC) freshly isolated from human whole blood were
driven towards an osteoclastogenesis pathway. The effects of external addition of Mg salt
(coming from magnesium chloride; MgCl2) on osteoclastic differentiation as well as
resorption behaviour were evaluated. It was demonstrated that MgCl2 first accelerated
osteoclastic proliferation and differentiation until a concentration of 10 or 15 mM MgCl2 and
then it was reduced.
In an attempt to distinguish the influence of magnesium ion (Mg2+) from chloride ion
(Cl-) when the role of MgCl2 on osteoclastogenesis was investigated, osteoclastic response
to different concentrations of supplemented sodium chloride (NaCl) was assessed. While
50 mM Cl- coming from the addition of 25 mM MgCl2 was shown to decrease osteoclast
resorption activity, the same amount of Cl- from 50 mM NaCl was investigated to significantly
increase osteoclastic resorption activity. Therefore, it might be concluded that the first
elevated followed by reduced effects of MgCl2 on osteoclastogenesis was due to Mg2+ rather
than Cl-.
A series of Mg extract dilutions was further prepared and their role on osteoclastic
differentiation behaviour was investigated as well and compared with the results from the
cultures supplemented with MgCl2. While MgCl2 first enhanced and then opposed
osteoclastic differentiation, decreased cell metabolic activity whereas enhanced resorption
activity per osteoclast were discovered at a lower concentration of Mg extract. It therefore
could be concluded that: (i) Mg salt in the form of MgCl2 and Mg extract exhibited different
direct effects on osteoclast metabolism; (ii) while MgCl2 could enhance osteoclastic
proliferation and function activity up to a concentration of approximately 10 or 15 mM, Mg
extract exerted its positive effect on the resorption activity per osteoclast at a lower Mg
content (≈ 6 mM Mg2+).
In the next step an osteoblast-osteoclast coculture was established. Their responses
to a series of Mg extract dilutions were investigated. Phenotype characterization as well as
late osteoclastogenesis analyses suggested that while 14.36 mM Mg2+ of Mg extract was
extremely toxic to osteoclast monoculture, monocytes cocultured with osteoblasts exhibited
a far more superior tolerance to higher concentrated Mg extract. Results from specific
osteoblastic and osteoclastic markers (both gene and protein levels) revealed that 10.13,
14.36 and 26.67 mM Mg2+ of Mg extract were beneficial to osteoblastogenesis but exerted a
detrimental effect on osteoclastogenesis.
In summary, coculture of osteoblasts and osteoclasts has been shown in the present
work to be preferable for in vitro cytocompatibility assessment of Mg-based implants
compared to their monocultures. While a contribution of high concentration of Mg extract to
enhanced bone formation has been demonstrated, the impact of potentially decreased
osteoclastic resorption should be taken into account as well. Coculture of osteoblasts and
osteoclasts is a compromise way between in vitro monocultures and in vivo animal models
for compatibility assessment of Mg-based alloys for orthopaedic applications.
iv
Zusammenfassung
Die einkernigen Zellen des peripheren Blutes (Peripheral blood mononuclear cells, PBMC)
wurden frisch aus humanem Vollblut isoliert und daraufhin die Osteoklastogenese induziert.
Es wurde der Effekt von Mg Salz (in Form von Magnesiumchlorid; MgCl2) auf die
Differenzierung der Osteoklasten und deren Resorptionsverhalten studiert. Dadurch konnte
gezeigt werden, dass MgCl2 die Proliferation und Differenzierung der Osteoklasten bis zu
einer Konzentration von 10 bzw. 15 mM MgCl2 beschleunigt und danach abfällt.
Um zu sicher zu stellen, dass diese Reaktion an den Magnesiumionen (Mg 2+) und
nicht an den Chlorionen (Cl-) liegt, wurde der Einfluss von MgCl2 auf die Osteoklastogenese
untersucht und die Reaktion der Osteoklasten auf verschiedene Konzentrationen von
Natriumchlorid (NaCl) bewertet. Die in den 25 mM MgCl2 enthaltenen 50 mM Cl- führen zu
einer Reduzierung der Resorptionsaktivität der Osteoklasten. Außerdem konnte bei
derselben Cl- Konzentration, die in 50 mM NaCl enthalten ist, ein signifikanter Rückgang der
Resorptionsaktivität der Osteoklasten beobachtet werden. Daher ist es wahrscheinlich, dass
die beobachteten Effekte eher durch Mg2+ statt Cl- ausgelöst werden.
Im nächsten Schritt wurden Mg-Extrakte hergestellt. Um die Rolle des darin
enthaltenen Magnesiums auf die Osteoklasten zu untersuchen, wurde eine
Verdünnungsreihe angefertigt und mit den Ergebnissen der mit MgCl2 behandelten Kulturen
verglichen. Zwar wird auch die metabolische Aktivität der Zellen verringert allerdings, konnte
auch beobachtet werden, dass die Resorptionsaktivität der einzelnen Osteoklasten bei einer
geringeren Mg Extrakt Konzentration erhöht wird. Daraus kann geschlossen werden: (i)
Mg-Salz als MgCl2 oder als Mg Extrakt zeigen einen unterschiedlichen Effekt auf den
Metabolismus von Knochen resorbierenden Osteoklasten; (ii) MgCl2 kann bis zu einer
Konzentration von ca. 15 mM die Proliferation und die Osteoklastenaktivität steigern, der Mg
Extrakt hingegen übt seinen positiven Effekt bei einer deutlich geringeren Mg Konzentration
aus.
An diese Ergebnisse anschließend wurde die Osteoblasten-Osteoklasten Co-Kultur
etabliert. Daraufhin wurde das Verhalten der Co-Kulturen auf verschiedene Verdünnungen
des Mg Extraktes untersucht. Die folgende Charakterisierung des Phänotyps zeigte, dass
Mg Extrakte mit einer Konzentration von 14.36 mM Mg2+ oder höher extrem toxisch für die
Osteoklasten Monokultur ist. Hingegen weisen die Monozyten, die mit Osteoblasten
gemeinsam kultiviert wurden, eine weitaus höhere Toleranz gegenüber höheren Mg Extrakt
Konzentrationen auf. Ergebnisse von spezifischen Markern für Osteoblasten und
Osteoklasten (auf Gen- und Proteinlevel) zeigen, dass Konzentrationen von 10.13; 14.36
und 26.67 mM Mg2+ im Mg Extraktes einen positiven Effekt auf die Osteoblastogenese
aufweisen allerdings haben diese Konzentrationen einen schädlichen Effekt auf die
Osteoklastogenese.
Zusammenfassend konnte in der vorliegenden Arbeit gezeigt werden, dass eine CoKultur, die aus Osteoblasten und Osteoklasten besteht, für die Untersuchung der in vitro
Zytokompatibilität von Mg basierten Implantaten einer Monokultur vorzuziehen ist, da ein
Zusammenhang zwischen einer hohen Konzentration des Mg Extraktes und einer
v
Steigerung der Knochenbildung gezeigt werden konnte. Allerdings sollte auch ein möglicher
Rückgang der Resorptionsfähigkeit der Osteoklasten berücksichtig werden. Eine Co-Kultur
von knochenaufbauenden Osteoblasten und knochenabbauenden Osteoklasten ist ein
Kompromiss zwischen in vitro Monokulturen und dem in vivo Tiermodel für die Beurteilung
der Zytokompatibilität von Mg basierten Legierungen für die orthopädische Anwendung.
vi
Contents
Introduction ..................................................................................................... 1
1
1.1
Magnesium (Mg) as a potential biodegradable metallic material in orthopedic
applications .............................................................................................................................. 2
1.2
Bone cells and bone remodeling .......................................................................................... 4
1.3
In vitro cytocompatibility assessment for Mg-based alloys ........................................... 6
2
Motivation and Objective .......................................................................................... 10
3
Materials and Methods ....................................................................................... 11
3.1
Preparation of cell culture media ................................................................................. 11
3.2
Isolation of human PBMC ............................................................................................ 13
3.3
Cell culture ................................................................................................................... 14
3.4
Cell metabolism assay ................................................................................................. 16
3.5
Cell lysate preparation and Determination of total protein content ............................. 17
3.6
TRAP & alkaline phosphatase (ALP) activity assay.................................................... 18
3.7
TRAP staining .............................................................................................................. 19
3.8
CK and CTR staining ................................................................................................... 19
3.9
Resorption assay ......................................................................................................... 20
3.10
Real time quantitative polymerase chain reaction (RT-qPCR) ................................... 21
3.11
Cell morphology investigation...................................................................................... 22
3.12
Elisa.............................................................................................................................. 22
3.13
Alizarin Red S (ARS) staining ...................................................................................... 22
3.14
Statistical analysis........................................................................................................ 22
Results........................................................................................................... 24
4
4.1
Effects of extracellular MgCl2 on the differentiation and function of human
osteoclasts ............................................................................................... 24
4.1.1
WST-1 assay .....................................................................................................................24
4.1.2
Total protein content .........................................................................................................24
4.1.3
TRAP activity assay..........................................................................................................25
4.1.4
TRAP staining....................................................................................................................25
4.1.5
CK staining.........................................................................................................................26
4.1.6
CTR staining ......................................................................................................................26
4.1.7
2D resorption assay..........................................................................................................27
4.2
NaCl directly and dose-dependently increases osteoclastic differentiation and
resorption ................................................................................................................ 28
4.2.1
WST-1 assay .....................................................................................................................28
4.2.2
Total protein content .........................................................................................................28
4.2.3
TRAP activity assay..........................................................................................................29
4.2.4
TRAP staining....................................................................................................................29
vii
4.2.5
CTR staining ......................................................................................................................30
4.2.6
2D resorption assay..........................................................................................................31
4.2.7
3D resorption assay..........................................................................................................31
4.2.8
RT-qPCR ............................................................................................................................32
4.3
Effects of extracellular Mg extract on the differentiation and function of human
osteoclasts ................................................................................................................... 33
4.3.1
Mg-containing media ........................................................................................................33
4.3.2
WST-1 assay .....................................................................................................................33
4.3.3
Total protein content .........................................................................................................34
4.3.4
TRAP activity assay..........................................................................................................34
4.3.5
TRAP staining....................................................................................................................35
4.3.6
CK staining .........................................................................................................................36
4.3.7
CTR staining ......................................................................................................................36
4.3.8
2D resorption assay..........................................................................................................37
4.4
Effects of extracellular Mg extract on the proliferation and differentiation of human
osteoblast-osteoclast cocultures .........................................................................................37
4.4.1
Mg extract-containing media ...........................................................................................37
4.4.2
Cell morphology investigation .........................................................................................38
4.4.3
Total protein content .........................................................................................................38
4.4.4
LDH assay..........................................................................................................................39
4.4.5
TRAP activity assay..........................................................................................................39
4.4.6
ALP activity assay .............................................................................................................40
4.4.7
Elisa ....................................................................................................................................40
4.4.8
ARS staining ......................................................................................................................41
4.4.9
RT-qPCR ............................................................................................................................42
5
Discussion and Conclusions ........................................................................... 44
6
References ..................................................................................................... 54
7
Abbreviations ................................................................................................. 54
8
Acknowledgements ........................................................................................ 65
9
Appendix........................................................................................................ 67
viii
1 Introduction
1
Introduction
As a consequence of rising life expectancies, major traumatic injuries, resection of bone
tumours, the demand for substitution or reconstruction of encountered bone loss with
suitable materials remains to be a major concern in orthopaedic surgical applications [1-3].
Advances in material science and in medical technology allow the development of new
implant material for loading bearing application. Nevertheless, since all of the elements will
enter into the human physiological environment, it is ethically and financially deemed to be of
excellent biocompatibility. There should be no toxic or side effects or enabling to be tolerated
by the body without causing any potentially harmful perturbation [4]. This necessity limits the
range of candidate materials selected for such investigations to a relatively small number. It
includes mainly four types of materials: metals, ceramics, polymers and their composites of
two or more of the preceding [5].
Metallic implants made of medical-grade metals such as stainless steels (316L) [6],
commercially pure titanium (Ti) and Ti-6Al-4V alloys [7] as well as cobalt-chromium-based
alloys (Co-Cr alloys) [8] are typically employed for load bearing applications. Due to their
combination of more superior mechanical strength and fracture toughness, they are used to
assist with the repair or replacement of bone tissue [9-12]. However, there are several major
drawbacks associated with the utilisation of these conventional metallic implants. First, the
mismatch of the mechanical properties between different metallic materials and the
surrounding natural bone tissue may cause long-term adverse effects. For example, it leads
to an increased risk of local inflammation or even stress shielding effects which can reduce
stimulation of new bone growth and remodelling, thus decreased implant stability [13, 14].
Second, the possible release of toxic metallic ions, such as chromium, cobalt and nickel, into
the body may result in inflammatory cascades from the body‘s immune system and should
be considered potentially harmful to the surrounding tissues [15-25]. Third, a second surgical
removal procedure after the tissue has healed sufficiently is needed due to its neutral
properties in vivo, leading to an increase of health care costs and longer hospitalisation [26].
Alternatively, to reduce or avoid such complications, a considerable amount of
researches has been focused currently on the investigation of new classes of so-called
―biodegradable implants‖ in medical applications [27-30]. They compose of non-toxic
materials that can be gradually dissolved or absorbed by the human body after a reasonable
period of time. Therefore, it offers a less invasive repair and temporary support during tissue
recovery [9, 31, 32]. Nowadays most of the biodegradable implants are polymer-based since
they are lightweight, ductile in nature, biocompatible and biodegradable [33, 34]. However,
even possessing such attractive performances, they exhibit relatively insufficient mechanical
strength when compared to ceramics and metallic implants, making them unsuitable for
high-load bearing applications. Litsky et al. [35] reported the need for a second surgical
procedure because of the failure of the fixation by implants made of biodegradable polymers.
Moreover, the reaction between some organic polymers and human host tissues has also
been reported which results in severe osteolysis and eventually synovitis. Consequently,
with respect to better mechanical performance compared to biodegradable polymers,
1
1 Introduction
biodegradable metallic alloys are new promising materials for implant production whilst
taking into consideration of both the biodegradation and the specific mechanical properties.
1.1 Magnesium (Mg) as a potential biodegradable metallic
material in orthopaedic applications
Based on the requirements in terms of biocompatibility and their relatively fast
biodegradability, currently, iron (Fe)-based and Mg-based alloys have been commonly
investigated for this application [36, 37]. However, due to its higher elastic modulus (91 GPa)
and density (7.8 g/cm3) [38] as compared to human natural bone [38, 39], Fe is not
recommended for using as orthopaedic implants. From the point of view of the mechanical
performance, Mg alloys are therefore preferred as potential candidates for biodegradable
implants owing to their rather low stiffness (i.e., low Young´s modulus) which is closer to that
of human bone [9, 12, 40]. The major advantages are their excellent capacities for
biodegradability, biocompatibility combined with appropriate mechanical properties over
traditional metallic materials, ceramics and biodegradable polymers [9, 40, 41].
Biodegradability
One of the most desirable characteristics of Mg-based alloys is their ability to be degraded in
physiological environment after the bone tissues have healed, avoiding the need for a
secondary implant removal surgery [9, 31, 32]. The corrosion behaviour of unprotected Mg
exposed to a typical aqueous environment proceeds by an electrochemical reaction in which
magnesium hydroxide (Mg(OH)2) and hydrogen gas (H2) will be yielded [42].
It has been demonstrated that the grey oxide film of Mg(OH) 2 onto the Mg surface can
further protect the metal from ongoing corrosion by slowing down their corrosion rate [43].
However, since these films of Mg(OH)2 are slightly soluble in water, in an aqueous
physiological environment enriched with Cl-, a highly soluble MgCl2 will be formed due to the
dissolving of Mg(OH)2 layer by Cl-. It thus yields the soluble MgCl2 salt, leading to severe
corrosion [9, 43, 44]. Corrosion tests have been performed in vitro and particularly in vivo in
a range of Mg alloy systems, such as aluminium/zinc (AZ), aluminium/manganese (AM) and
yttrium/rare earth elements, indicating a high potential for medical applications [45-47]. Witte
et al. have successfully inserted open porous metallic scaffolds made of Mg alloy AZ91D
(containing (mass fraction, %) of 9.0 aluminium (Al), 1.0 zinc (Zn) and the balance of pure
Mg) into the femur of New Zealand White Rabbits. It has been shown that Mg implant had
substantially degraded after 3 months and then replaced with new bone [48, 49].
Nevertheless, Mg implants for bone applications are still not in clinical use, due mainly to
their inappropriately high and in some cases unpredictable corrosion rates. Alloying,
protective coatings as well as surface treatments can be applied to improve the mechanical
properties and corrosion resistance of Mg implants [43, 50, 51].
Biocompatibility
Mg2+ is undoubtedly one of the most important elements present in the human body that is
largely and mainly stored in muscle and bone tissues [52]. It has been estimated that the
human body usually contains approximately 35 g Mg per 70 kg body weight and the daily Mg
intake is recommended to be 375 mg/day [53]. Insufficient dietary Mg uptake has been
2
1 Introduction
proved to be associated with low bone mass, thus increased risk of the development of
osteoporosis, both in human epidemiologic studies [54, 55] and experimental animal
researches [56]. Mg depletion is also estimated to be closely associated with cardiac
arrhythmias, the development of atherosclerosis, vasoconstriction of coronary arteries and
increased blood pressure in the cardiovascular system [57]. Moreover, Mg is highly involved
in many metabolism processes and required for more than 325 biochemical reactions [9, 5860].
In an attempt to secure fracture involving the bones of the lower leg, as early as 1907
[9], Mg materials were first utilised as orthopaedic implants by Lambotte, a French surgeon.
However, it failed due to the rapid corrosion of the Mg metal, causing a large amount of gas
beneath the skin. Around 1938, McBride used screws, pegs, plates and bands prepared
from Mg alloys to secure 20 fractures and stated the non-toxicity of Mg metal as well as its
stimulatory effect on the early proliferation of connective tissue [61]. Consistent with this
research, in 1944, Troitskii and Tsitrin reported the success in securing various fractures
with plates and screws made from Mg, alloyed with small levels of cadmium [62]. In all the
34 cases of patients, no increase in serum levels of Mg and inflammatory reactions to the
implant was observed [62]. Similar results were also reported by Znamenskii in 1945 in
which gunshot wounds in two young men were successfully healed by the implantation of
Mg materials alloying with 10wt% Al [63]. While their biocompatibility was suggested by
these previously-mentioned early clinical investigations, a very large amount of evidence
coming from recent in vivo and in vitro researches also indicated that Mg-based implants are
non-toxic [30-32, 40, 48, 64-70].
Excellent mechanical properties
Except for its excellent biodegradability as well as its good biocompatibility, another
significant advantage of Mg-based alloys over currently used surgical metals is their unique
mechanical properties which are closely matched to those of bone. Being considered as an
exceptionally lightweight metal, Mg and its alloys possess densities ranging from
1.74-2.0 g/cm3 which is 1.6 and 4.5 times less dense than Al and steel, respectively and very
similar to that of bone (1.8–2.1 g/cm3) [9]. Pure Mg possesses a modulus of elasticity of
approximately 45 GPa, which is much more closely matched to that of natural bone than in
the case for Ti alloys (110–117 GPa), stainless steels (189–205 GPa) and Co-Cr alloys
(230 GPa). It thus minimizes the likelihood of stress shielding effect occurring and the
associated loss of bone density and strength, rendering them desirable load-bearing
hard-tissue implants [9].
Osteoconductivity and osteoinductivity
Apart from its biocompatibility, several studies have further reported its stimulatory effects on
bone healing processes, indicating the good osteoconductivity and osteoinductivity [30, 40,
45, 62, 65, 66, 71-73]. Fig. 1 showed the enhanced new bone formation surrounding the Mg
rods compared to the polymer control group. Both Precival [74] and Boanini et al. [75] have
demonstrated the stimulatory role of the presence of Mg on bone growth as well as bone
healing by enhancing the osteoblastic and osteoclastic activities. Similar results were also
found in studies conducted by Zhang [76] and Duygulu [77] which implied that Mg alloy AZ31
3
1 Introduction
(containing (mass fraction, %) of 3.0 Al, 1.0 Zn and the balance of pure Mg) implantation is
likely to be physiologically beneficial than harmful to the growth of new bone tissues and
biocompatible in animal experiments.
Fig. 1 Fluoroscopic images of cross-sections of
a degradable polymer (a) and a magnesium rod
(b) performed 10 mm below the trochanter
major in a guinea pig femur. Both specimens
were harvested 18 weeks postoperatively. In
vivo staining of newly formed bone by calcein
green. Bar = 1.5 mm; I = implant residual; P =
periosteal bone formation; E = endosteal bone
formation. Reprinted from ref. [40], copyright 2005, with permission from Elsevier.
1.2
Bone cells and bone remodelling
From a biological perspective, bone is a remarkable living, highly vascular, dynamic and
mineralised tissue that is continuously maintained and renewed. Of the many cells
associated with bone, there are three primary types that are of special interest: osteoblasts,
osteocytes and osteoclasts. They are responsible for the elaboration, maintenance and
resorption of bone tissue, respectively [78]. All their names start with the root ‗osteo‘
meaning ‗bone‘ in Greek. Their roles and the one of osteoprogenitor cells are shown
schematically in Fig. 2 [79].
Fig. 2 Left: The differentiated osteoclasts break
down bone tissue and generate resorption
lacunae (‗pit‘) by bone resorption. Centre:
osteoprogenitor cells are recruited to the area
and then differentiate into osteoblasts, while the
osteoblasts are already present, line the surface
of the bone tissue and proliferate. Right: the
osteoblasts deposit new bone in the cavity
through a process called ossification, while
some of them differentiate into mature bone
cells – osteocytes. Reprinted from ref. [80]. Non-commercial uses of the work are permitted without
any further permission from Dove Medical Press Limited, provided the work is properly attributed.
Osteoblasts
Osteoblasts are the cells working in groups to generate new bone matrix as our body grows,
i.e., bone-forming cells. The second part of the word, ‗blast‘, comes from a Greek word that
means ‗germ‘ or ‗embryonic‘. They are found on the surface of new bone and form
uncalcified collagen-rich protein mixture known as "osteoid". Osteoid comprises bony matrix
proteins such as type I collagen and other non-collagenous proteins including osteocalcin,
bone sialoprotein, osteopontin as well as osteonectin [81]. It subsequently mineralises to
become bone in which the stiffness and the compressive strength of the bone at the
expense of its energy-storing capacity are increased. After finishing making bone,
osteoblasts become either lining cells or osteocytes.
4
1 Introduction
Osteocytes
Osteocytes are star shaped bone cells which are most commonly found in compact bone
and considered to be the derivatives of the terminal differentiation stage of osteoblasts. They
are embedded in the space known as osteocytic lacunae within the mineralised matrix.
Osteocytes have many cytoplasmic processes (around 80) that are 15 µm in length for
connecting them to neighbouring osteocytes probably for the purposes of exchanging
minerals and communicating with other cells in the area [82].
Osteoclasts
Osteoclasts are multinucleated, terminally differentiated cells. They are derived from
hematopoietic cells of the monocyte-macrophage lineage and responsible for bone
resorption and remodelling during normal and pathological bone turnover [83]. The second
part of the word, ‗clast‘, comes from the Greek word which means ‗break‘. They can be
generally distinguished from other bone cells by their multinuclearity and positive
tartrate-resistant acid phosphatase (TRAP) staining (Fig. 3). These cells work as a team with
osteoblasts for reshaping bone. It has been well established that the survival, differentiation
and activation of osteoclasts are regulated by numerous hormones and cytokines produced
by macrophages and osteoblast/stromal cells [84]. Macrophage colony-stimulating factor
(M-CSF) was first shown to play an essential role on osteoclast generation and
differentiation. It acts through binding to its receptor, colony-stimulating factor 1 receptor
(c-Fms), on early osteoclast precursors, thereby signals required for their survival and
proliferation are provided. Although it has been known that M-CSF is important for osteoclast
formation and survival, it alone failed to stimulate osteoclastic bone resorption. Receptor
activator of nuclear factor kappa-B ligand (RANKL) on the other hand, is recognized as the
other cytokine which plays a crucial role on osteoclast differentiation and activation.
Moreover, the complete osteoclastogenesis has been proved to be achieved in vitro with
pure populations of macrophages in the exposure of only to M-CSF and RANKL [85].
Fig. 3 Fully differentiated, multinucleated,
TRAP-positive human osteoclast in vitro
(magnification 400x). Reprinted from ref. [86],
copyright 2006, with permission from Springer.
5
1 Introduction
Bone remodelling by osteoclasts and osteoblasts
During adult life, bone continually undergoes a renewed process called bone remodelling. It
is performed by clusters of bone-breaking osteoclasts and bone-generating osteoblasts to
attain and preserve skeletal size, shape, and structural integrity and to regulate mineral
homeostasis. It begins with the process conducted by multinucleated osteoclasts which are
formed through the fusion of mononuclear precursors of hematopoietic origin [87]. After
osteoclasts migrate to a resorption site, the sealing zone, a specific membrane domain, is
formed. Through the sealing zone osteoclasts attach tightly to the bone surface. Then the
production of another specific membrane domain, the ruffled border at the bone/osteoclast
interface is performed. Together with sealing zone, an isolated microenvironment is created
by osteoclasts. The subsequent resorption behaviour is completed by acidification of the
extracellular compartments lying beneath the osteoclasts and dissolution of both organic and
inorganic matrices [83]. On the contrary, the other process of bone remodelling, bone
formation is carried out by osteoblasts which originated from mesenchymal stem cells and
starts briefly after osteoclastic resorption stops. In physiological conditions, this sequence of
events is tightly coordinated both temporally and spatially. It is necessary for preserving
skeletal structural integrity, repairing damaged bone and maintaining mineral homeostasis
[88]. In order to finally achieve replacement of the substitution material by healthy bone,
interaction between the two cell types must be considered.
1.3
In vitro cytocompatibility assessment for Mg-based alloys
For any biodegradable Mg material to be developed for use in the biomedical applications,
they become resorbed by the body after a certain period of time. All the products from the
progressive corrosion will enter into the human physiological environment. Therefore, in the
pre-clinical steps, the potential cytotoxicity of the constituent elements of an implant material
should be seriously taken into consideration by submitting to a range of pre-toxicity tests, in
vitro or in vivo or both.
In vivo biocompatibility assessments have been predominantly carried out in small
animals, like rats, guinea pigs and rabbits. It has been proved that Mg or Mg alloys in
general are suitable for the orthopaedic applications and even revealed that they are
osteoinductive and they can promote bone remodelling [30-32, 40, 48, 49, 89]. However, in
vitro toxicity examinations are preferable regarding ethical considerations (i.e., the attempt to
restrict animal experimentation to a minimum) as well as the need for a fast investigation of
the vast newly developed Mg-based materials. Furthermore, it has been pointed out that the
results of tests examined outside the body are more reproducible [90, 91]. Thus, preliminary
in vitro cytocompatibility assays are continually being preceded as an appropriate
―pre-screen‖ means in order to characterize the potentially harmful effects of Mg-based
materials before it is ultimately used for human application [92-94].
Osteoblast model
Currently, most in vitro biocompatible investigations of Mg and its alloys involve cell culture
experiments performed predominantly using osteoblasts of murine or human origin to
analyse the capability of the respective material to support new bone formation. For example,
the human osteosarcoma cell line U2OS cells were cocultured with Mg specimen for one
6
1 Introduction
week. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as well as
visual observation through cell staining have revealed that there was no significant
difference in cell cytotoxicity between control and cultures in the presence of the corroding
Mg sample. It suggested that Mg could be suitable as a biodegradable implant material [38].
MC3T3-E1 cells were used for the cytotoxicity tests of nine binary Mg alloys (alloying
elements Al, silver (Ag), indium (In), manganese (Mn), silicon (Si), tin (Sn), yttrium (Y), Zn
and zirconium (Zr)). The results showed that there was no significant reduce in osteoblasts
cell viability when cultured with Mg-1Al, Mg-1Sn and Mg-1Zn alloy extract [95]. Apart from
Mg alloys, when Mg was incorporated into bone substitutes such as hydroxyapatite (HA),
tricalcium phosphate (TCP) or Ti alloy implants, their beneficial effects on osteoblast
adhesion, proliferation as well as differentiation behaviour have been demonstrated in a
large amount of studies [65-68, 96]. For example, compared to the Mg-free CO3Ap-collagen
composite, osteoblast adhesion to the FGMgCO3Ap-collagen composite was proved to be
accelerated due to the free Mg2+ [65]. Similarly, a significantly enhanced level of osteoblastic
adhesion activity for human bone-derived cells (HBDC) grown on Mg divalent cations
enriched substrates was estimated compared to those grown on the native unmodified
aluminium oxide (Al2O3). It accompanied with a subsequent increase in the expression of
type I collagen extracellular matrix protein [66]. Mg incorporation in TCP was found
significantly stimulated the adhesion and proliferation of human osteoblast-like SaOs2 cells
[67]. More recently, similar beneficial effects of Mg-enriched materials (Mg incorporated
fluoridated HA and Ti-based alloys) on bone cell attachment, proliferation and late
differentiation have been reported [68, 96]. The proliferation of human osteoblast-like MG63
cells was significantly increased in cultures with the external addition of Mg ions [69].
Osteoclast model
While the extensive utilisation of osteoblasts or their precursors for the in vitro
cytocompatibility assessment of Mg-based alloys, cellular and molecular characterization of
osteoclastic response to Mg-based alloys has been extremely rare. This is mainly due to two
properties of these cells. First, osteoclasts are very scarce in number relative to other cell
types in bone, particularly in physiological states in adult primates, covering only 1% of the
bony surface [97]. Second, osteoclasts are situated on calcified bone surfaces within the
medullary cavity. It is extremely difficult to harvest them or obtain pure populations of cells in
large number for biochemical and molecular analyses. Due to the above reasons, the
generation of osteoclasts from their precursors via in vitro models has been of major interest.
The discovery of RANKL and M-CSF has made the in vitro generation of osteoclasts from
mononuclear precursors possible, without the support of osteoblastic stromal cells [98].
In this present work, the initial effect of variable concentrations of Mg that comes from
MgCl2 solution on osteoclasts differentiation and function was investigated first. PBMC blood
mononuclear cells were driven towards an osteoclastogenesis pathway via stimulation with
RANKL and M-CSF for 28 days in the exposure of variable concentrations of MgCl2. Their
influence on osteoclast proliferation and function was evaluated based on cell metabolic
activity, total protein content, TRAP activity, cathepsin K (CK) and calcitonin receptor (CTR)
immunocytochemistry. The cellular ability to form resorption pits was assessed as well.
7
1 Introduction
Moreover, in order to distinguish the influence of Mg 2+ from Cl- when the effect of
MgCl2 on osteoclastic differentiation was investigated, the effect of various concentrations of
NaCl on the differentiation and function of human osteoclasts was tested. While 50 mM Clfrom 25 mM MgCl2 was investigated to decrease osteoclastic function, the same
concentration of Cl- coming from the addition of 50 mM NaCl was found to significantly
increase osteoclast resorption activity. It indicated that it might be Mg 2+ rather than Cl- that
played a role on osteoclastic differentiation behaviour. Surprisingly, a direct, parathyroid
hormone (PTH)-independent, concentration-dependent effect of hypernatremia on
osteoclastic resorption was investigated as well. The study suggested that the reported
enhanced bone resorption after diets rich in NaCl and in diseases with high serum sodium
(Na) may not only be secondary to the urinary loss of calcium (Ca) but also due to a direct,
cell-mediated effect of increased Na concentration on osteoclastogenesis.
In the comparison with the cultures exposed to different concentrations of MgCl2, the
effects of various dilutions of Mg extract on osteoclastic differentiation and function
behaviour were also estimated. Compared to MgCl2, Mg extract exhibited a different mode
influencing osteoclastogenesis. It suggested that (i) variations in the in vitro Mg2+ affects
osteoclast metabolism and (ii) Mg extract should be used preferentially for indirect in vitro
biomedical tests as they mimic the in vivo environment more closely compared to Mg salt.
Osteoblast-osteoclast coculture model
Bone is a dynamic, living organ that is constantly being reshaped through a precisely
coordinated process called bone remodelling. In vivo osteoblasts and osteoclasts are usually
coexisting on the surface of the bone tissue. It has been well estimated that they interact
with each other through a precisely coordinated process in which the crosstalk between
them plays a key role [88]. However, the interaction between them or even the role of
osteoclasts on the success or longevity of biomedical implants is often underestimated [86].
Therefore, new in vitro models involving investigation of both osteoblast and osteoclast
differentiation and activity on bone substitute are of great interest for biocompatible
investigation of new biomaterials. They are one step closer to natural conditions and allow
investigation of the complex communication between bone-building osteoblasts and
bone-breaking osteoclasts.
Different cell combinations of osteoblasts and osteoclasts have been reported
recently. For example, the coculture systems were established based on the combination of
primary osteoblasts or osteoblast cell lines with PBMC or other isolated monocytes [99-104].
Human mesenchymal stem cells (hMSCs) have been widely considered maintaining the
potential to differentiate into a variety of mesenchymal tissues [25]. However, due to their
senescence-associated growth arrest during the culturing period, only a limited amount of
cells can be generated [26]. For example, it has been reported that bone marrow stromal
cells (BMSC) had a markedly diminished proliferation rate and they gradually lost their
multiple differentiation potential after the first passage [27]. Human telomerase reverse
transcriptase (hTERT) transduced mesenchymal stem cells (SCP-1) is a well-established
hMSCs model cell line. It was immortalised through constitutive overexpression of hTERT
8
1 Introduction
and has been further demonstrated to be comparable to primary hMSCs because of their
potential to undergo osteogenic and adipogenic differentiation [28].
Therefore, in the present study, a human osteoblast-osteoclast coculture model
derived by hMSCs line SCP-1 and human monocytes PBMC was established for Mg-based
biomaterial testing. The cells‘ responses to various dilutions (concentrations) of Mg extract
were investigated.
9
2 Motivation and Objective
2
Motivation and Objective
In the present work, osteoclast monoculture as well as osteoblast-osteoclast coculture were
conducted in the supplement with enriched Mg2+ (coming from either Mg salt or Mg extract). I
attempt to pursue the following major goals:
1. Evaluate the influence of increased extracellular MgCl2 content on the
osteoclastogenesis process via various parameters concerning osteoclast
differentiation and function behaviour;
2. Establish the osteoclast monoculture system in the exposure of different
concentrations of NaCl to assess their cellular responses in order to distinguish the
influence of Mg2+ from Cl- when the effect of MgCl2 on osteoclastic differentiation
behaviour is investigated;
3. Investigate the effect of Mg extract on osteoclastogenesis in terms of cell
differentiation and function. The results will be in comparison with that from the
cultures supplemented with MgCl2;
4.
10
Develop an attractive coculture procedure consisting of osteoblasts and osteoclasts
to investigate both qualitatively and quantitatively the in vitro cellular response to Mg
extract. The outcomes will be compared with that from osteoclast monoculture.
3 Materials and Methods
3
Materials and Methods
3.1
Preparation of cell culture media
Preparation of MgCl2-containing media
A MgCl2 stock solution at a concentration of 1 M (Sigma-Aldrich Chemie GmbH, Munich,
Germany) was prepared in double-distilled water (ddH2O) and subsequently sterilised
through a 0.2 µm membrane filter (Merck KGaA, Darmstadt, Germany). Appropriate dilutions
(0, 2, 5, 10, 15 and 25 mM) were prepared by diluting the 1 M MgCl2 stock solution directly in
the cell culture medium, i.e., minimum essential α-minimum (α-MEM) (Biochrom AG, Berlin,
Germany) supplemented with 10% (v/v) foetal bovine serum (FBS; PAA Laboratories GmbH,
Linz, Austria).
Preparation of NaCl-containing media
A 1 M NaCl stock solution was prepared from NaCl powder (purchased from Sigma-Aldrich
Chemie GmbH, Munich, Germany) in ddH2O followed by sterile filtration through a
membrane filter (0.2 µm; Merck KGaA, Darmstadt, Germany). The NaCl stock solution was
appropriately and directly diluted in the cell culture medium α-MEM (Biochrom AG, Berlin,
Germany) supplemented with 10% (v/v) FBS (PAA Laboratories GmbH, Linz, Austria) for the
production of external addition of 0, 2, 5, 10, 15, 25 and 50 mM NaCl. The basal
concentration of Na+ in the medium was calculated at 142 mM according to the
manufacturer‘s formulation (see Na composition in Table 1). Four groups were resulted in
based on the clinical standards. They were normal (135-145 mM; two NaCl treatment groups
obtained by the external addition of 0 and 2 mM NaCl plus the basal 142 mM NaCl in
α-MEM), mild (146-149 mM; one NaCl treatment group obtained by the external addition of
5 mM NaCl plus the basal 142 mM NaCl in α-MEM), moderate (150-169 mM; three NaCl
treatment groups obtained by the external addition of 10, 15 and 25 mM NaCl plus the basal
142 mM NaCl in α-MEM) as well as severe hypernatremia (≥ 170 mM; one NaCl treatment
group obtained by the external addition of 50 mM NaCl plus the basal 142 mM NaCl in
α-MEM) conditions, respectively. An overview about the modifications differing in media
composition is present in Table 2.
Table 1 Na composition in α-MEM
Substance
Concentration (mg/l)
Concentration (mM)
NaCl
6800.0
116.4
NaH2PO4·2H2O
158.3
0.8
NaHCO3
2000.0
23.8
110.0
1
Na-pyruvate
Total Na
+
142
11
3 Materials and Methods
Table 2 Modifications differing in media composition
+
+
Modifications
Na in α-MEM
External addition
(mM)
(mM)
of Na (mM)
in the media (mM)
Normal (135-145)
142
0, 2
142, 144
Mild (146-149)
142
5
147
Moderate (150-169)
142
10, 15, 25
152, 157, 167
Severe (≥ 170)
142
50
192
+
Total Na
Preparation of Mg extract-containing media
Cuboid Mg specimens with dimensions of 1 cm x 1 cm x 0.5 cm were cut from a cast ingot of
pure Mg (99.98 wt%; Hydro Magnesium, Norway) via electrical discharge machining. The
samples were sterilised via sonication for 20 min in 100% isopropanol (2-propanol, Merck,
Darmstadt, Germany). Subsequently, they were incubated in the extraction medium α-MEM
(Biochrom AG, Berlin, Germany) supplemented with 10% FBS (PAA Laboratories GmbH,
Linz, Austria) for 72 h under physiological conditions (5% CO2, 20% O2, 95% humidity, 37°C).
The extraction medium to specimen weight ratio is 0.2 g/mL for the 1x extract preparation
according to EN ISO standards 10993:5 [105] and 10993:12 [106]. The Mg extract stock
solution was serially diluted (2, 3, 5, 10 and 30 times) in cell culture medium (referred to as
2x, 3x, 5x, 10x and 30x dilution of Mg extract, respectively). While five different dilutions (1x,
2x, 5x, 10x and 30x dilution of Mg extract) was used for studying the effect of Mg extract on
osteoclast monoculture, six dilutions (1x, 2x, 3x, 5x, 10x and 30x dilution of Mg extract) was
performed for osteoblast-osteoclast coculture system. Normal cell culture medium without
Mg extract was considered as control. As all the PBMC in the exposure of 2x and 1x dilution
of Mg extract (14.36 and 26.67 mM Mg2+, respectively) were observed dead on day 3, only
the results from osteoclast monocultures in the exposure of 5x, 10x and 30x dilution of Mg
extract (6.08, 3.50 and 1.46 mM Mg2+, respectively) were exhibited in the text below.
The osmolality, pH values as well as Mg and Ca contents in the series of Mg extract
solutions were further measured. Gonotec 030-D cryoscopic osmometer (Gonotec, Berlin,
Germany) and an ArgusX pH Meter (Sentron Europe BV, Roden, the Netherlands) were
used for osmolality and pH quantification, respectively. Mg concentrations were determined
via the metallochromic dye xylidyl blue followed by a colorimetric method. 10 µL Mg extract,
extraction medium, or different concentrations of MgCl2 (standard curve) was mixed with
1.5 mL of a xylidyl blue solution (200 mmol/L trishydroxymethylaminomethane buffer, pH 12,
containing 0.12 mmol/L xylidyl blue II, 0.05 mmol/L ethylene glycol tetraacetic acid (Titriplex),
69 mmol/L potassium carbonate, 2.1 mol/L ethanol and 0.05% sodium azide) (all chemicals
supplied by Sigma-Aldrich Chemie GmbH, Munich, Germany). The mixture was incubated at
room temperature (RT) for 10 min. The absorbance of the samples was measured at 520 nm
via an enzyme linked immunosorbent assay (Elisa) reader (Tecan Sunrise; TECAN
Deutschland GmbH, Crailsheim, Germany). Unknown concentrations of Mg content were
determined by the standard curve. Moreover, Calcium O-cresolphthalein kit (Futura system
Srl, Rome, Italy) and a calcium chloride (CaCl2; Sigma-Aldrich Chemie GmbH, Munich,
12
3 Materials and Methods
Germany) standard curve were used for the determination of Ca content. An aliquot of 50 µL
of the samples were mixed with 2 mL of reagent. After incubation at RT for 5 min, the
absorbance of the mixtures was measured at 580 nm with a Tecan Sunrise microplate
reader (Tecan Sunrise; TECAN Deutschland GmbH, Crailsheim, Germany). Unknown
concentrations were determined from the standard curve.
In order for better comparison with the results from the supplementation of different
concentrations of MgCl2, the concentrations of Mg2+ in the different dilutions of Mg extract
(rather than Mg extract dilutions) are used in the following text.
3.2
Isolation of human PBMC
PBMC were freshly isolated from the whole blood obtained from healthy and consenting
donors (purchased from the Institute for Clinical Transfusion Medicine and Immunogenetics
Ulm, Ulm, Germany). The procedure was based on a density gradient centrifugation
technique in which Ficoll Paque Plus (Amersham Biosciences, Uppsala, Sweden) was used.
To prevent clotting, human peripheral blood (approximately 25 mL) was treated with 1%
sodium-heparin and stored on ice before processing. It was then diluted 1:8 in
phosphate-buffered saline (PBS; 37°C pre-warmed, without calcium ion (Ca2+) and Mg2+;
Biochrom AG, Berlin, Germany). Then it was carefully layered over Ficoll Paque Plus (37°C
pre-warmed, 1:1, v/v, Amersham Biosciences, Uppsala, Sweden) to avoid mixing of the two
solutions followed by a centrifugation step without brake with 350 g at 20°C for 30 min. After
this centrifugation step, the monocyte-enriched hematopoietic fraction accumulates at the
interface between PBS (37°C pre-warmed, without calcium ion (Ca2+) and Mg2+; Biochrom
AG, Berlin, Germany) and Ficoll Paque Plus (37°C pre-warmed, Amersham Biosciences,
Uppsala, Sweden). These cells were carefully pooled and transferred in fresh tubes. These
tubes were filled to 50 mL with PBS (37°C pre-warmed, without calcium ion (Ca2+) and Mg2+;
Biochrom AG, Berlin, Germany) and centrifuged with 300 g at 20°C for 10 min with brake.
The wash step was repeated with PBS twice. After the wash step, the pellets were collected.
The cell pellet was then resuspended in 1 mL α-MEM (Biochrom AG, Berlin,
Germany) containing 10% (v/v) FBS (PAA Laboratories GmbH, Linz, Austria). 10 μL of cell
suspension was stained with 990 μL Trypan blue solution for the assessment of cell viability.
The number of isolated PBMC monocytes was determined by counting via a Neubauer
counting chamber (Brand GMBH + CO KG, Wertheim, Germany). Cell suspension at a
density of 2 x 106 cells/mL was prepared in α-MEM (Biochrom AG, Berlin, Germany)
supplemented with 10% (v/v) FBS (Life Technologies GmbH, Karlsruhe, Germany), 2 mM
L-glutamine (Life Technologies GmbH, Karlsruhe, Germany) and 1% antibiotic/antimitotic
solution (PAA Laboratories GmbH, Pasching, Austria). The purification of the culture was
performed by cell adherence in which the contaminating lymphocytes were disposed. Slices
of sterilised dentin chips were kindly provided by German customs in accordance with the
international laws for the protection of species. They were cut by a low speed saw with water
cooling to dimensions of 6 mm x 6 mm x 0.9 mm and were previously placed into the culture
wells in order to evaluate bone resorption activity (at least three slices per treatment per
donor).
13
3 Materials and Methods
3.3
Cell culture
Osteoclast monoculture
Monocytes freshly isolated from the whole blood (obtained from the Institute for Clinical
Transfusion Medicine and Immunogenetics Ulm, Ulm, Germany) were seeded in 48-well
plate (Nunc, Roskilde, Denmark) at a cell density of 2 x 106 cells/mL. For osteoclast
differentiation, the cells were cultured in the presence of factors promoting osteoclastic
differentiation, i.e. RANKL (Peprotech Germany, Hamburg, Germany; 40 ng/mL) and M-CSF
(Peprotech Germany, Hamburg, Germany; 20 ng/mL). Non-adherent cells were discarded
after 24 h to eliminate the culture of contaminating lymphocytes. To evaluate how MgCl2,
NaCl and Mg extract influence the differentiation and function behaviour of osteoclast
monoculture, different MgCl2 concentrations (0 (control), 2, 5, 10, 15 and 25 mM), NaCl
concentrations (0 (control), 2, 5, 10, 15, 25 and 50 mM) and Mg extract dilutions (control, 5x,
10x and 30x in culture medium) were added to the media, respectively. All the cell cultures
were cultured at 37°C, 5% CO2 and 95% H2O saturation. Phase contrast inverted
microscopy was conducted every day for monitoring of the cultures and half of the medium
was replenished every other days.
Human osteoclasts were differentiated for a period of 28 days during which the cell
culture medium was half refreshed every two days. In order to assess the impact of MgCl 2,
NaCl and Mg extract on osteoclastogenesis, biochemical parameters including viability and
TRAP activity were tested on days 3, 7, 14, 21 and 28. At the end time point of the culture
period (day 28), stainings including TRAP staining, immunocytochemistry detection of CK
and CTR were performed. Osteoclastic resorption activity on day 28 was also estimated by
testing their ability to form resorption pits. Additionally, mRNA expressions for osteoclastic
specific genes CK, osteoclast-associated immunoglobulin-like receptor (OSCAR) and
receptor activator of nuclear factor κ B (RANK) were further performed to assess the
molecular mechanism involved in the effect of NaCl on osteoclast resorption activity. For
MgCl2, the experiments were performed three times with three different donors, while for
NaCl as well as for Mg extract the experiments were conducted twice with two different
donors. The overview of osteoclast monocultures in MgCl2-containing media,
NaCl-containing media as well as Mg extract-containing media is present in Table 3.
Table 3 Overview of osteoclast monocultures
Osteoclast
Donors
Concentrations
Monoculture
Culture time
Time points
(days)
(days)
MgCl2
3
0, 2, 5, 10, 15, 25 mM
28
3, 7, 14, 21, 28
NaCl
2
0, 2, 5, 10, 15, 25, 50 mM
28
3, 7, 14, 21, 28
Mg extract
2
0, 5x, 10x, 30x dilution
28
3, 7, 14, 21, 28
The isolation of human PBMC and subsequent osteoclastogenesis for experiments
concerning osteoclast monoculture is briefly described as in Fig. 4.
14
3 Materials and Methods
Plasma
Blood
PBMC
Ficoll
Ficoll
Granulocytes
+ RBCs
Whole Blood
Osteoclast-like cells
Layers before
Centrifuge at 350g for 30 min
Layers after
Ficoll spin
without brake
Ficoll spin
Monocytes
on day 28
Centrifuge at 300g for 10 min
with brake
PBMC
+ PBS
2 times
Fig. 4 Experimental procedure for the isolation of human PBMC from the whole blood. Pictures
represent the different steps for the establishment of osteoclast monoculture system.
Osteoblast-Osteoclast coculture
For the osteoblast-osteoclast coculture experiment, hMSCs cell line SCP-1 was kindly
provided by Prof. Schieker (Experimental Surgery and Regenerative Medicine, Department
of Surgery, Ludwig-Maximilians-University). Böcker et al. have shown that they retained their
ability to undergo osteogenic differentiation [107]. They were cultured at 37°C in a 5% CO2
humidified atmosphere in the first osteogenic medium for 7 days. The first osteogenic
medium contains α-MEM (Biochrom AG, Berlin, Germany) supplemented with 10% (v/v)
FBS (PAA Laboratories GmbH, Linz, Austria), 2 mM L-glutamine (Life Technologies GmbH,
Karlsruhe, Germany), 1% antibiotic/antimitotic solution (PAA Laboratories GmbH, Pasching,
Austria) and osteoblastic differentiation factors (10-8 M Dexamethasone, 5 mM L-Ascorbic
acid, 10-8 M 1α,25 Dihydroxyvitamin D3). The cells were then further cultured in the second
osteoblast induction medium for another 21 days until the osteoblastic phenotype was
detected. The second osteogenic medium consists of α-MEM (Biochrom AG, Berlin,
Germany) supplemented with 10% (v/v) FBS (PAA Laboratories GmbH, Linz, Austria), 2 mM
L-glutamine (Life Technologies GmbH, Karlsruhe, Germany), 1% antibiotic/antimitotic
solution (PAA Laboratories GmbH, Pasching, Austria) and osteoblastic differentiation factors
(10-8 M Dexamethasone, 5 mM L-Ascorbic acid, 10-8 M 1α,25 Dihydroxyvitamin D3 as well
as 10 mM ß-Glycerolphosphate).
15
3 Materials and Methods
PBMC were isolated according to the procedure mentioned before and immediately
cocultured with differentiated osteoblasts in 48-well plates (Nunc, Roskilde, Denmark, at a
ratio of 1:100) to a final volume of 500 µL medium for 28 days. The coculture medium
remained the same as the one used for SCP-1 cell culture but neither with osteogenic
promoting factors nor osteoclastogenesis promoting factors (RANKL and M-CSF). Seven
different dilutions of pure Mg extract (control, 30x, 10x, 5x, 3x, 2x and 1x in culture medium)
were used and cultures were incubated in a humidified atmosphere at 37°C and 5% CO 2 for
up to 28 days. The culture medium was carefully renewed every two days. The entire
procedure was briefly described as in Fig. 5. The role of Mg extract on osteoblast and
osteoclast differentiation was characterized either throughout the culture time (days 7, 14, 21
and 28) or at the end of culture period (day 28).
Plasma
0.93/1.46/3.50/6.08/10.13/14.36/
26.67 mM Mg2+ of Mg extract
PBMC
Ficoll
Granulocytes + RBCs
Whole
Blood
Monocytes
Layers after Ficoll spin
28 days
Coculture
st
Ficollmedium
spin
1 Osteogenic
Osteoblast-Osteoclast Coculture
(7 days)
2nd Osteogenic medium
SCP-1
(21 days)
Osteoblasts
Fig. 5 Experimental procedures for osteoblastogenesis, isolation of human PBMC from the whole
blood as well as the coculture of osteoblast and PBMC in the exposure of different concentrations of
Mg extract. Pictures represent the different steps for the establishment of osteoblast-osteoclast
coculture system.
3.4
Cell metabolism assay
Water soluble tetrazolium (WST-1) assay
For the experiments concerning the effect of MgCl2, NaCl as well as Mg extract on the
differentiation and function of osteoclasts monoculture, to assess cellular viability, a standard
WST-1 (Roche Diagnostic GmbH, Mannheim, Germany) assay was used. It was performed
according to the manufacturer‘s instructions. The colorimetric assay is based on the
cleavage of the tetrazolium salt WST-1 by cellular enzymes to a highly coloured formazan.
The formazan could absorb at 450 nm and the amount of the dye directly correlates to the
number of metabolically active cells.
After 3, 7, 14, 21 and 28 days of culture, the cells were subsequently incubated with
a 10 vol.% WST-1 dye solution (50 μL/well; n = 3 wells) under cell culture conditions for 2 h.
Cell culture media (with corresponding Mg-containing, NaCl-containing as well as Mg
extract-containing solutions, respectively) containing 10% (v/v) of WST-1 without any cells
16
3 Materials and Methods
were performed as blanks and treated similarly. After incubation, 200 µL of the culture
supernatant (in triplicate) was collected and pipetted into 96-well plates (Nunc, Roskilde,
Denmark). Their absorbance was subsequently measured using a spectrophotometer
(Berthold Technologies GmbH, Bad Herrenalb, Germany) at 450 nm with a 620 nm
reference wavelength.
Lactate dehydrogenase (LDH) assay
For osteoblast-osteoclast coculture experiment, LDH assay instead of WST-1 assay was
performed by assessing LDH released into the media as a marker of dead cells. LDH is an
oxidative enzyme extensively existing in cell membranes and cytoplasm. As it is released
during tissue damage, determination of serum LDH activity is frequently considered as a
good indicator of cellular damage for cytotoxicity studies [108].
In the present study, the cell culture supernatants (n = 3 wells) were harvested at 7,
14, 21 and 28 days of culture. The LDH assay via a LDH cytotoxicity detection kit (Roche
Diagnostic GmbH, Mannheim, Germany) was conducted according to the manufacturer‘s
instructions. Briefly, 100 µL aliquot of LDH substrate buffer was added into 100 µL cell
supernatant (in triplicates) followed by incubation in dark at RT for 20 min. The absorbance
was measured with a spectrophotometric microplate reader at 490 nm with 600 nm as a
reference (Berthold Technologies GmbH, Bad Herrenalb, Germany).
3.5 Cell lysate preparation and Determination of total protein
content
Preparation of cell lysate
The total protein synthesized by osteoblast-osteoclast coculture in the exposure of different
concentrations of Mg extract was extracted on days 7, 14, 21 and 28. For osteoclast
monocultures supplemented with various concentrations of MgCl2, NaCl as well as a series
of Mg extract concentrations, the total protein content was also extracted on day 3.
The cell lysate was obtained by using radioimmunoprecipitation assay (RIPA) lysis
buffer. It contains 10 mM Tris, pH 7.6 (Carl Roth GmbH, Karlsruhe, Germany), 100 mM NaCl
(Carl Roth GmbH, Karlsruhe, Germany), 10 mM ethylenediaminetetraacetic acid (EDTA;
Carl Roth GmbH, Karlsruhe, Germany), 0.5% Nonidet P-40 (Sigma-Aldrich Chemie GmbH,
Munich, Germany) and 0.5% deoxycholic acid (Sigma-Aldrich Chemie GmbH, Munich,
Germany). In order to avoid any sample degradation, all solutions and materials used for this
procedure were previously cooled. Cell layers were rinsed twice with PBS and then covered
with RIPA lysis buffer which has been freshly supplemented with a protease inhibitor cocktail
(Sigma-Aldrich Chemie GmbH, Munich, Germany). The adherent cells were harvested with a
plastic cell scraper (TPP, Trasadingen, Switzerland) and subsequently the cell suspensions
were transferred into pre-labelled 1.5 mL micro-centrifuge tubes. After maintaining on ice for
30 min for lysis with pipetting up and down every 10 min, lysates were cleared of cell debris
by centrifugation at 10, 000 g for 10 min at 4°C.
17
3 Materials and Methods
Determination of total protein content
Total protein content in the cell lysates (biological replicates = 3) was subsequently
quantified with the BCA Protein Assay kit (Thermo Fisher Scientific, Bonn, Germany) in
which the procedure recommended by the manufacturer for microplate was followed and
bovine serum albumin (BSA) was used as protein standard. 25 μL BSA standard, blank
(lysis buffer) and the unknown samples were added into 200 μL working reagent (in
replicates; 50:1, Reagent A: B) and then incubated at 37°C for 30 min. A spectrophotometric
microplate reader (Berthold Technologies GmbH, Bad Herrenalb, Germany) at 560 nm was
used for the measurement of their absorbance and protein concentrations were determined
correlating to a standard protein curve of absorbance.
3.6
TRAP & alkaline phosphatase (ALP) activity assay
Extracellular TRAP activity determination
For the experiments concerning the effect of MgCl2, NaCl as well as Mg extract on the
differentiation of osteoclasts, after culturing for 3, 7, 14, 21 and 28 days, osteoclast
differentiation was evaluated based on the measurement of extracellular TRAP activity
(three biological replicates per treatment).
P-nitrophenylphosphate (pNPP disodium hexahydrate; Sigma-Aldrich Chemie GmbH,
Munich, Germany) was used as a substrate (pH 5.5-6.1). A 150 µL aliquot of the TRAP
reaction solution which consists of 100 mM sodium acetate (Carl Roth GmbH, Karlsruhe,
Germany), 50 mM disodium-tartrate dihydrate (Carl Roth GmbH, Karlsruhe, Germany) and
7.6 mM pNPP disodium hexahydrate (Sigma-Aldrich Chemie GmbH, Munich, Germany) was
added to 50 µL of the samples in 96-well plates (in triplicates). The mixtures were incubated
for 1 h at 37°C. Subsequently the enzymatic reaction was stopped by adding 50 µL of 3 M
sodium hydroxide (NaOH; Carl Roth GmbH, Karlsruhe, Germany). The absorbance was
measured at 405 nm (reference wavelength, 620 nm) using a microplate spectrophotometer
(Berthold Technologies GmbH, Bad Herrenalb, Germany).
Intracellular TRAP activity determination
Osteoclastogenesis in the coculture system with different concentrations of Mg extract was
quantified by the spectrophotometric measurement of intracellular TRAP activity (coming
from the cell lysate) after 7, 14, 21 and 28 days of culture. pNPP disodium hexahydrate
(Sigma-Aldrich Chemie GmbH, Munich, Germany) was used as a chromogenic substrate (3
biological replicates per Mg concentration). The measurement of intracellular TRAP content
was performed according to the same procedure as that for the extracellular TRAP
determination (three technical replicates; see Extracellular TRAP activity determination).
Intracellular ALP activity determination
To evaluate osteogenic differentiation in the coculture experiment, the measurement of
intracellular ALP activity was conducted on days 7, 14, 21 and 28. An aliquot of 25 µL cell
lysate (biological/technical replicates = 3) was mixed with 75 μL ALP substrate buffer (pH
adjusted to around 9.8). The ALP substrate buffer contains 9 mM pNPP disodium
hexahydrate (Sigma-Aldrich Chemie GmbH, Munich, Germany), 1 M diethanolamine
(Sigma-Aldrich Chemie GmbH, Munich, Germany), 1 mM MgCl2 (Sigma-Aldrich Chemie
18
3 Materials and Methods
GmbH, Munich, Germany) and 1% Triton-100 (Carl Roth GmbH, Karlsruhe, Germany). After
incubation at 37°C for 30 min, the enzymatic reaction was terminated by adding 25 μL NaOH
solution (3 M; Carl Roth GmbH, Karlsruhe, Germany). ALP activity was then determined
spectrophotometrically at 405 nm in a microplate reader (Berthold Technologies GmbH, Bad
Herrenalb, Germany).
3.7
TRAP staining
Because of its abundant expression of TRAP by osteoclasts [109, 110], except for the
determination of its extracellular/intracellular activity, the measurement of TRAP expression
of the adherent cells by TRAP staining is also a common approach for the quantification of
osteoclasts differentiation.
For the experiments concerning the effects of different concentrations of MgCl2, NaCl
and Mg extract on osteoclastogenesis, after 28 days of culture, TRAP staining was
performed. The adherent cells (three replicates for each condition) were rinsed with PBS and
then fixed with a TRAP fixation solution at RT for 5 min. The TRAP fixation solution contains
3.7% formaldehyde (Carl Roth GmbH, Karlsruhe, Germany) and 0.2% Triton X-100 (Carl
Roth GmbH, Karlsruhe, Germany). Subsequently, after removal of the fixation solution, the
cells were dyed with a TRAP staining solution. It contains 0.1 mg/mL naphthol AS-MX
phosphate (Sigma-Aldrich Chemie GmbH, Munich, Germany), 0.5 mg/mL fast red violet LB
salt (Sigma-Aldrich Chemie GmbH, Munich, Germany), 10 mM sodium tartrate (Carl Roth
GmbH, Karlsruhe, Germany) and 40 mM sodium acetate (pH 5.0; Carl Roth GmbH,
Karlsruhe, Germany). Followed by the removal of staining solution and replacement by PBS,
red-stained TRAP-positive multinucleated cells that possessed three or more nuclei were
scored as osteoclast-like cells (OCLs) and photographed. The means of at least five
representative fields of view per condition were determined for quantification and formulated
as the number of positive cells per mm2.
3.8
CK and CTR staining
The cellular expression of CK and CTR in osteoclasts cultured with different concentrations
of MgCl2 and Mg extract was detected via immunocytochemistry (two replicates for each
condition) after 28 days of culture. CTR staining was performed as well to investigate the
effect of different NaCl concentrations on osteoclastogenesis.
After washing with PBS, the cells were fixed with 3.7% formaldehyde (Carl Roth
GmbH, Karlsruhe, Germany) for 10 min at RT and then PBS was used for thorough rinse.
For CK staining, the fixed cell layers were subsequently permeabilised with 0.1% Triton
X-100 (Carl Roth GmbH, Karlsruhe, Germany) and 3% H2O2, 1:1 (v/v; Carl Roth GmbH,
Karlsruhe, Germany), in PBS for 5 min at RT and then washed two times by PBS. The cells
were immersed in BSA (10% in PBS (w/v); Carl Roth GmbH, Karlsruhe, Germany) for 1 h at
37°C in order to block the nonspecific binding sites. The cells were subsequently incubated
with a polyclonal anti-CK or polyclonal anti-CTR primary IgG antibody (1:450 in PBS
containing 1% (w/v) BSA; Santa Cruz Biotechnology, Inc., Heidelberg, Germany) for 1 h at
37°C. Followed by two PBS washing steps (5 min/time), the samples were incubated with
the appropriate secondary antibodies (Alexa Fluor 568 Goat Anti-Rabbit IgG (red) or Alexa
19
3 Materials and Methods
Fluor 488 Goat Anti-Rabbit IgG (Life Technologies GmbH, Karlsruhe, Germany (green)) and
goat anti-rabbit IgG-Texas Red (Santa Cruz Biotechnology, Inc., Heidelberg, Germany) for
the anti-CK and anti-CTR primary antibodies, respectively; 1:450 in PBS containing 1% (w/v)
BSA). The nonspecific staining was identified by conducting a negative control in which
staining omitting the primary antibodies was carried out. To visualise cell nuclei,
4-6-diamidino-2 phenylindole solution (DAPI; 1.5 µg/mL diluted in PBS; Sigma-Aldrich
Chemie GmbH, Munich, Germany) was subsequently used and the cells were
counterstained for 5 min at RT. The means of at least five representative images per
condition were determined for quantification and formulated as the percentage of CK- or
CTR-positive osteoclasts compared to control.
3.9
Resorption assay
Two-dimensional (2D) resorption assay
Functional assessment of osteoclast exposed to different concentrations of MgCl2, NaCl and
a series of concentrations of Mg extract was determined by a lacunar resorption assay. The
resorption assay has been considered as the hallmark of the osteoclastic bone-breaking
capacity. Osteoclast activity was determined in a lacunar resorption assay using cells
cultured on slices of ivory which is a commonly used resorbable substrate for in vitro
osteoclastic resorption assays (at least 3 chips per condition).
At the end of the culture period (day 28), cells were removed with 30% H2O2 (Carl
Roth GmbH, Karlsruhe, Germany) and by wiping the surface of bone slices with tissue
towels. To visualise resorption lacunae, dentine chips were stained with a 1% (w/v) toluidine
blue (Carl Roth GmbH, Karlsruhe, Germany) solution (in ddH2O) for at least 5 s at RT. After
the chips being rinsed twice in tap water, the resorbed areas (pits) were microscopically
visualised. At least five representative images were randomly captured from each dentine
piece. ImageJ analysis software [111] was used for the quantification of pit resorption area.
Three-dimensional (3D) resorption assay
After 2D assessment of bone resorption area, the spatial resorption activity of osteoclasts in
the conditions supplemented with different concentrations of NaCl was further determined by
3D resorption assay (at least 3 chips per condition). The volume of bone resorbed on the
dentin slices was analysed with a Color 3D laser microscope (VK-9700; Keyence Corp,
Japan) equipped with an optical laser unit and a scanning unit using dedicated VK Analyzer
image analysing software.
Briefly, the sample surface was horizontally scanned in a point-by-point, line-by-line
raster followed by vertical scanning through the movement of the lens in the direction of
Z-axis. Thus, the resultant images were generated in which the surface of the dentine chips
was characterized three-dimensionally. Five fields from each dentin slice were randomly
selected and resorption volume for at least three dentin chips per NaCl concentration was
assessed.
20
3 Materials and Methods
3.10 Real time quantitative polymerase chain reaction (RT-qPCR)
To analyse the differentiation of monocultured osteoclasts in the exposure of different
concentrations of NaCl as well as cocultured osteoblasts and osteoclasts in the culture
conditions with different concentrations of Mg extract, RT-qPCR was further conducted.
Cells were washed twice with PBS and immediately used for RNA preparation
(biological replicates per condition). Total RNA isolation was performed by using the High
Pure RNA Isolation Kit (Roche, Diagnostic GmbH, Mannheim, Germany) according to the
manufacturer‘s instruction. The concentrations of RNA samples were determined by a
Nanodrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). 150 ng
of total RNA was reversibly transcribed into complementary DNA (cDNA) using a final
volume of 20 μL reaction mixture with Oligo-dT primers (QuantiTect Reverse Transcription
Kit, Qiagen). For quantitative RT-qPCR experiments, 1 μL of cDNA was used as a template
and the analysis was performed using SsoFast EvaGreen Supermix and CFX96 Real-time
PCR Detection System (both from Bio-Rad Laboratories; technical replicates = 3). The
details of primer sequences (RANKL, osteoprotegerin (OPG), M-CSF, runt-related
transcription factor 2 (RUNX2), distal-less homeobox 5 (DLX5), CK, OSCAR, RANK, spleen
focus forming virus (SFFV) proviral integration oncogene (SPI1), nuclear factor-activated T
cells c1 (NFATc1), nuclear factor-κB 1 (NFκB1) and the housekeeping genes Actinβ, β2
microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal
protein L10 (RPL10)) are summarized in Table 4. The reference genes were carefully
selected according to the geNorm algorithm method [112] automatically calculated with the
CFX Manager Software (Bio Rad, Munich, Germany; version 3.0). The resulting PCR
products were analysed with CFX Manager Software (Bio Rad, Munich, Germany; version
3.0) and the mRNA levels were normalised using the expression of the housekeeping genes.
Table 4 Primer sequences applied for RT-qPCR
Gene
Forward Primer (5’-3’)
Reverse Primer (5’-3’)
RANKL
ATACCCTGATGAAAGGAGGA
GGGGCTCAATCTATATCTCG
OPG
CGCTCGTGTTTCTGGACAT
GGACATTTGTCACACAACAGC
M-CSF
TGCAGCGGCTGATTGACA
GATCTTTCAACTGTTCCTGGTCTACA
RUNX2
CAGTAGATGGACCTCGGGAA
ATACTGGGATGAGGAATGCG
DLX5
GAGTGTTTGACAGAAGGGTCC
GAATCGGTAGCTGAAGACTCG
CK
TCTCTCGGCGTTTAATTTGGG
AACCACCTCTTCACTGGTCAT
OSCAR
CCCCAGCTTCATACCACCCTA
CCGGCATCTCAAGGTCACG
RANK
GCTCAACAAGGACACAGTGTGC
CGCATCGGATTTCTCTGTCCCA
SPI1
ATGGAAGGGTTTCCCCTCGT
CCAGTAATGGTCGCTATGGCT
NFATc1
CACCAAAGTCCTGGAGATCCCA
TTCTTCCTCCCGATGTCCGTCT
NFκB1
CTGGAAGCACGAATGACAGA
CCTTCTGCTTGCAAATAGGC
(to be continued)
21
3 Materials and Methods
Reference Genes
Actinß
CTTCCTGGGCATGGAGTC
TGATCTTCATTGTGCTGGGT
B2M
TGCTGTCTCCATGTTTGATGTATCT
TCTCTGCTCCCCACCTCTAAGT
GAPDH
GTCGGAGTCAACGGATTTG
TGGGTGGAATCATATTGGAA
RPL10
AGTGGATGAGTTTCCGCTTT
ATATGGAAGCCATCTTTGCC
Except for the above approaches described in common, several extra assays were
performed for the osteoblast-osteoclast coculture experiment as well:
3.11 Cell morphology investigation
To evaluate the adhesion/proliferation and differentiation behaviour of osteoblast-osteoclast
cocultures in the media supplemented with different concentrations of Mg extract, cells were
co-seeded on the plastic surface of 48-well plates (Nunc, Roskilde, Denmark; at densities of
2 × 104 and 2 × 106 cells/mL for osteoblasts and PBMC, respectively) for 6 and 28 days. For
each time point, three wells of each condition were monitored and light microscopy was
performed for their morphological investigation.
3.12 Elisa
The quantitative determination of RANKL, M-CSF, and OSCAR in cell supernatant from the
coculture experiment (in replicates) was performed with the Human TNFSF11/RANKL ELISA
Kit (Biorbyt, catalogue No orb10264), Human M-CSF ELISA Kit (Biorbyt, catalogue No
orb50070), and the OSCAR ELISA Kit (Uscn Life Science Inc., catalogue No SEC695Hu),
respectively. It was conducted according to the protocol provided by the manufacturer (two
technical replicates). After detection, the absorbance of the samples was measured at 450
nm in an Elisa plate reader (Berthold Technologies GmbH, Bad Herrenalb, Germany).
3.13 Alizarin Red S (ARS) staining
ARS is an anthraquinone derivative that can be used to identify Ca in tissue sections and
forms an ARS-Ca complex in a chelation process, which is birefringent. Therefore, it has
been used for decades as one of the important means to assess osteoblastic mineralisation.
In the osteoblast-osteoclast coculture experiment, after 28 days of culture, the late
differentiation of cocultured osteoblasts was evaluated using ARS staining. Briefly, the
medium was removed, and the cell layers from three wells of the culture plates were rinsed
three times with PBS and fixed in 2% (v/v) formaldehyde solution (Sigma-Aldrich) at RT for
15 min. The cell layers were washed with ddH2O and then stained for Ca deposit with 0.5%
ARS (pH 4.0) (Sigma-Aldrich Chemie GmbH, Munich, Germany). The plates were incubated
at RT for 20 min with gentle shaking until the production of nice red-orange staining of Ca
was observed by light microscope. At least five representative fields of view were randomly
captured per well.
3.14 Statistical analysis
All data was presented as mean ± SD. Statistical analyses were carried out by SigmaStat
package (Systat software GmbH, Erkrath, Germany; version 11.0). One-way repeated
22
3 Materials and Methods
measures analysis of variance (ANOVA) was employed to compare all conditions for cellular
proliferation and differentiation parameters.
Depending on the data distribution, either one-way repeated measures ANOVA or
one-way repeated measures ANOVA on ranks was performed with the Dunn or Holm-Sidak
post-hoc test. Statistical significance was accepted when P < 0.05. Linear regression
analysis was conducted with change in TRAP-positive staining counts as well as 2D and 3D
resorption activity as the dependent variables and supplemented NaCl as independent
variable via SPSS Statistics version 20. To detect different gene expression in RT-qPCR,
Volcano Plot was employed in which the regulation threshold and P value were set to 2.00
and 0.05, respectively (directly calculated by CFX Manager Software; Bio Rad, Munich,
Germany; version 3.0).
23
4 Results
4
Results
4.1 Effects of extracellular MgCl2 on the differentiation and
function of human osteoclasts
The following observations were obtained from three independent experimental repeats
using the PBMC isolated from three donors.
4.1.1 WST-1 assay
To assess the cellular viability and proliferation of human PBMC/osteoclasts cultured with
different concentrations of MgCl2, WST-1 assay was used at different time points (on days 3,
7, 14, 21 and 28). It measures the intracellular mitochondrial dehydrogenase activity of
viable cells by forming water-soluble formazan dye with WST-1. Therefore, a change in the
number of living cells results in an increase or decrease in the amount of formazan dye
formed which could be quantified by measuring the absorbance at ë = 450 nm. From the
figure (Fig. 6) we can see that although there is an increase in WST-1 activity with increased
MgCl2 concentrations on days 3 and 7, no significant difference is detected. For days 14, 21
and 28, a trend of first increase until 5 or 10 mM of MgCl2 and then decrease was found
without statistically significant difference.
Fig. 6 Cellular metabolic activity of
human PBMC/osteoclasts cultured
in the media supplemented with
different concentrations of MgCl2
was conducted by WST-1 assay.
For each time point, 0 mM (without
external addition of MgCl2) was set
as the control (100%), to which the
WST-1 for other conditions was
normalised.
4.1.2 Total protein content
Normally, it is thought that the total protein content does not directly correlate with the cell
number. However, it does show the protein-synthesising activity within the cells, which can
reflect, to some extent, the proliferation and differentiation ability of the cultures. Thus, the
total protein content of human PBMC/osteoclasts cultures exposed to different
concentrations of MgCl2 was determined at different time points (on days 3, 7, 14, 21 and 28)
and the results are shown in Fig. 7. From the figure we can see, on days 3, 7, 21 and 28, the
total protein contents of human PBMC/osteoclasts in the cultures supplemented with
different concentrations of MgCl2 increase first and then decrease. However, on day 14, a
different trend is shown in which the decrease in total protein content is associated with the
increase in the supplementation of MgCl2.
24
4 Results
Fig. 7 Total protein was extracted
from human PBMC/osteoclasts
exposed to different concentrations
of MgCl2 on days 3, 7, 14, 21 and
28. For each time point, total
protein content isolated from cells
cultured in the control condition was
set as 100% while that for other
conditions was expressed as the
percentage of the control (%).
4.1.3 TRAP activity assay
Since TRAP is an important marker for osteoclasts, determination of its serum level is widely
used as an approach to monitor osteoclast differentiation. In the experiment concerning the
effect of MgCl2-containing media on human osteoclast differentiation, extracellular TRAP
activity was measured over time (days 3, 7, 14, 21 and 28) to investigate the effect of MgCl 2
on osteoclast differentiation. As shown in Fig. 8, MgCl2 has almost no effect on extracellular
TRAP activity, i.e., no statistically significant difference is detected at all the time points.
Fig. 8 Extracellular TRAP activities
of
human
PBMC/osteoclasts
cultured
with
different
concentrations of MgCl2 on days 3, 7,
14, 21 and 28 were evaluated by
extracellular TRAP activity assay.
For each time point, 0 mM (without
external addition of MgCl2) was set
as the control (100%), to which the
extracellular TRAP activities for
other conditions were normalised.
4.1.4 TRAP staining
Except for the measurement of TRAP activity, TRAP staining is also widely used for the
specific identification of osteoclasts. Therefore, it was carried out on day 28 to access the
formation of multi-nucleated osteoclasts. Fig. 9 shows us the results of TRAP staining for
human osteoclasts cultured with different concentrations of MgCl2. A clear bell-shaped
distribution pattern is observed with the maximum value at the culture condition
supplemented with 15 mM MgCl2. It is followed by a decrease at 25 mM (even lower than
control; statistically significant difference is detected between 5/10/15 mM and the control
group; see Fig. 9b).
25
4 Results
Fig. 9 TRAP staining of human
osteoclasts cultured in different
concentrations of MgCl2 was
conducted on day 28. (a)
Micrographs of TRAP staining for
OCLs cultured on dentine slice
(scale bar = 100 µm). (b) The
number of TRAP-positive cells
recorded in 0 mM MgCl2 was set as
the control (100%), to which the
numbers of TRAP-positive cells
under other conditions were
normalised.
Symbols
indicate
significant differences between
cultures
supplemented
with
different concentrations of MgCl2
and the control group (P < 0.05).
4.1.5 CK staining
Since CK is the enzyme that is responsible for the degradation of type I collagen in
osteoclast-mediated bone resorption, its expression in the human PBMC/osteoclasts
cultures with various concentrations of MgCl2 was determined by fluorescence staining on
day 28. The result is displayed in Fig. 10. An initial decrease in the number of CK-positive
cells in the cultures with 2 mM MgCl2 is detected. The number of CK-positive osteoclasts
remains stable until 25 mM of MgCl2. Then even fewer positive cells are observed compared
to the control group (statistically significant difference is detected between the control
condition and cultures with 2/25 mM MgCl2; see Fig. 10b).
Fig. 10 The detection of osteoclast
specific marker CK was performed
on day 28. (a) Images of cultures
with different concentrations of
MgCl2 (scale bar = 100 µm). The
staining of nuclei was performed by
DAPI staining and appears in blue
colour. (b) The number of
CK-positive cells under the control
condition was considered as 100%,
to which the count under other
concentrations was normalised.
Symbols
indicate
significant
differences between cultures with
different concentrations of MgCl2
and the control group (P < 0.05).
4.1.6 CTR staining
CTR has been shown to have a strong correlation with the generation of active osteoclasts.
Therefore, its expression in the human osteoclasts cultures exposed to different
concentrations of MgCl2 was accessed by CTR fluorescence staining at the last time point
26
4 Results
(day 28). As for CK staining, the similar pattern is observed for CTR staining of the cells
exposed to different concentrations of MgCl2. The result is shown in Fig. 11. From Fig. 11b,
we can see that an increased MgCl2 content first increases and then decreases the number
of CTR-positive cells (significant difference is observed between the cultures with
2/10/15/25 mM MgCl2 and the control group; see Fig. 11b).
Fig. 11 CTR immunocytochemistry
was conducted on day 28. (a)
Images of CTR (red) staining (scale
bar = 100 µm). Nuclei were stained
with DAPI and appear blue. (b) The
number of CTR-positive human
osteoclasts counted for the control
condition was set as 100%, to
which the numbers of CTR-positive
cells for other conditions were
normalised.
Symbols
indicate
significant differences between
cultures
supplemented
with
different concentrations of MgCl2
and the control group (P < 0.05).
4.1.7 2D resorption assay
In order to estimate the effect of MgCl2 on the osteoclast resorption activity,
osteoclast-generated resorption was investigated via toluidine blue staining, followed by
quantifying the surface area resorbed on dentine chips after culturing for 28 days. Fig. 12
shows us that osteoclastic resorption activity increases up to a certain MgCl2 concentration
and then decreases.
Fig. 12 Osteoclast resorption
activity was assessed by pits
absorption assay on day 28. (a)
Images of dentine resorption (scale
bar = 200 µm). (b) The resorbed
area measured under the condition
without the supplementation of
MgCl2 was set as 100%, to which
the resorbed areas measured for
other
concentrations
were
normalised.
27
4 Results
4.2 NaCl directly and dose-dependently increases osteoclastic
differentiation and resorption
The following observations were obtained from two independent experimental repeats using
the PBMC isolated from two different donors.
4.2.1 WST-1 assay
Cytotoxicity of different concentrations of NaCl against the human monocytes as well as
osteoclasts was measured by WST-1 assay on days 3, 7, 14, 21 and 28. The result is
presented in (Fig. 13). From the figure we can see, after 3 days of culturing, NaCl
significantly stimulated cell proliferation with a maximum effect at mild cell culture condition.
On days 7, 14, 21 and day 28, an increased NaCl content first increases (with the maximum
values reached at moderate condition) and then decreases the activity of WST-1 (significant
difference between moderate and the normal conditions found on day 14 while no significant
difference detected on days 7, 21 and 28). Moreover, it should be noted that although not
significant, the proliferating activity of cultures exposed to severe hypernatremia condition is
found to be kept continuously reduced during the whole culture course compared to the
control treatment.
Fig. 13 Effect of NaCl on human
PBMC/osteoclasts proliferation was
evaluated by WST-1 assay on days
3, 7, 14, 21 and 28. For each time
point, the value under normal
culture condition was set as the
control (100%), while results under
other conditions were normalised
as percentage of the control.
Symbols
indicate
significant
differences between the control
group and other hypernatremia
conditions (P < 0.05).
4.2.2 Total protein content
In order to access the protein-synthesizing activity of the human monocytes and osteoclasts
cultures exposed to different concentrations of NaCl, total protein content was measured on
days 3, 7, 14, 21 and 28. The results are shown in Fig. 14. From the figure we can see that
on days 3, 14 and 28, an increase in the concentration of supplemented NaCl first increases
and then decreases the total protein content of cultures in the exposure of different
concentrations of NaCl (significant difference detected between normal and severe
conditions on day 3). However, a different curve trend is observed on days 7 and 21 in which
the increase in NaCl concentration is found to be associated with diminished protein content.
It should be noted that the total protein content under severe hypernatremia condition is
always lower as compared to less severe hypernatremia conditions at all time points
although no significant differences were observed.
28
4 Results
Fig.
14 Effect of different
concentrations of NaCl on the total
protein content was evaluated. For
each time point, the protein content
from cells under normal culture
condition was set as the control
(100%), to which that under other
hypernatremia conditions were
normalised.
Symbols
indicate
significant differences between
normal group and hypernatremia
conditions (P < 0.05).
4.2.3 TRAP activity assay
As TRAP activity is widely regarded as an important cytochemical marker of osteoclasts, its
expression was measured in the human PBMC/osteoclasts cultures with different
concentrations of NaCl. A general bell-shaped distribution is observed on days 3, 14 and 21
(Fig. 15). The maximum levels are obtained at moderate condition on day 3 (statistically
significant differences observed between normal and mild/moderate/severe condition), mild
condition on days 14 and 21 (statistically significant differences detected between normal
and mild/moderate/severe condition on day 14 - normal and mild/severe condition on day
21). On day 7, there is almost no difference in the extracellular TRAP activity in the cultures
with different concentrations of NaCl. It is noteworthy that the extracellular TRAP amount
under the severe hypernatremia condition is significantly lower relative to
normal/mild/moderate condition after culturing for 28 days.
Fig. 15 Release of extracellular
TRAP activity in response to the
treatment of PBMC with NaCl was
measured. Normal condition was
set as the control (100%). Results
for
human
PBMC/osteoclasts
cultures with NaCl are expressed
as the percentage of TRAP release
in the cultures without NaCl
(control).
Symbols
indicate
significant differences between
normal group and hypernatremia
conditions (P < 0.05).
4.2.4 TRAP staining
In order to identify the number of TRAP-positive osteoclasts in the exposure of different
concentrations of NaCl, TRAP staining was used on day 28. An increase in the number of
TRAP-positive OCLs is found to be associated with the elevation in NaCl concentrations (Fig.
16). The formation of TRAP-positive OCLs is significantly enhanced in the severe
hypernatremia condition (≈ 4-fold compared to the control; Fig. 16b). A significant linear
correlation between NaCl concentration and the number of OCLs is investigated with R2 =
0.9008, P < 0.001 (Fig. 16c).
29
4 Results
Fig. 16 The formation of TRAP
expressing multinucleated human
osteoclasts on dentin slices after 28
days of culture. (a) Micrographs of
TRAP-positive
staining
of
multinucleated OCLs. Scale bar =
100 µm. (b) The number of
TRAP-positive cells with the normal
treatment was set as control (100%)
while the numbers of TRAP-positive
cells under other hypernatremia
conditions were expressed as the
percentage of control. The statistical
analyses are presented with symbols
representing
the
statistical
significances between the normal
group and hypernatremia conditions
(P < 0.05). (c) A linear relationship is
2
suggested by regression analysis (R
= 0.901, P < 0.001).
4.2.5 CTR staining
As a specific marker of the differentiated osteoclasts, the number of CTR-positive
osteoclasts exposed in different concentrations of NaCl was determined by CTR staining.
The result is shown in Fig. 17. From Fig. 17b we can see that the number of CTR-positive
cells increased with the increase in NaCl concentration. Significant difference is observed
between cultures under severe hypernatremia and the normal condition.
Fig. 17 CTR staining of human
osteoclasts cultured in different
concentrations of NaCl was
performed on day 28. (a)
Micrographs of CTR staining (scale
bar = 100 µm). (b) The number of
CTR-positive cells under the
normal treatment was set as 100%,
to which that under other
hypernatremia conditions were
normalised.
Symbols
indicate
significant differences between the
normal group and hypernatremia
conditions (P < 0.05).
30
4 Results
4.2.6 2D resorption assay
After 28 days of culture, the effect of NaCl supplementation on human osteoclasts resorption
function was tested via 2D resorption assay. As described before, dentin slices were placed
at the bottom of the culture well plates before seeding the monocytes in the presence of
various conditions of NaCl supplementation as well as two osteoclastogenesis promoting
factors (RANKL and M-CSF) for 28 days. As indicated in Fig. 18, similar osteoclast
resorption patterns are observed with TRAP staining. Osteoclastic resorption activity (in
terms of resorption area) is significantly and dosage-dependently increased with the
increase in the additional NaCl concentrations. More than three times of bone resorption is
obtained in the cultures under severe hypernatremia condition compared to the normal
condition (Fig. 18b). Moreover, a significant, linear correlation between NaCl concentration
and resorption area is detected by regression analysis with R2 = 0.8917 and P < 0.001
(Fig. 18c).
Fig. 18 Effect of NaCl on human
osteoclasts
resorption
was
evaluated by 2D resorption area
assay on day 28. (a) Determination
of osteoclastic resorption area by
toluidine blue staining. scale bar =
200 µm; (b) The resorbed area
measured for the normal treatment
was set as the control (100%), to
which the resorbed areas under
other hypernatremia conditions
were expressed as the percentage
of the control condition. The
respective statistical analyses are
presented and symbols denote
significant differences between the
normal group and hypernatremia
conditions (P < 0.05). (c) A positive
linear-correlation was determined
by
regression
analysis
with
2
R = 0.892; (P < 0.001).
4.2.7 3D resorption assay
Except for the measurement of resorption area via 2D resorption assay, 3D resorption assay
conducted by confocal laser scanning microscopy was further performed at the end time
point (day 28) in order to evaluate osteoclast resorption activity in terms of resorption volume.
Fig. 19a showed us the spatial resorption behaviour of human osteoclasts in various
hypernatremia conditions (i.e., normal/mild/moderate/severe hypernatremia condition). It can
31
4 Results
be clearly seen that both the shape and size of the individual resorption lacunae are highly
variable among different hypernatremia conditions. The pits produced by cells treated with
normal/mild/moderate hypernatremia condition are smaller and shallower when compared to
those created by cultures in the exposure of the severe hypernatremia condition (Fig. 19a).
When the resorption volume was quantified and normalised to the control (the normal
condition; 100%), it could be seen from Fig. 19b that there is a significant increase between
the normal condition and the mild/moderate/severe conditions (Fig. 19b). The excavated
volume by osteoclasts under severe hypernatremia condition is significantly increased by
3.5-fold higher compared to osteoclastic resorption volume under the control condition. A
linear correlation with R2 = 0.9664 and P < 0.001 was further detected by regression
analysis between the resorption volume and the concentration of supplemented NaCl
(Fig. 19c).
Fig. 19 Effect of NaCl on human
osteoclast resorption activity was
investigated by 3D resorption
analysis
via
confocal
laser
scanning microscopy after 28 days‘
culture. (a) Images of resorption
pits. The difference in the depths of
the resorption pits in the vertical
direction is represented by different
colour contours (black, deep; red,
shallow; µm); (b) VK Analyzer
image analysing software was used
to determine the resorbed volume.
The resorbed volume of pits
measured under the normal
condition was recorded as the
control (100%), to which the
resorbed volumes evaluated under
other hypernatremia treatments
were normalised. The respective
statistical analyses are presented.
Symbols
indicate
significant
differences between normal group and hypernatremia conditions (P < 0.05); (c) A linear-correlation
relationship between the resorption volume and the concentration of supplemented NaCl is detected
2
with R = 0.9664 and P < 0.001 by regression analysis.
4.2.8 RT-qPCR
To access the effects of different concentrations of NaCl on the expression of human
osteoclast specific genes, RT-qPCR was performed on day 28. As shown in Fig. 20, when
cells were treated with varying concentrations of NaCl, mRNA expression for CK, OSCAR
and RANK is not significantly modified in the samples under different hypernatremia
conditions. It indicates that osteoclasts expressed CK, OSCAR and RANK mRNA constantly
and that their expression was not affected by treatment with different concentrations of NaCl.
32
4 Results
Fig.
20
Effect
of
various
hypernatremia conditions on CK,
OSCAR
and
RANK
mRNA
expression in human OCLs.
Isolated PBMC cells were exposed
to the factors RANKL and M-CSF
as well as the supplementation of
different concentrations of NaCl for
28 days. After removal of the
media, RNA was extracted and
reverse transcribed. cDNA was
subsequently subjected to PCR
using specific primers. Expression
of the markers was normalised to the expression of the reference genes. For comparison, gene
expression in normal condition was set to 1.
4.3 Effects of extracellular Mg extract on the differentiation and
function of human osteoclasts
The following observations were obtained from two independent experimental repeats using
the PBMC isolated from two donors.
4.3.1 Mg-containing media
The measurement of Mg and Ca contents as well as their pH values and osmolalities was
performed in order to characterize the different concentrations of Mg extract. The results are
presented in Table 5.
Table 5 Characterization of Mg extract solutions
-1
Extract
pH
Osmolality (osmol kg )
Mg content (mM)
Ca content (mM)
ɑ-MEM+10% FBS
7.80
0.33
0.93
1.76
1x
8.35
0.51
26.67
0.08
5x
8.04
0.46
6.08
1.42
10x
7.90
0.38
3.50
1.59
30x
7.80
0.34
1.46
1.70
4.3.2 WST-1 assay
Cell viability of the PBMC/osteoclasts cultures supplemented with different concentrations of
Mg extract was determined using WST-1 assay on days 3, 7, 14, 21 and 28. As shown in Fig.
21, WST-1 activity is enhanced with the increase in the concentration of Mg extract on day 3
(statistically significant difference detected between 0.93 and 6.08 mM Mg2+ of Mg extract).
However, the Mg extract concentrations decreases WST-1 activity at the following time
points with the statistically significant differences detected on days 14 and 21 between the
control and 3.50/6.08 mM Mg2+ of Mg extract as well as on day 28 between the control and
6.08 mM Mg2+ of Mg extract.
33
4 Results
Fig. 21 Cellular metabolic activity
of the human PBMC/osteoclasts
cultured
in
the
media
supplemented
with
different
concentrations of Mg extract was
conducted by WST-1 assay. The
absorbance was detected using a
spectrophotometer at a wavelength
of 450 nm with a reference
wavelength of 620 nm to determine
the cell viability in comparison with
the control (with no additional Mg
extract). For each time point, the
control condition was set as 100%,
to which the WST-1 for other concentrations was normalised. Respective statistical analyses are
presented and symbols indicate significant differences between the control group and cultures
supplemented with different concentrations of Mg extract (P < 0.05).
4.3.3 Total protein content
Except for WST-1, the direct approach, the measurement of total protein content was also
performed which indirectly indicated the proliferation and differentiation ability of the human
PBMC/osteoclasts cultures with different concentrations of Mg extract. As shown in Fig. 22,
total protein content from cultures exposed to various concentrations of Mg extract exhibits
different patterns in different time points. While a general time-dependent increase/decrease
in total protein content occurred on day 3 and day 28, respectively, on days 7, 14 and 21,
there is a decrease first until 3.50 mM Mg2+ of Mg extract and then followed by an increase.
However, no significant difference is detected at all the time points.
Fig. 22 Total protein content was
extracted from PBMC/osteoclasts
exposed to a series of Mg extract
concentrations. For each time point,
total protein content from cells
cultured in the control condition
was set as 100% while that for
other conditions was expressed as
the percentage of control. No
significant differences between
control and cultures supplemented
with different concentrations of Mg
extract are detected.
4.3.4 TRAP activity assay
The effects of various concentrations of Mg extract on human PBMC/osteoclasts were
determined at different time points by measuring the extracellular TRAP activity as it is a
biochemical marker of osteoclast function and degree of bone resorption. Fig. 23 shows the
results of extracellular TRAP activity of cultures in the presence of a series of Mg extract
concentrations. A clearer trend is observable, i.e., a constant decrease in the extracellular
34
4 Results
TRAP activity is found associated with increased concentrations of Mg extract over days
(statistically significant differences are detected between control and 6.08 mM Mg 2+ of Mg
extract on days 7, 14, 21 and 28 - control and 3.50 mM Mg2+ of Mg extract on days 3, 7, 14
and 21 - control and 1.46 mM Mg2+ of Mg extract on day 7).
Fig.
23
Extracellular
TRAP
activities
of
human
PBMC/
osteoclasts cultured with different
concentrations of Mg extract were
evaluated by TRAP activity assay.
The absorbance was measured at
405
nm
with
a
reference
wavelength at 620 nm. For each
time point, the culture without
external addition of Mg extract was
set as the control (100%), to which
the extracellular TRAP activities for
other conditions were normalised.
The respective statistical analyses
are presented. Symbols indicate significant differences between the control group and cultures
supplemented with different concentrations of Mg extract (P < 0.05).
4.3.5 TRAP staining
The quantification of TRAP-positive human osteoclasts in the cultures with different
concentrations of Mg extract was determined using TRAP staining. As shown in Fig. 24, a
decrease in the number of TRAP-positive osteoclasts is observable associated with
increased concentrations of Mg extract (see Fig. 24b; statistically significant difference
observed between control and 3.50/6.08 mM Mg2+ of Mg extract).
Fig. 24 TRAP staining of human
osteoclasts cultured in different
concentrations of Mg extract was
performed on day 28. (a)
Micrographs of TRAP staining
(scale bar = 100 µm) (0.93/1.46/
2+
6.08 mM Mg
of Mg extract,
respectively). (b) The number of
TRAP-positive cells recorded in
2+
0.93 mM Mg of Mg extract was
set as the control (100%), to which
the numbers of TRAP-positive cells
under other conditions were
normalised. The statistical analyses
are presented. Symbols indicate
significant differences between
control and cultures supplemented
with different concentrations of Mg extract (P < 0.05).
35
4 Results
4.3.6 CK staining
To quantify the effects of Mg extract on the number of CK-positive human osteoclasts, CK
staining was done on day 28. The results of CK expression in osteoclasts exposed to
different concentrations of Mg extract are displayed in Fig. 25. A continuous decrease in the
number of CK-positive cells is found to be associated with increased concentrations of Mg
extract (statistically significant decrease observed between the control and
1.46/3.50/6.08 mM Mg2+ of Mg extract treatments; see Fig. 25b).
Fig. 25 The detection of osteoclast
specific marker CK was performed
on day 28. (a) Images of cultures
supplemented
with
different
concentrations of Mg extract (0.93/
2+
1.46/6.08 mM Mg of Mg extract,
respectively; scale bar = 100 µm).
The staining of nuclei was
performed by DAPI staining and
appears in blue colour. (b) The
number of
CK-positive cells
counted under the control condition
was considered as 100%, to which
the numbers of CK-positive cells
under other conditions were
normalised. Respective statistical
analyses are presented and
symbols indicate significant differences between the control group and cultures supplemented with
different concentrations of Mg extract (P < 0.05).
4.3.7 CTR staining
The detection of osteoclastic specific marker CTR was performed by CTR staining on day 28
(Fig. 26). For the number of CTR-positive osteoclasts under the conditions exposed to
various concentrations of Mg extract, no significant difference is detected (see Fig. 26b).
Fig. 26 CTR immunocytochemistry
was conducted on day 28. (a)
Images
of
CTR
(red)
(0.93/1.46/6.08 mM Mg
2+
staining
of Mg
extract, respectively; scale bar =
100 µm). Nuclei were stained with
DAPI and appear blue. (b) The
number of CTR-positive human
osteoclasts counted for the control
treatment was set as 100%, to
which the numbers of CTR-positive
cells for other conditions were
normalised.
36
4 Results
4.3.8 2D resorption assay
Dentine resorption activity assay was performed on day 28 to estimate the effect of Mg
extract on human osteoclast resorption activity (Fig. 27). The resorption activity per
osteoclast for the cells cultured with different Mg extract concentrations was surprisingly
increased up to 6.08 mM Mg2+ of Mg extract (Fig. 27b; significant difference was detected
between the control group and the cultures supplemented with 6.08 mM Mg2+ of Mg extract).
Fig.
27
Human
osteoclast
resorption activity was assessed by
pits absorption assay on day 28. (a)
Images of dentine resorption
2+
(0.93/1.46/6.08 mM Mg
of Mg
extract, respectively; scale bar =
200 µm). (b) The resorbed area
measured under control conditions
was set as 100%, to which that
measured for other conditions were
normalised. The statistical analyses
are presented. Symbols indicate
significant differences between the
control condition and cultures
supplemented
with
different
concentrations of Mg extract
(P < 0.05).
4.4 Effects of extracellular Mg extract on the proliferation and
differentiation of human osteoblast-osteoclast cocultures
The following observations were obtained from two independent experimental repeats using
the PBMC isolated from two donors.
4.4.1 Mg extract-containing media
To characterize the different concentrations of Mg extract, their pH and osmolalities as well
as the Mg and Ca contents were determined and the results are present in Table 6.
Table 6 Characterization of Mg extract and its dilutions
-1
Extract
pH
Osmolality (osmol kg )
Mg content (mM)
Ca content (mM)
0
7.80
0.33
0.93
1.76
30x
7.80
0.34
1.46
1.70
10x
7.90
0.38
3.50
1.59
5x
8.04
0.46
6.08
1.42
3x
8.09
0.48
10.13
0.97
2x
8.17
0.49
14.36
0.43
1x
8.35
0.51
26.67
0.08
37
4 Results
4.4.2 Cell morphology investigation
The initial cellular adhesion, proliferation and differentiation behaviour of human osteoblasts
and monocytes/osteoclasts in the cocultures exposed to a series of Mg extract
concentrations after 6 and 28 days of culture was estimated via light microscopy. As
indicated in Fig. 28a (only results of cells cultured in 0.93, 3.50, 6.08 and 26.67 mM Mg 2+ of
Mg extract are presented), after 6 days of incubation osteoblasts were alive in all the cell
conditions (as shown in black arrow). However, in addition to that layer, round-shaped
monocytes could only be identified adherent in the cultures with lower concentrations of Mg 2+
in Mg extract (as shown in white arrow). For those exposed to higher concentrations of Mg
extract (for example, 14.36/26.67 mM Mg2+ of Mg extract), most of the monocytes were
found detached from the surface of the plates with small cell debris visible (as indicated by
the solid circles; Fig. 28a). Some degree of osteoclastogenesis or even activation was
proved by the formation of multinucleated OCLs after culturing for 28 days with the initial
direct physical contact of osteoblasts (Fig. 28b). Both osteoblasts and osteoclasts in the
coculture conditions with different Mg extract concentrations spread well. While osteoblasts
attached in a long, flattened manner, osteoclasts presented its large and multinucleated
phenotype. It should be highly emphasised that osteoclasts were formed in the absence of
external addition of RANKL and M-CSF. Obviously in the cultures with 26.67 mM Mg2+ of Mg
extract osteoblasts were found existed in multiple layers compared with the cells in other Mg
extract concentrations or the control condition (Fig. 28b).
Fig. 28 Light microscopy of human osteoblast-osteoclast cocultures in the exposure of various
concentrations of Mg extract was performed on day 6 (a) and day 28 (b). Images of the cocultures
under the control condition as well as the culture conditions exposed to 3.50, 6.08 and 26.67 mM
2+
Mg of Mg extract are shown. Black, white arrow as well as solid circle represents osteoblast,
monocyte and cell debris, respectively. Scale bar = 100 µm.
4.4.3 Total protein content
To evaluate the activity of synthesising protein of the human osteoblast-osteoclast
cocultures, the total protein content of the cocultures exposed to various concentrations of
Mg extract was calculated on days 7, 14, 21 and 28 (Fig. 29). A general bell-shaped trend
was observed with the maximum values being reached at cultures with 3.50 mM Mg 2+ of Mg
38
4 Results
extract on days 7 and 14. On days 21 and 28, total protein content first increases and then
decreases with a higher concentrated Mg extract (no significant difference detected).
Moreover, it was discovered that the total protein content in cultures with 14.36 mM Mg 2+ of
Mg extract was lower on day 7 but higher on day 14 compared to the control condition. For
cultures in the condition with 26.67 mM Mg2+ of Mg extract, the total protein content was
lower on day 7 and day 14 but higher on day 21 compared to that for control condition.
Fig. 29 Total protein content of the
human cocultures with various Mg
extract
concentrations
was
measured. For each time point,
total protein content isolated from
cells cultured in the control
condition was set as 100% while
that in other conditions was
normalised.
Symbols
indicate
significant differences between the
control group and other conditions
(P < 0.05).
4.4.4 LDH assay
Since LDH in an indicator of cell death, its release into the supernatant of human
osteoblast-osteoclast cocultures supplemented with various concentrations of Mg extract
was measured to access the damage of Mg extract to the cells. As presented in Fig. 30, the
absorbance of LDH leakage on day 7 was elevated gradually with the increase in Mg extract
concentrations. The significant difference of LDH release between control and higher
concentrations of Mg extract (especially 14.36 and 26.67 mM Mg2+ of Mg extract) was
detected on days 7, 21 and 28.
Fig. 30 Effect of Mg extract on LDH
release was estimated by LDH
assay on days 7, 14, 21 and 28.
For each time point, the LDH in
cultures without Mg extract was set
as 100%, to which that under other
conditions was normalised. Symbols indicate significant differences
between the control group and
conditions
supplemented
with
different concentrations of Mg
extract (P < 0.05).
4.4.5 TRAP activity assay
As a highly important osteoclast marker, the differentiation extent of human PBMC
monocytes in the coculture systems supplemented with various concentrations of Mg extract
was further estimated by the determination of intracellular TRAP activity on days 7, 14, 21
and 28.
39
4 Results
A general, noticeable, bell-shaped distribution of TRAP activity on days 7 and 14
could be detected with significant difference between the cultures with 26.67 mM Mg 2+ of Mg
extract and the control group (Fig. 31). However, on the late culture time points (days 21 and
28), no significant difference is observed. Remarkably, in the cultures with 26.67 mM Mg2+ of
Mg extract the intracellular TRAP release was continuously lower over the course of 28
days‘ culture.
Fig. 31 Intracellular TRAP release
was evaluated on days 7, 14, 21
and 28. TRAP release under the
control condition was considered
as 100% while that under other
conditions was normalised. Symbols indicate significant differences
between the control group and
conditions
different
supplemented
concentrations
with
of
Mg
extract (P < 0.05).
4.4.6 ALP activity assay
Since ALP is a byproduct of osteoblast activity, the osteoblastogenesis in the human
osteoblast-osteoclast cocultures in the exposure of different concentrations of Mg extract
was often assessed by the measurement of intracellular ALP activity. The results are shown
in Fig. 32. As the PBMC/osteoclasts culture have no ALP production, the values of
intracellular ALP activity measured for all the conditions are attributed to
the SCP-1/osteoblasts cells. From the figure we can see, similarly, at almost all the assayed
time points (except for day 28), a bell-shaped distribution of intracellular ALP activity could
be observed. Notably, on day 28, ALP increased nearly linearly with increasing
concentrations of Mg extract.
Fig. 32 Effect of Mg extract on
enzymatic activity of intracellular
ALP
in
osteoblast-osteoclast
cocultures with different concentrations of Mg extract was
quantified on days 7, 14, 21 and 28.
ALP activity under the control
culture was set as 100% while that
under
other
conditions
was
normalised.
Symbols
indicate
significant differences between the
control group and other conditions,
(P < 0.05).
4.4.7 Elisa
To estimate the effects of various concentrations of Mg extract supplements on the protein
production of human osteoblasts and osteoclasts specific markers (RANKL, M-CSF for
40
4 Results
osteoblasts and OSCAR for osteoclasts, respectively), Elisa was carried out for the various
coculture conditions on the different culture time points (days 7, 14, 21 and 28). The results
are shown in Fig. 33.
From Fig. 33a we can see that there is a significant increase in the production of
RANKL in cultures treated with higher concentrations of Mg extract compared to the control
culture on day 28 (Fig. 33a). Similarly, a general induction in M-CSF was detected in the
cultures with 14.36/26.67 mM Mg2+ of Mg extract compared to the control group on day 14
(Fig. 33b). Whereas, the result shows a significant decrease in the production of OSCAR
after being cultured with 26.67 mM Mg2+ of Mg extract for 28 days compared to the control
culture (Fig. 33c).
Fig.
33
Effects
concentrations
of
of
Mg
various
extract
on
RANKL (a), M-CSF (b) and OSCAR (c)
protein release were determined by
Elisa. Protein level under the control
condition was set as 100% to which
that
under
normalised.
other
conditions
Symbols
was
indicate
significant differences between the
control and other conditions (P < 0.05).
4.4.8 ARS staining
Since ARS could be used to identify Ca, it has been commonly used as one of the specific
osteoblast markers. At the end time point (day 28), ARS staining was conducted for the
determination of the effect of Mg extract on human osteoblast mineralisation function in its
coculture with osteoclasts. The extent of osteoblast mineralisation was visualised and the
results are shown in Fig. 34. From the figure we can see that there is a significantly
increased mineralisation in the cultures supplemented with 26.67 mM Mg2+ of Mg extract
compared to the control condition as well as the cultures exposed with lower concentrations
of Mg extract.
41
4 Results
Fig. 34 The late differentiation
behaviour of human osteoblasts
was investigated in the cocultures
by ARS staining on day 28. Images
of cultures under the control
condition as well as conditions
exposed to 3.50/6.08/26.67 mM
2+
Mg
of Mg extract are shown.
Scale bar = 100 µm.
4.4.9 RT-qPCR
RT-qPCR was conducted to characterize the influence of different concentrations of Mg
extract on human osteoblasts and osteoclasts specific genes expression on day 28.
From the results exhibited in Fig. 35a, we could see a decrease in the mRNA
expression of osteoblastic specific markers RANKL, OPG, RUNX2 and DLX5 until 6.08 mM
Mg2+ of Mg extract and then followed by an increase with increasing concentrations of Mg
extract. An opposite pattern was shown for the mRNA expression analyses of osteoclastic
specific genes CK, OSCAR, RANK, SPI1 and NFATc1 (Fig. 35b). A bell-shaped distribution
of the mRNA expression of osteoclast specific markers was detected, i.e., an increase until
the concentration of 6.08 mM Mg2+ of Mg extract and then a significant decrease observable
in the cultures with higher concentrations of Mg extract (10.13, 14.36 and 26.67 mM Mg 2+ of
Mg extract) (Fig. 35b). Additionally, the M-CSF and NFκB1 gene expression was found to be
gradually increased with the increase in the concentration of Mg extract (Fig. 35a and
Fig. 35b, respectively). Furthermore, the ratio between RANKL and OPG was also
calculated (Fig. 35c). The ratio > 1 was found in the cultures supplemented with 14.36 and
26.67 mM Mg2+ of Mg extract (1.5 and 1.3, respectively; Fig. 35c).
42
4 Results
Fig. 35 The mRNA expression of
osteoblastic
and
osteoclastic
specific genes in the cocultures
exposed to various concentrations
of Mg extract was determined by
RT-qPCR on day 28. (a) RANKL,
OPG, M-CSF, RUNX2 and DLX5,
(b) CK, OSCAR, RANK, SPI1,
NFATc1 and NFκB1 and (c) left
axis: gene expression of RANKL
(black) and OPG (grey) (column
chart); right axis: RANKL:OPG ratio (scatter chart). Data are normalised to reference genes Actinβ,
B2M, GAPDH and RPL10. The relative amount of gene expression under culture conditions with Mg
extract was normalised to that of the control culture (without Mg extract). Symbols indicate significant
differences between the control condition and conditions supplemented with different concentrations
of Mg extract (P < 0.05).
43
5 Discussion and Conclusions
5
Discussion and Conclusions
Currently, Mg and Mg-based alloys have attracted great attention as a biodegradable
material for orthopaedic applications due to their excellent biodegradability [40],
biocompatibility [41] and appropriate strength and elastic moduli compared to a natural bone
[9]. When the materials are surgically introduced into the patient‘s bone and start to degrade,
all the corrosion products will interact with the local bone cells, i.e., osteoblasts and
osteoclasts. Since osteoblasts are the cells that are not only responsible for the bone
generation but also regulate osteoclastogenesis, they have been widely considered as the
most dominating cells for osseointegration of implants [80, 113]. Therefore, most researches
concerning the in vitro biocompatible assessments for the newly developed Mg-based alloys
were performed by the use of osteoblast or their precursors monoculture by analysing their
cytocompatibility or osteoinductivity [32, 38, 89, 95, 114]. Although frequently been
underestimated, it has been strongly suggested that the successful use or longevity of an
implant is mainly determined by the action of bone-breaking osteoclasts. However, little is
known about the influence of Mg degrading products to osteoclasts. Therefore, in the
present work, procedures for osteoclast monoculture derived by PBMC in the supplement
with RANKL and M-CSF as well as osteoblast-osteoclast coculture were successfully
established. Their response to high/non-physiological extracellular Mg contents (coming
from either MgCl2 or Mg extract) in terms of cellular differentiation and function was
investigated.
Mg salt in the form of MgCl2 was first used and their influence on osteoclastic
differentiation and activation was investigated based on osteoclastic monoculture. As
indicated in Fig. 6, no significant difference in WST-1/formazan production was observable
at all the other time points. It therefore suggests that MgCl2 does not hinder cell viability. The
results of TRAP staining (Fig. 9), CK (Fig. 10) and CTR immunocytochemistry (Fig. 11)
showed that MgCl2 increases the formation of osteoclasts until a certain concentration and
then it decreases. Similarly, as shown in Fig. 12, there was an increase in the relative
resorption activity per TRAP-positive osteoclast up to a certain MgCl2 concentration followed
by a decrease. As the specialised cell that is responsible for bone resorption, both the initial
adhesion of osteoclasts to the bone surface and further migration along it while resorbing are
two mechanisms involved in its functional resorption [115]. It is well known that osteoclasts
express at least two á-integrins (á2 and áv) and three ß-integrins (ß1, ß3 and ß5) as cell
surface adhesion receptors that mediate osteoclast attachment to bone matrix [116]. Another
research performed by Shankar demonstrated that the binding between integrins and
substrate requires divalent cations [117] and Mg2+ plays a more effective role than Ca2+ in
facilitating cell adhesion to the substrates [118]. Therefore, initial adhesion may be facilitated.
However, osteoclast migration and function were inhibited. Based on the above arguments,
it can be suggested that MgCl2 enhances osteoclast differentiation and function up to a
certain concentration. This is exactly what we observed for MgCl2.
In an attempt to distinguish the effect of Mg 2+ from Cl- when osteoclastic response to
the supplementation of MgCl2 was investigated, osteoclasts were cultured in the presence of
a series of NaCl concentrations. As indicated in Fig. 18 as well as Fig. 19, a significant,
44
5 Discussion and Conclusions
linear, concentration-dependent enhancement in the resorbed area (R2 = 0.8917, P < 0.001)
as well as in the resorbed volume (R2 = 0.9664, P < 0.001) was investigated. Although it was
difficult to completely rule out the role of Cl- on osteoclast function, while 50 mM Cl- (coming
from the supplementation of 25 mM of MgCl2) was shown to significantly decrease
osteoclast resorption activity, the same amount of Cl- (coming from the addition of 50 mM
NaCl) was investigated to significantly increase osteoclastic resorption activity. Therefore, it
might be concluded that the first elevated followed by reduced effects of MgCl2 on
osteoclastic differentiation and function was due to Mg2+ rather than Cl-.
A contribution of high NaCl intake to the development of osteoporosis has been
illustrated by previously published evidence coming from animal researches as well as
clinical and epidemiological studies [119-122]. The oral NaCl supplements in growing rats
have been estimated to increase the urinary excretion of Ca and phosphorus, however, the
intestinal absorption of Ca didn‘t increase, thus leading to a depression in the accumulation
of Ca and phosphorus in bone [123]. Need et al. [124] examined the effect of salt restriction
on urine hydroxyproline excretion and revealed that salt restriction may be one way of
reducing bone resorption in postmenopausal women as a restriction in Na+ diet could lead to
a decrease in urinary Na+, Ca2+ and hydroxyproline/creatinine. On the other hand, evidence
coming from both human subjects and experimental rats indicates that higher Na+ intake is
associated with increased hydroxyproline excretion via urine [125-128]. In a two-year
longitudinal study of bone density in 124 postmenopausal women [119], Devine et al.
suggested that there was a negative correlation between urinary Na excretion and changes
in bone density at the total hip and the intertrochanteric sites. Based on an extensive review
of the literature, MacGregor concluded that a high salt intake is suggested as a major
aggravating factor in osteoporosis and a reduction in salt intake could have major benefits in
bone density [129]. The beneficial effect of the reduction in Na+ intake on bone health was
documented in an interventional study by Lin et al. [130] as well. In an observational study
conducted for four-week period, Harrington [122] also concluded that higher salt intake might
lead to greater rates of bone resorption in postmenopausal women.
However, the mode of action, how NaCl affects bone density is still controversial.
While a correlation between increased urinary Ca excretion and the production of serum
PTH was indicated in some studies [131], other studies failed to show the elevation in PTH
secretion due to NaCl loading [119, 132, 133], suggesting possible direct cellular effects of
NaCl on bone-resorbing osteoclasts.
In the present study, a direct, progressive and PTH-independent influence of NaCl on
human osteoclasts differentiation and function behaviour was revealed through an in vitro
cell culture system in which human PBMC monocytes was induced into mature osteoclasts
with the external addition of osteoclastogenesis promoting factors RANKL and M-CSF.
WST-1 assay was first performed to evaluate the influence of high NaCl addition on the cell
metabolism. As indicated in Fig. 13, a bell-shaped distribution of WST-1 was observed on
days 3 and 14. An increase in the cells metabolic activity was obtained until the cultures
supplemented with mild and moderate hypernatremia NaCl followed by a significant
decrease in the cultures with severely high NaCl concentration. This result was consistent
45
5 Discussion and Conclusions
with the previous study that was conducted by Arimochi [134]. In the study, the effect of high
salt culture conditions on the growth of rat C6 glioma cells was examined and it was found
that there was a reduction in the number of viable cells in a concentration-dependent
manner when the cells were exposed to the culture medium containing high concentrations
of NaCl. While most of the studies involved acute application of NaCl for only a few hours,
the response of human cervical epithelial carcinoma (HeLa) cells as well as primary mouse
embryonic fibroblasts to prolonged exposure to high NaCl culture condition was investigated
for 18 and 10 days, respectively. The proliferation rate of HeLa cells treated with NaCl was
reported to decrease gradually and display signs of senescence while similarly for the
primary mouse embryonic fibroblasts, the appearance of cellular senescence was
accelerated as well [135]. Except for the inhibitory effect of high NaCl on cell metabolic
activity, total protein synthesis in cells exposed to hypertonic osmolarity of the extracellular
medium was also found to be profoundly inhibited. Protein synthesis was found to be
strongly inhibited when the chick embryo fibroblasts were exposed to the medium with
0.4 osM osmolarity within 30 minutes, although the cells appear to adapt to the altered
environment with a gradual protein synthesis restoration reaching control values within
12-14 h of treatment [136]. Consistently, Petronini et al. also reported the existence of
transient impairment of the rate of protein synthesis in cultured endothelial cells [137].
However, as shown in Fig. 14, a general bell-shaped distribution pattern of total protein
content was observed on day 3. On days 14 and 28, although the difference is not significant,
an increased concentration of NaCl first increases and then decreases total protein content.
All of these indicate the stimulatory effect of low concentrations of NaCl on the
proliferation/differentiation capacity of osteoclastic precursors. It should be noted that the
total protein content of cultures under severe hypernatremia condition was always lower than
that of relative controls at all the tested time points which suggested the inhibition of cell
metabolism and protein production when exposed the cells to severe hypernatremia culture
environment. Interestingly, however, in spite of the lower overall cell activity in the severe
hypernatremia culture group, more osteoclasts that were more active than in any other group
were observed which suggested that there were diverging effects of NaCl on osteoclasts at
different stages of differentiation. A possible explanation would be that the increase in
supplemented NaCl concentrations favoured its differentiation over proliferation, thus leading
to a higher relative number of multinucleated osteoclasts. Indeed, this was confirmed by
TRAP staining in which a positive linear relationship between the number of osteoclast-like
TRAP-positive multinuclear cells per mm2 and the concentration of supplemented NaCl in
the extracellular culture medium was investigated with R2 = 0.9008, P < 0.001 (Fig. 16). An
inductive effect of high NaCl on the formation of bone-resorbing osteoclasts was thus
indicated. Similar results were further obtained for CTR expression (Fig. 17).
On the contrary, the extracellular TRAP release (Fig. 15) was found to be decreased
in the cultures exposed to severe hypernatremia condition while more TRAP-positive
multinuclear cells were detected. The most probably explanations for the above discrepancy
lie in the different isoforms of TRAP. It has been widely suggested that there are two
distinctly glycosylated forms of TRAP in human blood circulation which are known as
TRAP5a and TRAP5b [138]. While TRAP5a is mainly derived from macrophages as well as
46
5 Discussion and Conclusions
dendritic cells, TRAP5b was reported to exclusively originate from both bone-resorbing and
non-resorbing osteoclasts [139, 140]. The TRAP activity determined in the present work,
however, is not isoform selective. Therefore, it might be that high NaCl supplementation may
have led to a situation where the increased formation of TRAP5b in the multinucleated
TRAP-positive OCLs is offset by the decreased number of activated monocytes or
macrophages, thus leading to a diminished release of TRAP5a and consequently to a
decrease of combined TRAP activity.
Moreover, in order to enable a more profound analysis of the influence of high NaCl
on osteoclastic function, 2D resorption area measurement as well as 3D resorption volume
evaluation was further performed. As indicated in Fig. 18c and Fig. 19c, a well-fit linear
correlation between the resorption capacity and NaCl was found with R2 = 0.8917 and
0.9664, in terms of resorption area and volume, respectively, suggesting a direct,
dose-dependent positive effect of high NaCl concentration also on the function of osteoclasts.
A limitation of this study is that the effect of the monovalent anion Cl- on osteoclast
function couldn‘t be completely ruled out. However, in another setup, 50 mM Cl- has been
estimated to decrease osteoclastic resorption capacity. Furthermore, the osmotic or ionic
effect in the exposure of high extracellular NaCl have not been attempted to dissociate. In
the future it will be interesting to study, which molecular pathway results in the observable
effect of NaCl on the bone-resorbing osteoclasts. Therefore, it could be concluded that NaCl
directly, positively regulated osteoclastic differentiation and function. The previously reported
enhancement in bone resorption after diets rich in NaCl, and in diseases with high serum
Na+ may not only due to the urinary Ca loss but also because of a direct, cell-mediated effect
of increased Na+ concentration on osteoclast resorption activity. These findings may help to
explain the clinical findings in bone metabolism in patients with increased serum NaCl levels
and may therefore be important for the prevention and treatment of osteoporosis.
In order to more closely mimic the in vivo environment, the osteoclast monoculture
was exposed to different concentrations of Mg extract and their response was investigated in
comparison of the experimental setup of MgCl2. For the cultures in the exposure of different
concentrations of Mg extract, however, the biphasic effect of MgCl2 on osteoclast
differentiation and function was not found. The results from WST-1 (Fig. 21), extracellular
TRAP activity (Fig. 23), TRAP staining (Fig. 24) as well as CK staining (Fig. 25) consistently
indicated a decrease associated with the increase in Mg extract content. However, as shown
in Fig. 27, the resorption activity per osteoclast increased gradually with the increase in Mg
extract content. The different influence patterns for MgCl2 and Mg extract on osteoclast
proliferation and differentiation behaviour are not surprising. In a study concerning the effect
of Mg on the primary human osteoblasts, such differences have previously been highlighted
in which Mg extract was found to increase the expression of genes involved in bone
metabolism (e.g. osteocalcin) in a more effective manner than MgCl2 (data not shown). The
different effects can be explained by one of the main differences between MgCl2 and Mg
extract, i.e. Ca depletion in the pure Mg extract (see Table 5). It has been pointed out that
the balance between Mg and Ca is very important for bone homeostasis and circulating Ca2+
has an important effect on bone turnover. When there is too much Ca 2+, osteoclast
47
5 Discussion and Conclusions
resorption activity in bones will be inhibited by calcitonin which is primarily released via
thyroid. On the contrary, when the Ca2+ is too low, osteoclast bone resorption will be
promoted by calcitriol and PTH. The effects of Mg 2+ and Ca2+ omission, depletion and
excess have been extensively studied by Rubin and co-workers (see Reference [141]). It
has been estimated that omission of Ca2+ could lead to a significant increase in cell
permeability and Mg2+ can apparently substitute for Ca2+ in the maintenance of normal
permeability, but in a less-efficient manner since 5-10 mM Mg2+ is required to maintain Na2+
and K+ at normal levels in the absence of Ca2+. Furthermore, other evidence indicated that
the depletion of Ca2+ will result in a shift of Mg2+ away from ATP toward other binding sites in
the cell [142]. This is maybe one reason that Mg extract doesn‘t exert the effect observed
under the supplementation of MgCl2 salt.
Moreover, the different effect patterns of MgCl2 and Mg extract on osteoclast
differentiation and function behaviour could also be explained by the osmolality and pH
which are considered to be two negative parameters for osteoclast formation and activity. It
can be seen from Table 5 that both the osmolality and pH in the culture medium
supplemented with Mg extract are high. It has been tested that when PBMC (coming from
two separate donors) were cultured in the presence of 14.36 and 26.67 mM Mg2+ of Mg
extract, all of them died on day 3. The role of pH on osteoclast activity has been also
investigated by several studies. For instance, acidic conditions were proved to stimulate
osteoclast activity [143, 144]. pH between 7.0-7.5 was estimated to be the optimal condition
for the proliferation and differentiation of osteoclast from neonatal rabbits while the
resorption activity was enhanced when the pH at 6.5-7.0 [145]. As indicated in Table 5, the
pH ranged from 8.35 to 7.8 in the culture conditions with a series of Mg extract
concentrations. While a negative effect of Mg extract on osteoclast metabolic activity was
detected (as shown in Fig. 21), cell differentiation was less affected. As an inward
transporter of Mg, transient receptor potential melastin 7 (TRPM7) has been reported to
sense osmotic gradients rather than ionic strength and be inhibited by hypertonic conditions
[146]. The positive effects observed in the cultures treated with MgCl2 would then be
abolished, resulting in no or a reduced increase in the intracellular Mg content until the
extracellular osmolality was restored. Indeed, in the present experiments, it was observed
that when osmolality was returned to normal level osteoclast activity was enhanced. The
specific knockout or inhibition of TRPM7 (e.g. with non-specific lipoxygenase inhibitors like
nordihydroguaiaretic acid or NDGA [147]) may help to uncover the role of this channel.
The differences observed for the two Mg-containing solutions could also be explained
by Voltage-dependent Ca channels (VDCC). The VDCC are a group of voltage-gated ion
channels that are activated by changes in electrical potential near the channel and they are
generally found in excitable cells. For cells of the nervous system, it has been investigated
that the external Mg ions can block VDCC [148]. In osteoclasts, long-lasting Ca channels
that may promote movement can be also found [149]. The increased resorption observed at
lower Mg concentrations in the case of the Mg extract (compared to MgCl2) would then be
explained by Mg blockage. This hypothesis could be validated through performing the
measurements of osteoclast migration pattern.
48
5 Discussion and Conclusions
Furthermore, the correlation between in vitro and in vivo condition would be
discussed. It can be assumed that there is a decreasing Mg concentration gradient between
the implant surface and the farther tissues during in vivo Mg-based implant degradation. This
gradient could thus explain the bell-shaped distribution observed in the cultures
supplemented with MgCl2 and the constant decrease in the case of cultures in the presence
of Mg extract measured for the in vitro osteoclastic activity. Therefore a depletion of
osteoclasts may appear close to the implant, while osteoclasts may form further away. In this
respect, it might be interesting for the analysis in the in vivo experiments. In fact, this may
partly explain the different osteoclast behaviour in the peri-implantation site of Mg-based
implants detected in previous studies. For example, while reduced osteoclast surface and
fewer osteoclasts were described by Janning et al. [150], Huehnerschulte et al. [151]
showed a large number of osteoclasts formation. Another essential issue in this respect is
the coupling of bone-building osteoblasts to bone-resorbing osteoclasts. It may be possible
that the deleterious effect of increased osteoclastic activity may be matched or even
overcome by activation of osteoblasts via an osteoclastic relay. The establishment of a
coculture procedure consisting of osteoblast and osteoclast will be necessary to test this
hypothesis. Indeed, a high mineral apposition rates and increased bone mass/volume
around degrading Mg implants in bone were estimated by Witte et al. [40]. Furthermore, the
formation of implant particles in the degradation process could be one of the contributing
factors. It has been pointed out that the production of osteoclastogenic cytokine could be
influenced by the particles coming from different materials [152] and the cells reaction is
shown to be dependent on the particle size [153].
Finally, in the present work, á-MEM supplemented with 10% FBS was used for the
solvent to prepare extract, as it is complex and some chemical reactions may also take place
during Mg degradation process, more detailed analyses of Mg extract and its differences
with MgCl2 salt by inductively coupled plasma mass spectrometry or liquid chromatography–
tandem mass spectrometry, may be helpful in understanding the observed differences in the
cell behaviour.
MgCl2 salt and Mg extract exhibited different direct effects on the differentiation and
function of human bone-resorbing osteoclast. While MgCl2 was able to increase osteoclast
proliferation and function up to a concentration of approximately 15 mM, Mg extract
appeared to reduce cell metabolism, although the parameters concerning cell differentiation
were less affected. Osteoclastic resorption activity was activated by both MgCl2 and Mg
extract, but the Mg extract exerted its positive effect at a lower Mg content. With respect to
the in vivo degrading properties, Mg extract is believed to be the closest in vitro model for
the cytocompatibility assessment of Mg-based biomaterials [105, 106].
The establishment of an osteoblast-osteoclast coculture system in which the
crosstalk between bone-forming and bone-resorbing cells could be investigated for the in
vitro cytocompatibility assessments for biomedical Mg-based alloy is of great interest. In the
present work, a coculture system containing human osteoblasts (derived from SCP-1 cell
line) and osteoclasts (obtained from the differentiation of human PBMC monocytes) was
successfully established. The effect of a series of concentrations of Mg extract (7
49
5 Discussion and Conclusions
concentrations: 0.93/1.46/3.50/6.08/10.13/14.36/26.67 mM Mg2+ of Mg extract) on the
proliferation and differentiation behaviour of osteoblast-osteoclast coculture was evaluated at
various time points (days 7, 14, 21 and 28). Opposite modes of Mg extract acting on
osteoblastic and osteoclastic behaviour could be detected. On the one hand, osteoclast
differentiation was elevated with the increase in the concentration of Mg extract (up to 6 mM
Mg2+ of Mg extract) and then decreased in the cultures with high concentrations of Mg
extract. On the other hand, osteoblast differentiation was first inhibited until 6.08 mM Mg 2+ of
Mg extract and then enhanced in higher concentrations (especially 14.36 and 26.67 mM
Mg2+ of Mg extract).
The initial adhesion behaviour of the cocultures cultured with different concentrations
of Mg extract was estimated by light microscopy after culturing for 6 days (Fig. 28). As
shown in Fig. 28a, a bad attachment of the coculture especially the PBMC cells in the culture
condition supplemented with 26.67 mM Mg2+ of Mg extract was observed. As indicated by
the solid circles (see Fig. 28a), small cell debris were visible, suggesting the detachment for
most of the monocytes from the surface of the plates. This is consistent with further
evidences. For example, after culturing for 7 days, the total protein content of the cocultures
under the condition supplemented with 26.67 mM Mg2+ of Mg extract was significantly
decreased compared to the cultures with lower concentrations of Mg extract (3.50, 6.08 and
10.13 mM Mg2+ of Mg extract for instance, Fig. 29). Moreover, the LDH release from the cell
destruction was found continuously increased on day 7 because of the exposure of higher
concentration of Mg extract. Especially for the cocultures with 26.67 mM Mg2+ of Mg extract,
significant increase in LDH release was detected compared to all the other conditions
(Fig. 30). The bad attachment of osteoblast-osteoclast cocultures in the cultures with higher
concentrations of Mg extract (especially for 14.36 and 26.67 mM Mg 2+ of Mg extract)
compared to control or cultures with lower concentrations of Mg extract on day 7 was also
proved by the decreased intracellular TRAP and ALP activity (as indicated in Fig. 31 and
Fig. 32, respectively). In a study conducted by Lorenz et al. [154], a similar conclusion was
achieved, i.e., the high reactivity of polished commercially pure Mg samples in the cell
culture medium might lead to a pH shift in the alkaline direction as well as an increase in
osmolality and thus the reduced cellular adhesion and viability. A very recent paper
compared the biocompatible properties of Mg-Ca alloy samples with and without microarc
oxidation coatings [155]. While the coated ones showed great cytocompatibility, because of
the low adhesion activity caused by the suffering from severe corrosion, no MG63 cells were
observed on the uncoated samples. Furthermore, Ca2+ has long been reported playing a
highly important role in the maintenance of bone mass which potentially antagonizes with
Mg2+ in many other physiological activities [156, 157]. The balance between Mg and Ca is
considered to be highly important for bones and for homeostasis in general [158]. Therefore,
the concentration of Ca2+ in the culture media with various concentrations of Mg extract was
also measured. As indicated in Table 6, a gradual decrease in Ca2+ concentration was
observed with the increase in the concentration of Mg extract. The explanation has been well
described in a recent study conducted by Willumeit et al. [159] which revealed the deposit of
Ca2+ on the corrosion layer of the material. Such deposit of Ca2+ leads to its depletion in the
Mg extract solution, thus the decrease of Ca2+ in the measured culture medium (Table 6).
50
5 Discussion and Conclusions
Despite suffering from a relatively inhospitable environment with increased pH as well
as osmolality, some cellular adhesion did happen. Compared to our very recent study [70],
while osteoclast monoculture in the exposure of 14.36 and 26.67 mM Mg2+ of Mg extract was
detected all dead after culturing for 3 days, being cocultured with osteoblasts, they were
found to be still alive although only in a few amount (Fig. 28a). As indicated in Fig. 28b, with
the increasing culture time up to 28 days, their cell division and even late cell differentiation
were further confirmed by the formation of multinucleated osteoclasts. The superior
capability of osteoclastic survival and differentiation in the coculture system with high
concentration of Mg extract (especially for 14.36 and 26.67 mM Mg 2+ of Mg extract)
compared to osteoclast monoculture could be explained by the increased amount of
osteoblasts. The stimulatory effects of high concentration Mg extract on osteoblasts lead to
the increased amount of osteoblasts in the culture condition which causes cell culture media
acidification, resulting in neutralisation of the Mg extract alkalinity.
Similarly to osteoclasts, osteoblasts were also found to be alive in the culture
conditions supplemented with high concentration of Mg extract (14.36 and 26.67 mM Mg2+ of
Mg extract). They exhibited their morphological appearance and produced late differentiation
parameters. As shown in Fig. 29, when exposed to 14.36 mM Mg2+ of Mg extract, the total
protein content of the cocultures was lower on day 7 but higher on day 14 compared to
control, however, when exposed to 26.67 mM Mg2+ of Mg extract, it was lower on day 7 and
day 14 but higher on day 21 (Fig. 29). It thus indicated that the more alkaline the culture
medium is the longer it needed for the acid-alkaline neutralisation process. Furthermore, with
having a closer look, on day 14 intracellular ALP activity in the cultures with 14.36 mM Mg 2+
of Mg extract was found to be higher compared to control however, in the cultures with
26.67 mM Mg2+ of Mg extract, 21 days was needed for osteoblasts to produce higher level of
ALP activity compared to control (Fig. 32). As depicted in Fig. 31, late osteoclastic
differentiation behaviour was further assessed by the measurement of intracellular TRAP
activity. Although a general increase was detected of intracellular TRAP activity during the
entire culture period of 28 days, the enzymatic level in cultures with 26.67 mM Mg2+ of Mg
extract was continuously lower compared to relative controls at all the time points. It thus
suggested that osteoblasts were recovering faster compared to osteoclasts. This could be
explained by the different modes of osteoblastic and osteoclastic differentiation. While
osteoblasts could further proliferate in the high alkaline environment, as osteoclasts are
generated by the fusing of monocytes and they are terminally differentiated cells, there might
be not enough cells left for them to start the selection process if the fusing cells are depleted.
The polypeptide growth factor M-CSF and RANKL released by osteoblasts are the
key factors that are essential and sufficient for osteoclastogenesis [160]. Binding of M-CSF
to its receptor (colony-stimulating factor 1 receptor, or c-Fms) will activate cell proliferation
and survival and the expression of RANK. The RANKL/RANK interaction will in turn triggers
a sequence of events that leads to the downstream activation of transcription factors like
NFκB and the expression of master transcription factors for osteoclastogenesis, i.e., NFATc1
and SPI1. NFATc1 and SPI1 will then induce the expression of osteoclastogenesis-related
genes like TRAP, CK and OSCAR [161]. While RANKL induces osteoclastic destruction,
51
5 Discussion and Conclusions
OPG produced by osteoblasts is reported as a decoy receptor that downregulates the bone
destruction through preventing the binding of RANKL with its receptor RANK [162, 163].
Therefore, the bone resorption is regulated by the relative expression of RANKL and OPG
and the ratio between them (RANKL:OPG ratio) has been estimated as an important marker
for bone loss or more specifically, for osteoclast activation (i.e. ratio > 1 proosteoclastogenesis and < 1 pro-osteoblastogenesis; Fig. 35c) [164, 165].
Taken together, it can be concluded that higher concentrations of Mg extract could
increase osteoblastic activity. The evidences came from the enhanced ALP activity (Fig. 32)
and mineralisation capacity (revealed by ARS staining; Fig. 34). Osteoblast released proosteoclast factors were also found to be increased in the cocultures exposed to high
concentration of Mg extract (i.e., RANKL and M-CSF, both protein and gene levels;
Fig. 33a/35a, respectively). However, Fig. 30 showed an increase in LDH release with the
increase in the concentration of Mg extract on day 28, indicating the high cytotoxicity. It
seems incompatible with the enhanced osteoblastic proliferation and differentiation in that
culturing condition. The high cell competition (as shown in Fig. 28b, multiple layers of
osteoblast cells) resulted from the significantly stimulatory proliferation rate of osteoblasts in
the culture environment with high concentration of Mg extract might be one of the main
reasons.
Moreover, an opposite pattern of Mg extract acting on osteoclasts was detected, i.e.,
osteoclastogenesis markers (both on protein and gene levels; Fig. 33c/35b, respectively) are
increased up to ≈ 6.08 mM Mg2+ of Mg extract and then decreased with increasing Mg
extract. For example, a general bell-shaped distribution was observed for intracellular TRAP
activity on days 7 and 14 with significant difference between the cultures with 26.67 mM
Mg2+ of Mg extract and the control group, suggesting the dual effect of Mg extract on
osteoclastic differentiation, i.e., lower concentrations of Mg extract induced osteoclast
intracellular TRAP production until a concentration of 3.50 mM Mg2+ or 6.08 mM Mg2+ of Mg
extract and then decreased (Fig. 31). Similarly, the pattern of dual effect of Mg extract on
osteoclastic differentiation was also observable in terms of OSCAR protein expression and
CK, OSCAR, RANK, SPI1 as well as NFATc1 mRNA expression as indicated in Fig. 33c and
Fig. 35b, respectively. The inhibitory effects of high concentration of Mg extract (especially
14.36 and 26.67 mM Mg2+ of Mg extract) acting on osteoclastogenesis could be explained
by the fact that neither osteoblast-released osteoclastogenesis promoting factors nor
osteoblast-induced pH media neutralisation process are sufficient to counteract the negative
effects caused by high pH and osmolality. This hypothesis can be proved by previously
published work in which alkalosis has been considered to decrease osteoclastic resorption
activity while increase osteoblastic formation in vivo [166]. Furthermore, although RANKL
has been estimated to activate mature osteoclastogenesis in a dose-dependent manner in
vitro [48, 49] and Fig. 35a/35c have shown the significant increases in RANKL and M-CSF
mRNA expression as well as the RANKL:OPG ratio (respectively) in the cultures
supplemented with 14.36 and 26.67 mM Mg2+ of Mg extract, we failed to get more osteoclast
formation at the high Mg concentrations. This could be explained by the lower expression of
RANK mRNA (Fig. 35b) which is essential for RANKL/RANK signalling in the same coculture
52
5 Discussion and Conclusions
condition [50]. Furthermore, increased extracellular Mg concentration has been estimated to
decrease osteoclast migration (i.e., function) through increasing its binding to integrins [167,
168].
Consistent with the in vivo study in which enhanced bone growth was observed in the
contributions to both the enhancement in osteoblast activity and a decrease in osteoclast
numbers [150], in the present study, the in vitro data showed a promotion in the formation of
osteoblasts but an inhibitory effect on the differentiation of osteoclasts caused by exposure
to higher concentrated Mg extract (especially 14.36 and 26.67 mM Mg 2+ of Mg extract). The
enhanced bone formation after implanting Mg-based alloys could be contributed to the dual
modes of Mg on the bone cell level. Compared to monoculture, when cocultured with
osteoblasts, PBMC exhibited higher tolerance to high concentration of Mg extract which can
be attributed to the cell-cell communication. Therefore cocultures consisting of both bone
cells (osteoblasts and osteoclasts) should be preferentially performed for in vitro
cytocompatibility assessment of Mg-based implants.
53
6 References
6
References
1.
Hamadouche, M., et al., Long-term in vivo bioactivity and degradability of bulk sol-gel
bioactive glasses. Journal of Biomedical Materials Research, 2001. 54(4): p. 560-566.
Schindler, O., et al., Composite ceramic bone graft substitute in the treatment of
locally aggressive benign bone tumours. Journal of Orthopaedic Surgery, 2008. 16(1).
Jones, J. and L. Hench, Biomedical materials for new millennium: perspective on the
future. Materials Science and Technology, 2001. 17(8): p. 891-900.
Seal, C., K. Vince, and M. Hodgson. Biodegradable surgical implants based on
magnesium alloys – A review of current research. in IOP Conference Series:
Materials Science and Engineering. 2009. IOP Publishing.
Shi, D., Biomaterials and tissue engineering. Vol. 1. 2004: Tsinghua University Press.
Sumita, M., T. Hanawa, and S. Teoh, Development of nitrogen-containing nickel-free
austenitic stainless steels for metallic biomaterials – review. Materials Science and
Engineering: C, 2004. 24(6): p. 753-760.
Geetha, M., et al., Ti based biomaterials, the ultimate choice for orthopaedic implants
– a review. Progress in Materials Science, 2009. 54(3): p. 397-425.
Puleo, D., Biochemical surface modification of Co-Cr-Mo. Biomaterials, 1996. 17(2):
p. 217-222.
Staiger, M.P., et al., Magnesium and its alloys as orthopedic biomaterials: a review.
Biomaterials, 2006. 27(9): p. 1728-1734.
Niinomi, M., Recent metallic materials for biomedical applications. Metallurgical and
Materials Transactions A, 2002. 33(3): p. 477-486.
Sumita, M., Y. Ikada, and T. Tateishi, Metallic Biomaterials – Fundamentals and
Applications. ICP, Tokyo, 2000: p. 629.
Black, J. and G. Hastings, Handbook of biomaterial properties. 1998: Springer.
Nagels, J., M. Stokdijk, and P.M. Rozing, Stress shielding and bone resorption in
shoulder arthroplasty. Journal of Shoulder and Elbow Surgery, 2003. 12(1): p. 35-39.
Denkena, B., et al. Degradable implants made of magnesium alloys. in Proc. 5th
euspen int. conf., Montpellier, France. 2005.
Upadhyay, D., et al., Corrosion of alloys used in dentistry: a review. Materials
Science and Engineering: A, 2006. 432(1): p. 1-11.
Dearnley, P., A brief review of test methodologies for surface-engineered biomedical
implant alloys. Surface and Coatings Technology, 2005. 198(1): p. 483-490.
Puleo, D.A. and W.W. Huh, Acute toxicity of metal ions in cultures of osteogenic cells
derived from bone marrow stromal cells. Journal of Applied Biomaterials, 1995. 6(2):
p. 109-116.
Jacobs, J.J., et al., Metal release in patients who have had a primary total hip
arthroplasty. A prospective, controlled, longitudinal study. The Journal of Bone &
Joint Surgery, 1998. 80(10): p. 1447-58.
Jacobs, J.J., et al., Metal degradation products: a cause for concern in metal-metal
bearings? Clinical Orthopaedics and Related Research, 2003. 417: p. 139-147.
Lhotka, C., et al., Four-year study of cobalt and chromium blood levels in patients
managed with two different metal-on-metal total hip replacements. Journal of
Orthopaedic Research, 2003. 21(2): p. 189-195.
Granchi, D., et al., Cytokine release in mononuclear cells of patients with Co-Cr hip
prosthesis. Biomaterials, 1999. 20(12): p. 1079-1086.
Niki, Y., et al., Metal ions induce bone-resorbing cytokine production through the
redox pathway in synoviocytes and bone marrow macrophages. Biomaterials, 2003.
24(8): p. 1447-1457.
Haynes, D.R., et al., Variation in cytokines induced by particles from different
prosthetic materials. Clinical Orthopaedics and Related Research, 1998. 352: p. 223230.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
54
6 References
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
Wang, J.Y., et al., Titanium, chromium and cobalt ions modulate the release of boneassociated cytokines by human monocytes/macrophages in vitro. Biomaterials, 1996.
17(23): p. 2233-2240.
Wang, M.L., et al., Titanium particles suppress expression of osteoblastic phenotype
in human mesenchymal stem cells. Journal of Orthopaedic Research, 2002. 20(6): p.
1175-1184.
Park, J.B. and J.D. Bronzino, Biomaterials: principles and applications. 2002: crc
press.
Levesque, J., et al., Coronary stents. Advanced Materials & Processes, 2004: p. 45.
Zhang, Z., et al., Cell-based resorption assays for bone graft substitutes. Acta
Biomaterialia, 2012. 8(1): p. 13-19.
Xu, L., et al., In vitro and in vivo evaluation of the surface bioactivity of a calcium
phosphate coated magnesium alloy. Biomaterials, 2009. 30(8): p. 1512-1523.
Xu, L., et al., In vivo corrosion behavior of Mg-Mn-Zn alloy for bone implant
application. Journal of Biomedical Materials Research Part A, 2007. 83(3): p. 703711.
Witte, F., et al., In vitro and in vivo corrosion measurements of magnesium alloys.
Biomaterials, 2006. 27(7): p. 1013-1018.
Li, Z., et al., The development of binary Mg-Ca alloys for use as biodegradable
materials within bone. Biomaterials, 2008. 29(10): p. 1329-1344.
Winet, H. and J. Hollinger, Incorporation of polylactide-polyglycolide in a cortical
defect: neoosteogenesis in a bone chamber. Journal of Biomedical Materials
Research, 1993. 27(5): p. 667-676.
Dauner, M., et al., Resorbable continuous-fibre reinforced polymers for
osteosynthesis. Journal of Materials Science: Materials in Medicine, 1998. 9(3): p.
173-179.
Litsky, A.S., Clinical reviews: bioabsorbable implants for orthopaedic fracture fixation.
Journal of Applied Biomaterials, 1993. 4(1): p. 109-111.
Moravej, M. and D. Mantovani, Biodegradable metals for cardiovascular stent
application: interests and new opportunities. International Journal of Molecular
Sciences, 2011. 12(7): p. 4250-4270.
González, S., et al., Improved mechanical performance and delayed corrosion
phenomena in biodegradable Mg-Zn-Ca alloys through Pd-alloying. Journal of the
Mechanical Behavior of Biomedical Materials, 2012. 6: p. 53-62.
Yun, Y., et al., Biodegradable Mg corrosion and osteoblast cell culture studies.
Materials Science and Engineering: C, 2009. 29(6): p. 1814-1821.
Song, G., Control of biodegradation of biocompatable magnesium alloys. Corrosion
Science, 2007. 49(4): p. 1696-1701.
Witte, F., et al., In vivo corrosion of four magnesium alloys and the associated bone
response. Biomaterials, 2005. 26(17): p. 3557-3563.
Maguire, M.E. and J.A. Cowan, Magnesium chemistry and biochemistry. Biometals,
2002. 15(3): p. 203-210.
Godard, H.P., et al., The corrosion of light metals. 1967: Wiley New York.
Shaw, B.A., Corrosion resistance of magnesium alloys. ASM handbook, 2003. 13: p.
692.
Song, G.L. and A. Atrens, Corrosion mechanisms of magnesium alloys. Advanced
Engineering Materials, 1999. 1(1): p. 11-33.
Zeng, R., et al., Progress and challenge for magnesium alloys as biomaterials.
Advanced Engineering Materials, 2008. 10(8): p. B3-B14.
Drynda, A., et al., Rare earth metals used in biodegradable magnesium-based stents
do not interfere with proliferation of smooth muscle cells but do induce the
upregulation of inflammatory genes. Journal of Biomedical Materials Research Part A,
2009. 91(2): p. 360-369.
Kirkland, N., et al., A survey of bio-corrosion rates of magnesium alloys. Corrosion
Science, 2010. 52(2): p. 287-291.
55
6 References
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
56
Witte, F., et al., Biodegradable magnesium scaffolds: Part 1: appropriate
inflammatory response. Journal of Biomedical Materials Research Part A, 2007.
81(3): p. 748-756.
Witte, F., et al., Biodegradable magnesium scaffolds: Part II: Peri-implant bone
remodeling. Journal of Biomedical Materials Research Part A, 2007. 81(3): p. 757765.
Kaesel, V., et al. Approach to control the corrosion of magnesium by alloying. in
Magnesium: Proceedings of the 6th International Conference Magnesium Alloys and
Their Applications. 2004. Wiley Online Library.
Gray, J. and B. Luan, Protective coatings on magnesium and its alloys – a critical
review. Journal of Alloys and Compounds, 2002. 336(1): p. 88-113.
Saris, N.-E.L., et al., Magnesium: an update on physiological, clinical and analytical
aspects. Clinica Chimica Acta, 2000. 294(1): p. 1-26.
Seiler, H.G., H. Sigel, and A. Sigel, Handbook on toxicity of inorganic compounds.
1988.
New, S.A., et al., Dietary influences on bone mass and bone metabolism: further
evidence of a positive link between fruit and vegetable consumption and bone health?
The American Journal of Clinical Nutrition, 2000. 71(1): p. 142-151.
Carpenter, T., C. Barton, and Y. Park. Usual dietary magnesium intake in NHANES
III is associated with femoral bone mass. Journal of Bone and Mineral Research,
2000. 15(suppl. 1):S292.
Rude, R., et al., Magnesium deficiency: effect on bone and mineral metabolism in the
mouse. Calcified Tissue International, 2003. 72(1): p. 32-41.
Williams, D., New interests in magnesium. Medical Device Technology, 2006. 17(3):
p. 9-10.
Hartwig, A., Role of magnesium in genomic stability. Mutation Research/
Fundamental and Molecular Mechanisms of Mutagenesis, 2001. 475(1): p. 113-121.
Wolf, F.I. and A. Cittadini, Chemistry and biochemistry of magnesium. Molecular
Aspects of Medicine, 2003. 24(1): p. 3-9.
Vormann, J., Magnesium: nutrition and metabolism. Molecular Aspects of Medicine,
2003. 24(1): p. 27-37.
Mcbride, E.D., Absorbable metal in bone surgery: a further report on the use of
magnesium alloys. Journal of the American Medical Association, 1938. 111(27): p.
2464-2467.
Troitskii, V. and D. Tsitrin, The resorbing metallic alloy „Osteosinthezit‟ as material for
fastening broken bone. Khirurgiia, 1944. 8(1): p. 41-44.
Znamenskii, M., Metallic osteosynthesis by means of an apparatus made of
resorbing metal. Khirurgiia, 1945. 12(1): p. 60-63.
Zhang, S., et al., Research on an Mg-Zn alloy as a degradable biomaterial. Acta
Biomaterialia, 2010. 6(2): p. 626-640.
Yamasaki, Y., et al., Synthesis of functionally graded MgCO3 apatite accelerating
osteoblast adhesion. Journal of Biomedical Materials Research, 2002. 62(1): p. 99105.
Zreiqat, H., et al., Mechanisms of magnesium-stimulated adhesion of osteoblastic
cells to commonly used orthopaedic implants. Journal of Biomedical Materials
Research, 2002. 62(2): p. 175-184.
Sader, M.S., R.Z. LeGeros, and G.A. Soares, Human osteoblasts adhesion and
proliferation on magnesium-substituted tricalcium phosphate dense tablets. Journal
of Materials Science: Materials in Medicine, 2009. 20(2): p. 521-527.
Cai, Y., et al., Osteoblastic cell response on fluoridated hydroxyapatite coatings: the
effect of magnesium incorporation. Biomedical Materials, 2010. 5(5): p. 054114.
Abed, E. and R. Moreau, Importance of melastatin-like transient receptor potential 7
and cations (magnesium, calcium) in human osteoblast-like cell proliferation. Cell
Proliferation, 2007. 40(6): p. 849-865.
6 References
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
Wu, L., et al., Effects of extracellular magnesium on the differentiation and function of
human osteoclasts. Acta Biomaterialia, 2014.
Zhang, E., et al., In vivo evaluation of biodegradable magnesium alloy bone implant
in the first 6 months implantation. Journal of Biomedical Materials Research Part A,
2009. 90(3): p. 882-893.
Revell, P.A., et al., The effect of magnesium ions on bone bonding to hydroxyapatite
coating on titanium alloy implants. Key Engineering Materials, 2004. 254: p. 447-450.
Yamasaki, Y., et al., Action of FGMgCO3Ap-collagen composite in promoting bone
formation. Biomaterials, 2003. 24(27): p. 4913-4920.
Percival, M., Bone health & osteoporosis. Appl Nutr Sci Rep, 1999. 5: p. 1-5.
Boanini, E., M. Gazzano, and A. Bigi, Ionic substitutions in calcium phosphates
synthesized at low temperature. Acta Biomaterialia, 2010. 6(6): p. 1882-1894.
Zhang, G., et al., Experimental study of in vivo implantation of a magnesium alloy at
early stage. Acta Metallurgica Sinica-Chinese Edition, 2007. 43(11): p. 1186.
Duygulu, O., et al. Investigation on the potential of magnesium alloy AZ31 as a bone
implant. in Materials science forum. 2007. Trans Tech Publ.
Salgado, A.J., O.P. Coutinho, and R.L. Reis, Bone tissue engineering: state of the art
and future trends. Macromolecular Bioscience, 2004. 4(8): p. 743-765.
Hing, K.A., Bone repair in the twenty-first century: biology, chemistry or engineering?
Philosophical Transactions of the Royal Society of London. Series A: Mathematical,
Physical and Engineering Sciences, 2004. 362(1825): p. 2821-2850.
Rupani, A., R. Balint, and S. Cartmell, Osteoblasts and their applications in bone
tissue engineering. Cell Health and Cytoskeleton, 2012. 4: p. 49-61.
Aubin, J., J.B. Lian, and G.S. Stein, Bone formation: maturation and functional
activities of osteoblast lineage cells. In: Murray JF, ed. Primer on the metabolic bone
diseases and disorders of mineral metabolism, 2006.
Knothe Tate, M.L., “Whither flows the fluid in bone?” An osteocyte's perspective.
Journal of Biomechanics, 2003. 36(10): p. 1409-1424.
Vaananen, H., et al., The cell biology of osteoclast function. Journal of Cell Science,
2000. 113(3): p. 377-381.
Teitelbaum, S.L., Bone resorption by osteoclasts. Science, 2000. 289(5484): p. 15041508.
Lacey, D., et al., Osteoprotegerin ligand is a cytokine that regulates osteoclast
differentiation and activation. Cell, 1998. 93(2): p. 165-176.
Schilling, A.F., et al., Osteoclasts and biomaterials. European Journal of Trauma,
2006. 32(2): p. 107-113.
Väänänen, H.K. and M. Horton, The osteoclast clear zone is a specialized cellextracellular matrix adhesion structure. Journal of Cell Science, 1995. 108(8): p.
2729-2732.
Raggatt, L.J. and N.C. Partridge, Cellular and molecular mechanisms of bone
remodeling. Journal of Biological Chemistry, 2010. 285(33): p. 25103-25108.
Zhang, S., et al., In vitro degradation, hemolysis and MC3T3-E1 cell adhesion of
biodegradable Mg-Zn alloy. Materials Science and Engineering: C, 2009. 29(6): p.
1907-1912.
Cheong, H.I., et al., In vitro cytotoxicity of eight β-blockers in human corneal epithelial
and retinal pigment epithelial cell lines: Comparison with epidermal keratinocytes and
dermal fibroblasts. Toxicology in Vitro, 2008. 22(4): p. 1070-1076.
Soheili Majd, E., M. Goldberg, and L. Stanislawski, In vitro effects of ascorbate and
Trolox on the biocompatibility of dental restorative materials. Biomaterials, 2003.
24(1): p. 3-9.
Zhang, M., et al., Properties and biocompatibility of chitosan films modified by
blending with PEG. Biomaterials, 2002. 23(13): p. 2641-2648.
Kirkpatrick, C. and C. Mittermayer, Theoretical and practical aspects of testing
potential biomaterialsin vitro. Journal of Materials Science: Materials in Medicine,
1990. 1(1): p. 9-13.
57
6 References
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
58
Porto, I.C., et al., Cytotoxicity of current adhesive systems: in vitro testing on cell
cultures of primary murine macrophages. Dental Materials, 2011. 27(3): p. 221-228.
Gu, X., et al., In vitro corrosion and biocompatibility of binary magnesium alloys.
Biomaterials, 2009. 30(4): p. 484-498.
Park, J.W., et al., Osteoblast response to magnesium ion-incorporated nanoporous
titanium oxide surfaces. Clinical Oral Implants Research, 2010. 21(11): p. 1278-1287.
Parfitt, A., The physiologic and clinical significance of bone histomorphometric data.
Bone Histomorphometry: Techniques and Interpretation, 1983: p. 143-223.
Yasuda, H., et al., Osteoclast differentiation factor is a ligand for osteoprotegerin/
osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proceedings
of the National Academy of Sciences, 1998. 95(7): p. 3597-3602.
Bloemen, V., et al., Intercellular adhesion molecule-1 clusters during
osteoclastogenesis. Biochemical and Biophysical Research Communications, 2009.
385(4): p. 640-645.
Bernhardt, A., et al., Crosstalk of osteoblast and osteoclast precursors on
mineralized collagen – towards an in vitro model for bone remodeling. Journal of
Biomedical Materials Research Part A, 2010. 95(3): p. 848-856.
Greiner, S., et al., Cocultures of osteoblasts and osteoclasts are influenced by local
application of zoledronic acid incorporated in a poly (D, L-lactide) implant coating.
Journal of Biomedical Materials Research Part A, 2009. 91(1): p. 288-295.
Jones, G.L., et al., Osteoblast: osteoclast co-cultures on silk fibroin, chitosan and
PLLA films. Biomaterials, 2009. 30(29): p. 5376-5384.
Mbalaviele, G., et al., Human mesenchymal stem cells promote human osteoclast
differentiation from CD34+ bone marrow hematopoietic progenitors 1. Endocrinology,
1999. 140(8): p. 3736-3743.
Tortelli, F., et al., Osteoblast and osteoclast differentiation in an in vitro threedimensional model of bone. Tissue Engineering Part A, 2009. 15(9): p. 2373-2383.
10993-5:2009 I. Biological evaluation of medical devices. Part 5. Tests for in vitro
cytotoxicity. 2009.
10993-12:2012 I. Biological evaluation of medical devices. Part 12. Sample
preparation and reference materials. 2012.
Böcker, W., et al., Introducing a single-cell-derived human mesenchymal stem cell
line expressing hTERT after lentiviral gene transfer. Journal of Cellular and Molecular
Medicine, 2008. 12(4): p. 1347-1359.
Legrand, C., et al., Lactate dehydrogenase (LDH) activity of the number of dead cells
in the medium of cultured eukaryotic cells as marker. Journal of Biotechnology, 1992.
25(3): p. 231-243.
Long, C.L., et al., E proteins regulate osteoclast maturation and survival. Journal of
Bone and Mineral Research, 2012. 27(12): p. 2476-2489.
Chiu, Y.H., et al., Regulation of human osteoclast development by dendritic cellspecific transmembrane protein (DC-STAMP). Journal of Bone and Mineral Research,
2012. 27(1): p. 79-92.
Collins, T.J., ImageJ for microscopy. Biotechniques, 2007. 43(1 Suppl): p. 25-30.
Hellemans, J., et al., qBase relative quantification framework and software for
management and automated analysis of real-time quantitative PCR data. Genome
Biology, 2007. 8(2): p. R19.
Phan, T., J. Xu, and M. Zheng, Interaction between osteoblast and osteoclast: impact
in bone disease. Histol Histopathol, 2004.19(4):1325-1344.
Witte, F., et al., Biodegradable magnesium-hydroxyapatite metal matrix composites.
Biomaterials, 2007. 28(13): p. 2163-2174.
Novack, D.V. and R. Faccio, Osteoclast motility: putting the brakes on bone
resorption. Ageing Research Reviews, 2011. 10(1): p. 54-61.
Minkin, C. and V. Marinho, Role of the osteoclast at the bone-implant interface.
Advances in Dental Research, 1999. 13(1): p. 49-56.
6 References
117.
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
Shankar, G., et al., Integrin receptor-mediated mobilisation of intranuclear calcium in
rat osteoclasts. Journal of Cell Science, 1993. 105(1): p. 61-68.
Takeichi, M. and T. Okada, Roles of magnesium and calcium ions in cell-to-substrate
adhesion. Experimental Cell Research, 1972. 74(1): p. 51-60.
Devine, A., et al., A longitudinal study of the effect of sodium and calcium intakes on
regional bone density in postmenopausal women. The American Journal of Clinical
Nutrition, 1995. 62(4): p. 740-745.
Massey, L.K. and S.J. Whiting, Dietary salt, urinary calcium, and bone loss. Journal
of Bone and Mineral Research, 1996. 11(6): p. 731-736.
Creedon, A. and K.D. Cashman, The effect of high salt and high protein intake on
calcium metabolism, bone composition and bone resorption in the rat. British Journal
of Nutrition, 2000. 84(01): p. 49-56.
Harrington, M., High salt intake appears to increase bone resorption in
postmenopausal women but high potassium intake ameliorates this adverse effect.
Nutrition Reviews, 2003. 61(5): p. 179-183.
Goulding, A. and D. Campbell, Effects of oral loads of sodium chloride on bone
composition in growing rats consuming ample dietary calcium. Mineral and
Electrolyte Metabolism, 1983. 10(1): p. 58-62.
Need, A.G., et al., Effect of salt restriction on urine hydroxyproline excretion in
postmenopausal women. Archives of Internal Medicine, 1991. 151(4): p. 757.
Chan, E. and R. Swaminathan, The effect of high protein and high salt intake for 4
months on calcium and hydroxyproline excretion in normal and oophorectomized rats.
J Lab Clin Med, 1994. 124: p. 37-41.
Goulding, A., et al., Sodium and osteoporosis. Recent advances in clinical nutrition.
London, John Libby, 1986: p. 99-108.
Goulding, A. and E. Gold, Effects of dietary sodium chloride loading on parathyroid
function, 1, 25-Dihydroxyvitamin D, calcium balance, and bone metabolism in female
rats during chronic prednisolone administration. Endocrinology, 1986. 119(5): p.
2148-2154.
Itoh, R. and Y. Suyama, Sodium excretion in relation to calcium and hydroxyproline
excretion in a healthy Japanese population. The American Journal of Clinical
Nutrition, 1996. 63(5): p. 735-740.
MacGregor, G.A., Salt – more adverse effects. American Journal of Hypertension,
1997. 10(S4): p. 37S-41S.
Lin, P.-H., et al., The DASH diet and sodium reduction improve markers of bone
turnover and calcium metabolism in adults. The Journal of Nutrition, 2003. 133(10): p.
3130-3136.
Goulding, A., Effects of dietary NaCl supplements on parathyroid function, bone
turnover and bone composition in rats taking restricted amounts of calcium. Mineral
and Electrolyte Metabolism, 1980. 4(4): p. 203-208.
Teucher, B., et al., Sodium and bone health: impact of moderately high and low salt
intakes on calcium metabolism in postmenopausal women. Journal of Bone and
Mineral Research, 2008. 23(9): p. 1477-1485.
Zarkadas, M., et al., Sodium chloride supplementation and urinary calcium excretion
in postmenopausal women. The American Journal of Clinical Nutrition, 1989. 50(5): p.
1088-1094.
Arimochi, H. and K. Morita, High salt culture conditions suppress proliferation of rat
C6 glioma cell by arresting cell-cycle progression at S-phase. Journal of Molecular
Neuroscience, 2005. 27(3): p. 293-302.
Dmitrieva, N.I. and M.B. Burg, High NaCl promotes cellular senescence. Cell Cycle,
2007. 6(24): p. 3108-3113.
Petronini, P.G., et al., Adaptive response of cultured fibroblasts to hyperosmolarity.
Experimental Cell Research, 1986. 165(1): p. 180-190.
Petronini, P.G., et al., Induction of BGT-1 and amino acid system A transport
activities in endothelial cells exposed to hyperosmolarity. American Journal of
59
6 References
138.
139.
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
60
Physiology-Regulatory, Integrative and Comparative Physiology, 2000. 279(5): p.
R1580-R1589.
Halleen, J.M., et al., Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker
of bone resorption. Clinical Laboratory, 2006. 52(9-10): p. 499-510.
Janckila, A.J., et al., Properties and expression of human tartrate-resistant acid
phosphatase isoform 5a by monocyte-derived cells. Journal of Leukocyte Biology,
2005. 77(2): p. 209-218.
Alatalo, S.L., et al., Rapid screening method for osteoclast differentiation in vitro that
measures tartrate-resistant acid phosphatase 5b activity secreted into the culture
medium. Clinical Chemistry, 2000. 46(11): p. 1751-1754.
Rubin, A., M. Terasaki, and H. Sanui, Major intracellular cations and growth control:
Correspondence among magnesium content, protein synthesis, and the onset of
DNA synthesis in BALB/c3T3 cells. Proceedings of the National Academy of
Sciences, 1979. 76(8): p. 3917-3921.
Bowen-Pope, D., et al., Separate roles for calcium and magnesium in their
synergistic effect on uridine uptake by cultured cells: significance for growth control.
Proceedings of the National Academy of Sciences, 1979. 76(3): p. 1308-1312.
Arnett, T.R., Extracellular pH regulates bone cell function. The Journal of Nutrition,
2008. 138(2): p. 415S-418S.
Goldhaber, P. and L. Rabadjija, H+ stimulation of cell-mediated bone resorption in
tissue culture. Am J Physiol, 1987. 253(1 Pt 1): p. E90-E98.
Shibutani, T. and J.N. Heersche, Effect of medium pH on osteoclast activity and
osteoclast formation in cultures of dispersed rabbit osteoclasts. Journal of Bone and
Mineral Research, 1993. 8(3): p. 331-336.
Bessac, B.F. and A. Fleig, TRPM7 channel is sensitive to osmotic gradients in
human kidney cells. The Journal of Physiology, 2007. 582(3): p. 1073-1086.
Chen, H.-C., et al., Blockade of TRPM7 channel activity and cell death by inhibitors
of 5-lipoxygenase. PLoS One, 2010. 5(6): p. e11161.
Hartzell, H.C. and R.E. White, Effects of magnesium on inactivation of the voltagegated calcium current in cardiac myocytes. The Journal of General Physiology, 1989.
94(4): p. 745-767.
Miyauchi, A., et al., Osteoclast cytosolic calcium, regulated by voltage-gated calcium
channels and extracellular calcium, controls podosome assembly and bone
resorption. The Journal of Cell Biology, 1990. 111(6): p. 2543-2552.
Janning, C., et al., Magnesium hydroxide temporarily enhancing osteoblast activity
and decreasing the osteoclast number in peri-implant bone remodelling. Acta
Biomaterialia, 2010. 6(5): p. 1861-1868.
Huehnerschulte, T.A., et al., In vivo assessment of the host reactions to the
biodegradation of the two novel magnesium alloys ZEK100 and AX30 in an animal
model. Biomed Eng Online, 2012. 11: p. 14.
Lange, T., et al., Proinflammatory and osteoclastogenic effects of betatricalciumphosphate and hydroxyapatite particles on human mononuclear cells in
vitro. Biomaterials, 2009. 30(29): p. 5312-5318.
Lange, T., et al., Size dependent induction of proinflammatory cytokines and
cytotoxicity of particulate beta-tricalciumphosphate in vitro. Biomaterials, 2011.
32(17): p. 4067-4075.
Lorenz, C., et al., Effect of surface pre-treatments on biocompatibility of magnesium.
Acta Biomaterialia, 2009. 5(7): p. 2783-2789.
Gu, X., et al., Corrosion resistance and surface biocompatibility of a microarc
oxidation coating on a Mg-Ca alloy. Acta Biomaterialia, 2011. 7(4): p. 1880-1889.
Gueux, E., et al., Protective effect of calcium deficiency on the inflammatory
response in magnesium-deficient rats. European Journal of Nutrition, 2002. 41(5): p.
197-202.
6 References
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
Hans, C.P., D.P. Chaudhary, and D.D. Bansal, Effect of magnesium supplementation
on oxidative stress in alloxanic diabetic rats. Magnesium Research, 2003. 16(1): p.
13-19.
Rosanoff, A., The 2-to-1 calcium-to-magnesium ratio.
Willumeit, R., A. Möhring, and F. Feyerabend, Optimization of cell adhesion on Mg
based implant materials by pre-Incubation under cell culture conditions. International
Journal of Molecular Sciences, 2014. 15(5): p. 7639-7650.
Boyle, W.J., W.S. Simonet, and D.L. Lacey, Osteoclast differentiation and activation.
Nature, 2003. 423(6937): p. 337-342.
Nakashima, T., M. Hayashi, and H. Takayanagi, New insights into osteoclastogenic
signaling mechanisms. Trends in Endocrinology & Metabolism, 2012. 23(11): p. 582590.
Simonet, W., et al., Osteoprotegerin: a novel secreted protein involved in the
regulation of bone density. Cell, 1997. 89(2): p. 309-319.
Grimaud, E., F. Redini, and D. Heymann, Osteoprotegerin: a new therapeutic agent
for the treatment of bone disease. Drug Discovery Today, 2001. 6(23): p. 1241-1242.
Morabito, N., et al., Osteoprotegerin and RANKL in the pathogenesis of thalassemiainduced osteoporosis: new pieces of the puzzle. Journal of Bone and Mineral
Research, 2004. 19(5): p. 722-727.
Fazzalari, N.L., et al., The ratio of messenger RNA levels of receptor activator of
nuclear factor κB ligand to osteoprotegerin correlates with bone remodeling indices in
normal human cancellous bone but not in osteoarthritis. Journal of Bone and Mineral
Research, 2001. 16(6): p. 1015-1027.
Bushinsky, D.A., Acid-base imbalance and the skeleton. Eur J Nutr, 2001. 40(5): p.
238-44.
Elices, M.J., L.A. Urry, and M.E. Hemler, Receptor functions for the integrin VLA-3:
fibronectin, collagen, and laminin binding are differentially influenced by Arg-Gly-Asp
peptide and by divalent cations. J Cell Biol, 1991. 112(1): p. 169-81.
Takeichi, M. and T.S. Okada, Roles of magnesium and calcium ions in cell-tosubstrate adhesion. Exp Cell Res, 1972. 74(1): p. 51-60.
61
7 Abbreviations
7
Abbreviations
Ag
Silver
Al
Aluminum
Al2O3
Aluminium oxide
ALP
Alkaline phosphatase
AM
Aluminium/manganese
α-MEM
Minimum essential α-minimum
ANOVA
Analysis of variance
ARS
Alizarin Red S
AZ
Aluminium/zinc
BMSC
Bone marrow stromal cells
BSA
Bovine serum albumin
B2M
β2 microglobulin
Ca
Calcium
Ca2+
Ca ion
CaCl2
Calcium chloride
cDNA
Complementary DNA
c-Fms
Colony-stimulating factor 1 receptor
CK
Cathepsin K
Cl-
Chloride ion
Co-Cr alloys
Cobalt-chromium-based alloys
CTR
Calcitonin receptor
DAPI
4-6-diamidino-2 phenylindole solution
ddH2O
Double-distilled water
DLX5
Distal-less homeobox 5
EDTA
Ethylenediaminetetraacetic acid
Elisa
Enzyme linked immunosorbent assay
FBS
Foetal bovine serum
Fe
Iron
GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
HA
Hydroxyapatite
HBDC
Human bone-derived cells
hMSCs
Human mesenchymal stem cells
hTERT
Human telomerase reverse transcriptase
H2
Hydrogen gas
In
Indium
LDH
Lactate dehydrogenase
54
7 Abbreviations
M-CSF
Macrophage colony-stimulating factor
Mg
Magnesium
Mg
2+
Magnesium ion
MgCl2
Magnesium chloride
Mg(OH)2
Magnesium hydroxide
Mn
Manganese
MTT
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
Na
Sodium
NaCl
Sodium chloride
NaOH
Sodium hydroxide
NDGA
nordihydroguaiaretic acid
NFATc1
Nuclear factor-activated T cells c1
NFêB1
Nuclear factor-êB 1
OCLs
Osteoclast-like cells
OPG
Osteoprotegerin
OSCAR
Osteoclast associated immunoglobulin-like receptor
PBMC
Peripheral blood mononuclear cells
PBS
Phosphate-buffered saline
pNPP
P-nitrophenylphosphate
PTH
Parathyroid hormone
RANK
Receptor activator of nuclear factor kappa-B
RANKL
Receptor activator of nuclear factor kappa-B ligand
RIPA
Radioimmunoprecipitation assay
RPL10
60S ribosomal protein L10
RT
Room temperature
RT-qPCR
Real time quantitative polymerase chain reaction
RUNX2
Runt-related transcription factor 2
SCP-1
Single cell-picked clone 1
Si
Silicon
Sn
Tin
SPI1
Spleen focus forming virus (SFFV) proviral integration oncogene
TCP
Tricalcium phosphate
Ti
Titanium
TRAP
Tartrate-resistant acid phosphatase
TRPM7
Transient receptor potential melastin 7
VDCC
Voltage-dependent Ca channels
WST-1
Water-soluble tetrazolium salt
55
7 Abbreviations
Y
Yttrium
Zn
Zinc
Zr
Zirconium
2D
Two-dimensional
3D
Three-dimensional
56
8 Acknowledgements
8
Acknowledgements
The current thesis is about the report of my research which was carried out at the
Department for Biological Characterisation, Helmholtz-Zentrum Geesthacht and Department
of Plastic Surgery and Hand Surgery, Klinikum Rechts der Isar, Technical University Munich
from October, 2010 to April, 2015. It is my great pleasure to thank the generous financial
support supplied by China Scholarship Council and Helmholtz Association of German
Research Centers. In particular, I would also like to thank all the persons who helped me
during this long-term project. It would not have been accomplished without the following
people who contributed, in many forms, for which I am especially grateful.
First and foremost, I offer my sincerest gratitude to my supervisor, Prof. Regine
Willumeit-Römer from Helmholtz-Zentrum Geesthacht for all of her huge knowledge, her
scientific supervision and her charm. Working with her was not only scientifically, but also
personally enriching. It was for me a privilege to have the opportunity to work in the
Department of Plastic Surgery and Hand Surgery, Klinikum Rechts der Isar, Technical
University Munich from May, 2012 to April, 2013. I would like to give my sincerest
acknowledgement to Prof. Dr. Arndt F. Schilling for his considerably enrichment of
knowledge as well as his discussions and guidance on my research work. I am deeply
grateful that I have been given the chance to work with osteoclasts, the most beautiful and
fascinating cells. They continue to make me happy every time I see them. I would also like to
say thanks to Prof. Dr. Ulrich Hahn from the Department of Chemistry, University of
Hamburg for his constant support and encouragement throughout the entire duration of my
research. It would not have been possible to earn my Ph.D. experience productive and
stimulating without all of his contributions of ideas, patience and guidance.
Secondly, my deepest gratitude goes to Dr. Bérengère Luthringer who introduced me
into the topic of medical biomaterials and helped me out with almost any problem I
encountered both in science and daily life with her precious equanimity and friendship. As
much as I could write here would never be enough to express how thankful I am to all of her
trust, enlightening guidance and fruitful discussions.
I wish to extend my appreciation to all members in WBB (the former WPS)
department who have been directly or indirectly contributed to the great work atmosphere in
which I learn and grow through various ways toward the accomplishment of my dissertation.
I would like to give many thanks to Dr. Frank Feyerabend for the scientific discussions and
for reviewing and improving my project manuscripts. I am also highly grateful to Gabriele
Salamon for the trainings she gave to me on cell culture techniques as well as other
technical supports whenever I needed it for my project. Additionally, a sincere appreciation
goes to Anna Burmester and Axel Deing for their preparation of the pure Mg extract for my
experiment, showing me how to perform the fluorescence staining as well as PCR
techniques. A lot of thanks come to Steven Behr and Dorothee Scharfenberg for their kind
help in translating my abstract into German. Many thanks come to Dr. Katharina Philipp for
her nice and very friendly support in helping me with the practice of my oral presentation as
well as the organization of my thesis printing. Completing my project would not been
65
8 Acknowledgements
possible without Dr. Lei Yang, Dr. Di Tie‘s friendship and outstanding moral support. I also
owe a thank you to two unexpected, but decisive collaborations: Prof. Dr.-Ing Sergio
Amancio and Andre Abibe. Both of them are from WMP, Helmholtz-Zentrum Geesthacht.
They supplied me the opportunity as well as technical aspects for performing threedimension assessment of osteoclastic resorption activity by laser confocal scanning
microscope. Without them my project wouldn‘t have been so successful. I also would like to
thank Anke Roering for always being so kind on supplying the interlibrary loan service to me.
It was always a pleasure having a conversation with her.
Additionally, my most appreciation goes to Ursula Hopfner and Manuela Kirsch for
their invaluable technical supports and efforts for making every experimental mean available
for conducting my research work. I am also very grateful to all my remarkable colleagues
and friends at Technical University Munich for their work collaboration and friendship which
is far beyond laboratory relationship: to Mark Di Frangia for his encouragement,
organizational support and pleasant conversations; to Lisanne Grünherz and Nadja Wojtas
for their training on me about the isolation of osteoclast precursor cells and various
osteoclastic characterization techniques; to Elisabeth Wahl, Dr. Dai, Simone Schmalix, Myra
Chavéz Rosas, Dibora Tibebu for their precious accompany, friendship and all the relaxing
time we spent together in the Chinese restaurants.
Although not influencing my research work so directly, I would like to especially
express my sincerest gratitude to Mr. Peter Kummerow and his wife Mrs. Urte Kummerow.
They are both so kind and considerate people that they helped me a lot with my contracts,
searching for apartments, transporting furniture, extending visa and so on. Furthermore,
many thanks go to my dearest friends and peers in Geesthacht who I accompanied with,
learned from and made precious friendship and lovely memory with. Without you, I could not
have led a pretty colorful and impressive life in Germany.
Last but not least, I am extremely thankful to my dearest families and specially my
great husband Zhuang Cao for all of their unconditional love, endless support,
encouragement and understanding. It could be considered as a key element in keeping me
inspired throughout not only the duration of my degree but the entire of my life.
September, 2015
66
Lili Wu
9 Appendix
9
Appendix
I.
RISK AND SAFETY STATEMENTS
Following is the list of potentially hazardous materials as well as the respective hazard and
precautionary statements as introduced by the Globally Harmonized System of Classification
and Labelling of Chemicals (GHS).
Compound
Chemical
Abstracts
Service No.
Hazard
statements
GHS hazard
Precautionary
statements
ARS
130-22-3
H315-H319-H335
GHS07
P261-P305 + P351 +
P338
CaCl2
10043-52-4
H319
GHS07
P305 + P351 + P338
Deoxycholic acid
83-44-3
H302-H315H319-H335
GHS07
P261-P305 + P351 +
P338
Dexamethasone
50-02-2
H315-H317H319-H334-H335
GHS07,
GHS08
P261-P280-P305 + P351
+ P338-P342 + P311
Diethanolamine
111-42-2
H302-H315H318-H373-H412
GHS05,
GHS07,
GHS08
P273-P280-P301 + P312
+ P330-P305 + P351 +
P338 + P310
EDTA
60-00-4
H319
GHS07
P305 + P351 + P338
Ethanol
64-17-5
H225-H319
GHS02,
GHS07
P210-P280-P305 + P351
+ P338-P337 + P313P403 + P235
Fast red violet LB
salt
32348-81-5
H302-H312H332-H351
GHS07,
GHS08
P280
Formaldehyde
solution
50-00-0
H301 + H311 +
H331-H314H317-H335H341-H350-H370
GHS05,
GHS06,
GHS08
P201-P260-P280-P301 +
P310 + P330-P303 +
P361 + P353-P304 +
P340 + P310-P305 +
P351 + P338-P308 +
P311-P403 + P233
H2O2
7722-84-1
H302-H318
GHS05,
GHS07
P280-P301 + P312 +
P330-P305 + P351 +
P338 + P310
Isopropanol
67-63-0
H225-H319-H336
GHS02,
GHS07
P210-P280-P305 + P351
+ P338-P337 + P313P403 + P235
67
9 Appendix
Naphthol AS-MX
phosphate
1596-56-1
H315-H319-H335
GHS07
P261-P305 + P351 +
P338
Nonidet P 40
Substitute
9016-45-9
H302-H318-H400
GHS05,
GHS07,
GHS09
P273-P280-P305 + P351
+ P338
Potassium
carbonate
584-08-7
H302-H315H319-H335
GHS07
P280-P301 + P312 +
P330-P305 + P351 +
P338-P337 + P313
Sodium azide
26628-22-8
H300 + H310H373-H410
GHS06,
GHS08,
GHS09
P273-P280-P301 + P310
+ P330-P302 + P352 +
P310-P391-P501
Sodium hydroxide
1310-73-2
H290-H314-H318
GHS05
P280-P301 + P361 +
P353-P304 + P340 +
P310-P305 + P351 +
P338
Triton X-100
9002-93-1
H302-H319-H411
GHS07,
GHS09
P273-P280-P301 + P312
+ P330-P337 + P313P391-P501
1α,25
Dihydroxyvitamin
D3
32222-06-3
H300 + H310 +
H330-H361
GHS06,
GHS08
P260-P264-P280-P284P301 + P310-P302 +
P350
™
GHS hazard statements
H225
Highly flammable liquid and vapour
H290
May be corrosive to metals
H300
Fatal if swallowed
H301
Toxic if swallowed
H302
Harmful if swallowed
H310
Fatal in contact with skin
H311
Toxic in contact with skin
H312
Harmful in contact with skin
H314
Causes severe skin burns and eye damage
H315
Causes skin irritation
H317
May cause an allergic skin reaction
H318
Causes serious eye damage
H319
Causes serious eye irritation
H330
Fatal if inhaled
68
9 Appendix
H331
Toxic if inhaled
H332
Harmful if inhaled
H334
May cause allergy or asthma symptoms or breathing difficulties if inhaled
H335
May cause respiratory irritation
H336
May cause drowsiness or dizziness
H341
Suspected of causing genetic defects
H350
May cause cancer
H351
Suspected of causing cancer
H361
Suspected of damaging fertility or the unborn child
H370
Causes damage to organs
H373
Causes damage to organs through prolonged or repeated exposure
H400
Very toxic to aquatic life
H410
Very toxic to aquatic life with long lasting effects
H411
Toxic to aquatic life with long lasting effects
H412
Harmful to aquatic life with long lasting effects
GHS precautionary statements
P201
Obtain special instructions before use
P210
Keep away from heat/sparks/open flames/hot surfaces. — No smoking
P233
Keep container tightly closed
P235
Keep cool
P260
Do not breathe dust/fume/gas/mist/vapours/spray
P261
Avoid breathing dust/fume/gas/mist/vapours/spray
P264
Wash hands thoroughly after handling
P273
Avoid release to the environment
P280
Wear protective gloves/protective clothing/eye protection/face protection
P284
Wear respiratory protection
P301
If swallowed
P302
If on skin
P303
If on skin (or hair)
P304
If inhaled
69
9 Appendix
P305
If in eyes
P308
If exposed or concerned
P310
Immediately call a poison centre or doctor/physician
P311
Call a poison centre or doctor/physician
P312
Call a poison centre or doctor/physician if you feel unwell
P313
Get medical advice/attention
P330
Rinse mouth
P337
If eye irritation persists
P338
Remove contact lenses, if present and easy to do. Continue rinsing
P340
Remove victim to fresh air and keep at rest in a position comfortable for
breathing
P342
If experiencing respiratory symptoms
P350
Gently wash with plenty of soap and water
P351
Rinse cautiously with water for several minutes
P352
Wash with plenty of soap and water
P353
Rinse skin with water/shower
P361
Remove/Take off immediately all contaminated clothing
P391
Collect spillage. Hazardous to the aquatic environment
P403
Store in a well-ventilated place
P501
Dispose of contents/container to… [… in accordance with local/regional/
national/international regulations (to be specified)]
70
9 Appendix
II.
CURRICULUM VITAE
Division of Metallic Biomaterials, Institute of Materials Research
Helmholtz-Zentrum Geesthacht (HZG), Geesthacht, 21502, Germany
Tel Office: +49 (0)4152 872509
Mobile: +49 (0)157 89166898
Fax: +49 (0)4152 872595
Email: [email protected]
Homepage: http://www.hzg.de/metallic_biomaterials
ACADEMIC QUALIFICATIONS
04/2015-Present
10/2010-04/2015
09/2007-06/2010
09/2003-06/2007
Scientific Researcher, Institute of Materials Research, HZG, Germany
Doctoral Candidate, Institute of Materials Research, HZG, Germany
Master, School of Life Sciences, Lanzhou University, China
Bachelor, School of Life Sciences, Lanzhou University, China
RESEARCH EXPERIENCE
Division of Metallic Biomaterials, HZG cooperated with Department of Plastic Surgery
and Hand Surgery, Klinikum Rechts der Isar, Technical University Munich (TUM), 2010Present
Doctoral thesis research supervised by Prof. Dr. Regine Willumeit-Römer (HZG), Prof. Dr. Ulrich
Hahn (University of Hamburg) and Prof. Dr. med. Arndt F. Schilling (TUM)
Dissertation: ―In Vitro Assessment of the Cytocompatibility of Magnesium-Based Implant Materials
with Osteoclasts.‖
The cellular mechanism involved in the remodelling of magnesium-based implants has been revealed
via osteoclast monoculture as well as osteoblast-osteoclast coculture models. The importance of the
cocultivation system of bone cells has been highlighted as it could be considered as a compromise
way between in vitro monoculture and in vivo animal model for biocompatible assessment of
biomedical magnesium-based alloys.
School of Life Sciences, Lanzhou University, 2007-2010
Master thesis research supervised by Prof. Jian Quan Liu
Dissertation: ―Phylogeography investigation of Allium przewalskianum Regel. (Alliaceae) in the
Qinghai-Tibetan Plateau.‖
The complex response of Allium przewalskianum diploid-tetraploid complex on the Qinghai-Tibetan
Plateau (QTP) to the Quaternary climatic oscillations was addressed through the examination of five
chloroplast DNA fragments to determine the extent of sequence variation and its distribution within
diploid and tetraploid populations.
71
9 Appendix
III.
PUBLICATION LIST
1. L. L. Wu, B. J.C. Luthringer, F. Feyerabend, A. F. Schilling and R. Willumeit-Römer
(2015). Effects of extracellular magnesium extract on the proliferation and
differentiation of human osteoblasts and osteoclasts in coculture. Acta Biomaterialia
27: 294-304. http://www.ncbi.nlm.nih.gov/pubmed/26318802. (Journal Article)
2. L. L. Wu, B. J. C. Luthringer, F. Feyerabend, A. F. Schilling and R. Willumeit (2014).
Effects of extracellular magnesium extracts on the proliferation and differentiation of
human osteoblast-osteoclast co-cultures. European Cells and Materials 28. Suppl. 3,
27. http://www.ecmjournal.org/journal/supplements/vol028supp03/pdf/vol028supp03a
027.pdf. (Conference Proceeding)
3. L. L. Wu, B. J. C. Luthringer, F. Feyerabend, A. F. Schilling and R. Willumeit (2014).
Effects of extracellular magnesium on the differentiation and function of human
osteoclasts. Acta Biomaterialia 10: 2843–2854. http://www.sciencedirect.com/
science/article/pii/S1742706114000622. (Journal Article)
4. D. Tie, R. G. Guan, T. Cui, L. L. Wu, L. L. Song and H. M. Qin (2013). Influence of
strontium concentration on in vitro corrosion property and cytocompatibility of ternary
Mg-Zn-Sr alloys. European Cells and Materials 26. Suppl. 5, 36.
http://www.ecmjournal.org/journal/supplements/vol026supp05/pdf/vol026supp05a036
.pdf. (Conference Proceeding)
5. B. J. C Luthringer, L. L. Wu, M. Costantino, A. Burmester, A. F. Schilling, F.
Feyerabend and R. Willumeit (2013). In vitro strategies to mimic in vivo events after
osseous implantation. European Cells and Materials 26. Suppl. 5, 35.
http://www.ecmjournal.org/journal/supplements/vol026supp05/pdf/vol026supp05a035
.pdf. (Conference Proceeding)
6. L. Grünherz , L. L. Wu, N. Wojtas, F. Kleinmichel, C. I. Günter, H.-G. Machens and A.
F. Schilling (2013). Osteoclastic resorption of bone substitute biomaterials.
Osteologie
22:
169-248.
http://www.schattauer.de/en/magazine/subjectareas/journals-a-z/osteology/contents/archive/issue/1788/manuscript/
20259.html.
(Journal Article)
7. L. L. Wu, X. K. Cui, R. I. Milne, Y. SH. Sun and J. Q. Liu (2010). Multiple
autopolyploidizations and range expansion of Allium przewalskianum Regel.
(Alliaceae) in the Qinghai-Tibetan Plateau. Molecular Ecology 19: 1691–1704.
http://onlinelibrary.wiley.com/doi/10.1111/j.1365-294X.2010.04613.x/abstract.
(Journal Article)
8. L. L. Wu, B. J.C. Luthringer, F. Feyerabend, Z. Y. Zhang, H. G. Machens, R.
Willumeit-Römer and A. F. Schilling (2015). Increased levels of sodium chloride
directly and dose-dependently increase osteoclastic differentiation and resorption.
Submitted to Osteoporosis International, under revision. (Journal Article)
72
9 Appendix
IV.
CONFERENCE CONTRIBUTIONS
1. L. L. Wu, B. J. C. Luthringer, F. Feyerabend, A. F. Schilling and R. Willumeit-Römer
(2014). Effects of extracellular magnesium extracts on the proliferation and
differentiation of human osteoblast-osteoclast co-cultures. Maratea, Italy: 6th
Symposium on Biodegradable Metals, 24-29 Aug. 2014. (Oral & Poster presentation)
2. L. L. Wu, B. J. C. Luthringer, F. Feyerabend, A. F. Schilling and R. Willumeit (2014).
Effects of extracellular magnesium on the differentiation and function of human
osteoclasts. Smolenice Castle, Slovak Republic: Magnesium in Translational
Medicine, 11-15 May 2014. (Poster presentation)
3. L. L. Wu, B. J. C. Luthringer, L. Grünherz, N. Wojtas, U. Hopfner, F. Feyerabend, R.
Willumeit and A. F. Schilling (2013) MgCl2 affects the proliferation, differentiation and
function of human osteoclasts. Weimar, Germany: Osteologie, 6-9 Mar. 2013.
(Poster presentation)
73