ORIGINAL
E n d o c r i n e
ARTICLE
R e s e a r c h
Testosterone and Progesterone, But Not Estradiol,
Stimulate Muscle Protein Synthesis in
Postmenopausal Women
Gordon I. Smith, Jun Yoshino, Dominic N. Reeds, David Bradley,
Rachel E. Burrows, Henry D. Heisey, Anna C. Moseley, and Bettina Mittendorfer
Center for Human Nutrition, Division of Geriatrics and Nutritional Science, Department of Internal
Medicine, Washington University School of Medicine, St Louis, Missouri 63110
Context: The effect of the female sex steroids, estradiol and progesterone, on muscle protein
turnover is unclear. Therefore, it is unknown whether the changes in the hormonal milieu throughout the life span in women contribute to the changes in muscle protein turnover and muscle mass
(eg, age associated muscle loss).
Objective: The objective of this study was to provide a comprehensive evaluation of the effect of
sex hormones on muscle protein synthesis and gene expression of growth-regulatory factors [ie,
myogenic differentiation 1 (MYOD1), myostatin (MSTN), follistatin (FST), and forkhead box O3
(FOXO3)].
Subjects and Design: We measured the basal rate of muscle protein synthesis and the expression
of muscle growth-regulatory genes in 12 premenopausal women and four groups of postmenopausal women (n ⫽ 24 total) who were studied before and after treatment with T, estradiol, or
progesterone or no intervention (control group). All women were healthy, and pre- and postmenopausal women were carefully matched on body mass, body composition, and insulin
sensitivity.
Results: The muscle protein fractional synthesis rate was approximately 20% faster, and MYOD1,
FST, and FOXO3 mRNA expressions were approximately 40%–90% greater (all P ⬍ .05) in postmenopausal than premenopausal women. In postmenopausal women, both T and progesterone
treatment increased the muscle protein fractional synthesis rate by approximately 50% (both P ⬍
.01), whereas it was not affected by estradiol treatment and was unchanged in the control group.
Progesterone treatment increased MYOD1 mRNA expression (P ⬍ .05) but had no effect on MSTN,
FST, and FOXO3 mRNA expression. T and estradiol treatment had no effect on skeletal muscle
MYOD1, MSTN, FST, and FOXO3 mRNA expression.
Conclusion: Muscle protein turnover is faster in older, postmenopausal women compared with
younger, premenopausal women, but these age-related differences do not appear to be explained
by the age- and menopause-related changes in the plasma sex hormone milieu. (J Clin Endocrinol
Metab 99: 256 –265, 2014)
exual dimorphism in body composition (more fat and
less muscle in women than men) (1, 2) is thought to
be a secondary sexual characteristic due to differences in
the sex hormone milieu between men and women. T is a
S
well-known anabolic steroid; it increases muscle protein
synthesis (3–7) and muscle mass (8 –11) and is most likely
responsible for the greater increase in lean mass after the
onset of puberty in boys compared with girls (12). Female
ISSN Print 0021-972X ISSN Online 1945-7197
Printed in U.S.A.
Copyright © 2014 by The Endocrine Society
Received July 11, 2013. Accepted October 15, 2013.
First Published Online November 7, 2013
Abbreviations: E1, estrone; E2, 17␤-estradiol; FOXO3, forkhead box O3; FSR, fractional
synthesis rate; FST, follistatin; HDL, high-density lipoprotein; IGF-BP3, IGF-binding protein 3;
LDL, low-density lipoprotein; MSTN, myostatin; MYOD1, myogenic differentiation 1;
OGTT, oral glucose tolerance test; TTR, tracer to tracee ratio.
256
jcem.endojournals.org
J Clin Endocrinol Metab, January 2014, 99(1):256 –265
doi: 10.1210/jc.2013-2835
doi: 10.1210/jc.2013-2835
sex steroids, on the other hand, have long been considered
innocent bystanders with regard to muscle protein turnover and mass. About a decade ago, however, a study on
rodents showed that ovariectomy increases and progesterone and estradiol suppress the rate of muscle protein
synthesis (13). This suggests that female sex steroids might
be important regulators of muscle mass. The results from
subsequent studies evaluating the effect of female sex steroids on muscle protein metabolism in human subjects
have been conflicting though. We found that the basal rate
of muscle protein synthesis is greater in older, postmenopausal compared with younger, premenopausal women
(14), and other investigators reported that the basal rate of
muscle protein synthesis is less in women who received
estrogen replacement therapy after hysterectomy than
age-matched postmenopausal women (15) and less in
women who use oral, hormonal contraceptives compared with those who do not (16). Others, however,
reported no difference in the rate of muscle protein synthesis between hormone users and nonusers (16), between young and old women (17), or between women
who were studied during the follicular or the luteal
phases of their menstrual cycle (18).
These studies are difficult to interpret, however, because of their cross-sectional design and differences in subject characteristics within and between studies [eg, body
composition (14, 17)] as well as potential confounding
influences [eg, differences in free T, IGF-I, and insulin concentrations between hormone treated and untreated
women (15, 16)], which may have been induced by the oral
hormone treatments that were used in these studies. Evidence is emerging that increased adiposity may affect the
rate of muscle protein turnover (19), and it is well known
that oral administration of synthetic female sex hormone
derivatives alters the concentration of anabolic and catabolic hormones (eg, IGF-I, cortisol) in plasma, whereas
systemic delivery of unmodified hormones does not
(20 –22).
The purpose of the study presented here was to evaluate
the effect of menopausal status on muscle protein synthesis and to provide a comprehensive evaluation of the effect
of systemically delivered sex hormones (to avoid oral hormone treatment induced changes in anabolic/catabolic
plasma hormone availability) on muscle protein synthesis.
Accordingly, we measured the basal rate of muscle protein
synthesis in premenopausal women and four groups of
postmenopausal women who were studied before and
after treatment with T, estradiol, or progesterone or no
intervention (control group). Pre- and postmenopausal
women were healthy and carefully matched on body mass,
body composition, and insulin sensitivity. We hypothesized that the rate of muscle protein synthesis would be
jcem.endojournals.org
257
greater in postmenopausal compared with premenopausal
women and that T administration would increase and estradiol and progesterone treatment would suppress the
basal rate of muscle protein synthesis. We also measured
the expression of genes involved in the regulation of muscle mass [ie, myogenic differentiation 1 (MYOD1), a myogenic growth factor (23); myostatin (MSTN), a muscle
growth inhibitor (24 –26); follistatin (FST), which binds to
and thereby inhibits myostatin (27, 28); and forkhead box
O3 (FOXO3), which induces the transcription of ubiquitin ligases (29)] to gain information regarding potential
sex hormone-mediated transcriptional changes.
Materials and Methods
Subjects and prestudy testing
Twelve premenopausal and 24 postmenopausal, sedentary
(⬍1.5 h of exercise/ per week) and weight-stable (⬍2 kg change
for at least 6 mo) women participated in this study. Written
informed consent was obtained from all subjects before participation in the study, which was approved by the Institutional
Review Board of Washington University School of Medicine (St
Louis, Missouri).
All subjects were considered to be in good health after completing a comprehensive medical examination, including a detailed history and physical examination, a resting electrocardiogram, standard blood tests, and an oral glucose tolerance test
(OGTT). None of the subjects had evidence of chronic illness or
significant organ dysfunction (eg, diabetes mellitus, cirrhosis) or
were taking medications (including hormone replacement therapy or hormonal contraceptives) that could interfere with muscle
protein metabolism, and none reported excessive alcohol intake
or consumed tobacco products. Body fat mass, fat-free mass, and
appendicular muscle mass were determined by using dual-energy
X-ray absorptiometry (Hologic QDR 1000/w).
Experimental design
Protein metabolism study
All subjects completed a baseline protein metabolism study
after having been instructed to adhere to their usual diet, to avoid
alcohol intake, and to refrain from vigorous physical activities
for 3 days. They were admitted to the Clinical Research Unit in
the late afternoon, the day before the protein metabolism study,
consumed a standard dinner between 6:00 and 7:00 PM, and then
fasted, except for water, until the next morning. At 6:00 AM, a
catheter was inserted into an arm vein for the infusion of a stable
isotope labeled leucine tracer; a second catheter was inserted into
a vein of the contralateral hand, which was warmed to 55°C by
using a thermostatically controlled box to obtain arterialized
blood samples. The sampling catheter was kept open with a slow,
controlled infusion of 0.9% NaCl solution (30 mL/h). At 7:00 AM
(time ⫽ 0), a continuous infusion of [5,5,5-2H3]leucine (0.12
␮mol/kg body weight 䡠 min; priming dose: 7.2 ␮mol/kg body
weight) dissolved in 0.9% NaCl solution was started and maintained for 5 hours.
Blood samples were obtained immediately before administering the tracer and 60, 120, 180, 240, and 300 minutes after
258
Smith et al
Sex Hormones and Muscle Protein Synthesis
starting the tracer infusion to determine plasma hormone and
substrate concentrations and the leucine tracer to tracee ratio
(TTR) in plasma. Muscle tissue (⬃100 mg) was obtained under
local anesthesia (lidocaine 2%) from the quadriceps femoris by
using a Tilley-Henkel forceps at 120 minutes and 300 minutes to
determine the basal rate of muscle protein synthesis (labeled leucine incorporation into muscle protein; see Calculations) and the
mRNA expressions (initial biopsy only) of MYOD1, MSTN,
FST, and FOXO3.
Hormone treatment and repeat protein metabolism
studies (postmenopausal women only)
After completing the baseline study, postmenopausal women
were randomized to one of four groups (n ⫽ 6 per group): control
(no intervention), and T, estradiol, or progesterone treatment,
which was started within 2 weeks after completing the baseline
study. Subjects randomized to the T group applied 1.25 g/d of T
J Clin Endocrinol Metab, January 2014, 99(1):256 –265
transdermally (Androgel 1%; Abbvie Inc) for 21 days. Assuming
an absorption rate of 10%, this regimen was expected to deliver
approximately 1250 ␮g of T daily and raise plasma T concentration by approximately 7-fold (6). This increase in concentration is comparable with the concentration typically found in
women with hyperandrogenemia due to polycystic ovary syndrome (30, 31) but somewhat below the normal range for eugonadal men (32). Subjects randomized to the estradiol group
applied estradiol transdermally for 14 days by using continuous
delivery patches designed to deliver 0.1 mg estradiol per day (31
cm2 patches applied once a week; Mylan Pharmaceuticals Inc),
followed by a 14-day period without treatment. The 14-day
treatment period was repeated two more times with a 14-day
no-treatment period in between. This regimen was expected to
raise (during the active drug delivery phase) plasma estrogens to
concentrations comparable with those in young healthy women
during the mid- to late-follicular phase of the menstrual cycle
Table 1. Subjects’ Age, Body Composition, and Baseline Plasma Substrate and Hormone Concentrations
Age, y
Body mass index, kg/m2
Body mass, kg
Fat-free mass, kg
Appendicular muscle mass, kg
Body fat, %
Fasting insulin, mU/L
Fasting insulin, pM
Fasting glucose, mg/dL
Fasting glucose, mM
2-Hour post-OGTT plasma glucose, mg/dL
2-Hour post-OGTT plasma glucose, mM
HOMA-IR score
Leucine, mg/dL
Leucine, ␮M
Triacylglyerol, mg/dL
Triacylglyerol, mM
Total cholesterol, mg/dL
Total cholesterol, mM
HDL-cholesterol, mg/dL
HDL-cholesterol, mM
LDL-cholesterol, mg/dL
LDL-cholesterol, mM
Total T, ng/dL
Total T, nM
Bioavailable T, ng/dL
Bioavailable T, nM
E1 ⫹ E2, pg/mL
E1 ⫹ E2, pM
Progesterone, ng/mL
Progesterone, nM
FSH, U/L
SHBG, mg/L
SHBG, nM
Cortisol, ng/dl
Cortisol, nM
IGF-I, ng/dL
IGF-I, nM
IGF-BP3, ng/dL
IGF-BP3, nM
Premenopausal
(n ⴝ 12)
Postmenopausal
(n ⴝ 24)
33 ⫾ 2
29.7 ⫾ 1.7
78 ⫾ 5
48 ⫾ 2
19.4 ⫾ 1.0
38 ⫾ 2
3.9 (3.1, 5.0)
27 (22, 35)
88 ⫾ 2
4.88 ⫾ 0.10
105 ⫾ 5
5.83 ⫾ 0.28
0.8 (0.7, 1.1)
1.37 ⫾ 0.08
105 ⫾ 6
62 ⫾ 7
0.71 ⫾ 0.08
164 ⫾ 8
4.26 ⫾ 0.22
57 ⫾ 4
1.47 ⫾ 0.09
95 ⫾ 7
2.46 ⫾ 0.18
26 ⫾ 2
0.92 ⫾ 0.08
0.6 ⫾ 0.1
0.020 ⫾ 0.004
144 ⫾ 11
529 ⫾ 40
3.63 ⫾ 1.49
11.5 ⫾ 4.7
5⫾1
7.88 ⫾ 1.26
70 ⫾ 11
70 (29, 111)
193 (81, 305)
90 (88, 139)
11.8 (11.5, 18.2)
1822 ⫾ 119
66 ⫾ 4
61 ⫾ 2
29.8 ⫾ 1.2
79 ⫾ 3
46 ⫾ 1
17.8 ⫾ 0.5
41 ⫾ 1
3.5 (2.5, 4.4)
24 (18, 30)
92 ⫾ 1
5.09 ⫾ 0.07
116 ⫾ 4
6.42 ⫾ 0.24
0.7 (0.5, 1.0)
1.31 ⫾ 0.05
100 ⫾ 4
94 ⫾ 8
1.06 ⫾ 0.09
197 ⫾ 6
5.10 ⫾ 0.15
66 ⫾ 3
1.71 ⫾ 0.09
113 ⫾ 5
2.93 ⫾ 0.12
21 ⫾ 3
0.71 ⫾ 0.11
0.4 ⫾ 0.1
0.015 ⫾ 0.002
84 ⫾ 6
311 ⫾ 21
0.16 ⫾ 0.04
0.5 ⫾ 0.1
71 ⫾ 4
4.71 ⫾ 0.44
42 ⫾ 4
129 (107, 144)
356 (295, 398)
66 (61, 87)
8.7 (8.0, 11.4)
1773 ⫾ 85
64 ⫾ 3
P Value
⬍.01
.96
.83
.45
.12
.19
.25
.10
.14
.38
.47
.01
⬍.01
.10
.04
.23
.26
⬍.01
⬍.01
⬍.01
⬍.01
⬍.01
⬍.01
.74
Abbreviation: HOMA-IR, homeostasis model assessment of insulin resistance. Values are mean ⫾ SEM or median (quartiles) for normally
distributed and skewed data sets, respectively.
doi: 10.1210/jc.2013-2835
(33). Subjects randomized to the progesterone group applied
micronized progesterone (100 mg/d) by using a vaginal insert
(Endometrin; Ferring Pharmaceuticals Inc) for 14 days followed
by a 14-day period without treatment. The 14-day treatment
period was repeated two more times with a 14-day no-treatment
period in between. This regimen was expected to raise (during the
active drug delivery phase) plasma progesterone to concentrations similar to those in premenopausal women during the luteal
phase of the menstrual cycle (34).
Subjects in the control group repeated the protein metabolism
study after 46 ⫾ 7 days (four subjects in the control group completed their second study 31–38 days after their baseline study,
one completed it after 56 days, and another after 78 days); subjects randomized to the treatment groups repeated the protein
metabolism study on the day after the last dose of T (d 22 after
start of treatment) or progesterone (d 71 after start of the treatment) administration or the day after removal of the last estradiol
patch (d 71 after start of the treatment), respectively. All subjects
were instructed to continue their normal diet and exercise habits
and to maintain their body weight during the intervention. Compliance with the interventions was confirmed by regular phone
interviews and pill count at the end of the study.
Sample collection, processing, and analyses
Blood samples were collected in chilled tubes containing either heparin (to determine glucose and insulin concentrations) or
EDTA (all other analyses). Samples were placed in ice and plasma
was separated by centrifugation within 30 minutes of collection
and then stored at ⫺80°C until final analyses. Muscle samples
were rinsed in ice-cold saline immediately after collection,
cleared of visible fat and connective tissue, frozen in liquid nitrogen, and stored at ⫺80°C until final analysis.
Plasma glucose concentration was determined on an automated glucose analyzer (Yellow Spring Instruments Co). Serum
total and bioavailable T concentrations were determined at the
Mayo Medical Laboratories. The bioavailable T concentration
in serum was determined by adding known amounts of tritiumlabeled T to the serum, precipitating the SHBG-bound fraction
with ammonium sulfate and measuring the radioactivity of the
supernatant as described by Wheeler (35). Total T concentration
was determined by using liquid chromatography-tandem mass
spectrometry as described by Wang et al (36). Commercially
available ELISAs were used to measure insulin (EMD Millipore),
FSH, SHBG, estrone (E1), 17␤-estradiol (E2), progesterone, cortisol (all from IBL-America Inc), IGF-I and IGF-binding protein
3 (IGF-BP3) (R&D Systems Inc). Plasma concentrations of triacylglycerol, cholesterol (total), high-density lipoprotein (HDL)cholesterol, and low-density lipoprotein (LDL)-cholesterol were
measured in the Washington University Core Laboratory for
Clinical Studies by using a Hitachi 917 autoanalyzer.
Plasma leucine concentration and enrichment were determined by using gas chromatography-mass spectrometry (MSD
5973 system; Hewlett-Packard); after adding a known amount
of nor-leucine to aliquots of each plasma sample, plasma proteins were precipitated, and the supernatant, containing free
amino acids, was collected to prepare the t-butyldimethylsilyl
derivatives of leucine and nor-leucine (37). To determine leucine
labeling in muscle proteins and in tissue fluid, samples (⬃20 mg)
were homogenized in 1 mL trichloroacetic acid solution [3%
(wt/vol)], proteins were precipitated by centrifugation, and the
supernatant, containing free amino acids was collected. The pel-
jcem.endojournals.org
259
let containing muscle proteins was washed and then hydrolyzed
in 6 N HCl at 110°C for 24 hours. Amino acids in the protein
hydrolysate and supernatant samples were purified on cationexchange columns (Dowex 50W-X8 –200; Bio-Rad Laboratories). The t-butyldimethylsilyl derivative was prepared for the
analysis of muscle free leucine and the N-heptafluorobutyryl
n-propyl ester for the analysis of leucine in muscle proteins to
determine their TTR by electron impact and chemical ionization
gas chromatography-mass spectrometry (MSD 5973 system)
analysis, respectively (6, 38). The extent of leucine labeling in
plasma, muscle tissue fluid, and muscle protein was calculated
based on the simultaneously measured TTR of standards of
known isotope labeling.
MYOD1, MSTN, FST, and FOXO3 gene expression in muscle was evaluated by using real-time PCR. Total RNA was isolated from frozen muscle biopsy samples in Trizol reagent (Invitrogen), quantified spectrophotometrically (NanoDrop 1000;
Thermo Scientific) and reverse transcribed (high capacity cDNA
reverse transcription kit; Invitrogen). Gene expression was determined on an ABI 7500 real-time PCR system (Invitrogen) by
using the SYBR Green master mix (Invitrogen) and the following primer sequences: MYOD1, forward, CGCCATCCGCTATATCGAGG, reverse, CTGTAGTCCATCATGCCGTCG;
MSTN, forward, TCCTCAGTAAACTTCGTCTGGA, reverse,
CTGCTGTCATCCCTCTGGA; FST, forward, ACGTGTGAGAACGTGGACTG, reverse, CACATTCATTGCGGTAGGTTTTC; and FOXO3, forward, CGGACAAACGGCTCACTCT, reverse, GGACCCGCATGAATCGACTAT. The
expression of each gene of interest was normalized against the
threshold cycle value for the GAPDH gene (forward, TTGCCATCAATGACCCCTTCA, reverse, CGCCCCACTTGATT
TTGGA) because it has been reported that GAPDH is a valid
housekeeping gene across a wide age range in human skeletal
muscle (39, 40). To ascertain the validity of GAPDH as a housekeeping gene in our hormone interventions, we also compared
the expression of our genes of interest against ␤-actin (ACTB,
forward, CATGTACGTTGCTATCCAGGC, reverse, CTCCTTAATGTCACGCACGAT) and the results were the same (data
not shown).
Calculations
The fractional synthesis rate (FSR) of mixed muscle protein
was calculated from the rate of incorporation of [2H3]leucine
Figure 1. Skeletal muscle protein FSR during basal, postabsorptive
conditions in pre- and postmenopausal women. Data are mean ⫾
SEM. *, Value significantly different from value in premenopausal
women (P ⬍ .05).
260
Smith et al
Sex Hormones and Muscle Protein Synthesis
into muscle protein, using a standard precursor-product model
as follows: FSR ⫽ ⌬Ep/Eic ⫻ 1/t ⫻ 100; where ⌬Ep is the change
between two consecutive biopsies in extent of labeling (TTR) of
protein-bound leucine. Eic is the mean labeling over time of the
precursor for protein synthesis, and t is the time between biopsies. The free leucine labeling in muscle tissue fluid was chosen to
represent the immediate precursor for muscle protein synthesis
(ie, aminoacyl-t-RNA) (41). The homeostasis model assessment
of insulin resistance score was calculated as the product of
plasma insulin (microunits per milliliter⫺1) and glucose (millimoles per liter⫺1) concentrations divided by 22.5 (42).
Statistical analyses
All data sets were tested for normality by using the Kolmogorov-Smirnov test. Differences between pre- and postmenopausal women were evaluated by using a Student’s t test for
independent samples (for normally distributed data) or a MannWhitney U test (for skewed data sets). A repeated-measures
ANOVA and a Tukey’s post hoc procedure were used to evaluate
the significance of hormone treatment-induced changes in
plasma substrate and hormone concentrations and the muscle
protein FSR. Skewed data sets were log transformed for
ANOVA. Statistical contrasts focused on treatment vs control
comparisons. A Kruskal-Wallis one-way ANOVA and a Bonferroni-corrected Mann-Whitney U post hoc analyses were used
to evaluate differences in gene expression between the control
and individual treatment groups. The potential impact of time
J Clin Endocrinol Metab, January 2014, 99(1):256 –265
between studies on the change in muscle protein FSR in the control group was assessed by using the Pearson product-moment
correlation coefficient.
A value of P ⱕ .05 was considered statistically significant.
Data in the text are presented as means ⫾ SEM; data in tables and
figures are expressed as indicated in the legends. All analyses
were carried out with SPSS version 20 for Windows (IBM).
Results
Pre- vs postmenopausal women
Pre- and postmenopausal women were well matched on
total body mass, body mass index, body composition, and
insulin sensitivity (Table 1). However, postmenopausal
women were older (as expected) and had a somewhat
worse plasma lipid profile than premenopausal women
(Table 1). Total and bioavailable plasma T, leucine, and
IGF-BP3 concentrations were not different in pre- and
postmenopausal women, whereas plasma progesterone,
estrogen, IGF-I, and SHBG concentrations were significantly lower and FSH and cortisol concentrations were
greater in post- compared with premenopausal women (all
P ⬍ .01; Table 1). The muscle protein FSR was approximately 20% greater (P ⫽ .02; Figure
1) and MYOD1, FST, and FOXO3
mRNA expressions were approximately 40%–90% greater (P ⬍ .05; Figure 2) in postmenopausal than premenopausal women. MSTN mRNA
expression was not different in premenopausal and postmenopausal
women (Figure 2).
Figure 2. Skeletal muscle MYOD1, FST, MSTN, and FOXO3 gene expression (relative to GAPDH)
during basal, postabsorptive conditions in pre- and postmenopausal women. Data are median
(central horizontal line), 25th and 75th percentiles (box), and minimum and maximum values
(vertical lines). *, Value significantly different from corresponding value in premenopausal
women (P ⬍ .05).
Effect of hormone treatments in
postmenopausal women
Plasma substrate and hormone
concentrations were unchanged in
the control group (Table 2). In the T
and progesterone groups, plasma T
and progesterone concentrations, respectively, were significantly greater
the day after the final treatment
dose than before treatment, whereas
plasma substrate and hormone concentrations were unaffected by the
hormone treatments (Table 2). In the
estradiol group, plasma estrogen
concentration was significantly elevated 12 hours after the patch removal, and plasma triacylglycerol
concentration was reduced by approximately 20% compared with
doi: 10.1210/jc.2013-2835
jcem.endojournals.org
261
Table 2. Plasma Substrate and Hormone Concentrations in Postmenopausal Women Before and After Treatment
With T, Estradiol, or Progesterone or No Intervention (Control)
Control
Glucose, mg/dL
Glucose, mM
Insulin, mU/L
Insulin, pM
Leucine, mg/dL
Leucine, ␮M
Triacylglyerol, mg/dL
Triacylglyerol, mM
Total cholesterol, mg/dL
Total cholesterol, mM
HDL-cholesterol, mg/dL
HDL-cholesterol, mM
LDL-cholesterol, mg/dL
LDL-cholesterol, mM
Total T, ng/dL
Total T, nM
Bioavailable T, ng/dl
Bioavailable T, nM
E1 ⫹ E2, pg/mL
E1 ⫹ E2, pM
Progesterone, ng/mL
Progesterone, nM
SHBG, mg/L
SHBG, nM
Cortisol, ng/mL
Cortisol, nM
IGF-I, ng/mL
IGF-I, nM
IGF-BP3, ng/mL
IGF-BP3, nM
T
Estradiol
Progesterone
Before
After
Before
After
Before
After
Before
After
97 ⫾ 3
5.36 ⫾ 0.19
3.1 (2.6, 4.3)
22 (18, 30)
1.30 ⫾ 0.10
99 ⫾ 7
102 ⫾ 14
1.15 ⫾ 0.15
187 ⫾ 6
4.83 ⫾ 0.15
64 ⫾ 5
1.66 ⫾ 0.13
102 ⫾ 6
2.65 ⫾ 0.15
16 ⫾ 3
0.55 ⫾ 0.10
0.3 ⫾ 0.1
0.011 ⫾ 0.001
82 ⫾ 5
304 ⫾ 19
0.17 ⫾ 0.07
0.55 ⫾ 0.21
5.62 ⫾ 1.02
50 ⫾ 9
129 ⫾ 17
355 ⫾ 48
84 ⫾ 9
11.0 ⫾ 1.1
1883 ⫾ 164
68 ⫾ 6
94 ⫾ 3
5.21 ⫾ 0.17
3.3 (2.8, 4.1)
23 (19, 28)
1.27 ⫾ 0.07
97 ⫾ 5
86 ⫾ 15
0.98 ⫾ 0.17
181 ⫾ 6
4.68 ⫾ 0.16
66 ⫾ 4
1.70 ⫾ 0.11
98 ⫾ 5
2.53 ⫾ 0.14
16 ⫾ 3
0.56 ⫾ 0.12
0.4 ⫾ 0.1
0.013 ⫾ 0.003
92 ⫾ 14
339 ⫾ 53
0.19 ⫾ 0.05
0.62 ⫾ 0.17
5.27 ⫾ 0.80
47 ⫾ 7
110 ⫾ 18
303 ⫾ 49
80 ⫾ 8
10.5 ⫾ 1.0
1873 ⫾ 152
67 ⫾ 5
92 ⫾ 2
5.11 ⫾ 0.11
2.8 (1.6, 4.2)
19 (11, 29)
1.32 ⫾ 0.13
101 ⫾ 10
73 ⫾ 5
0.82 ⫾ 0.06
198 ⫾ 13
5.14 ⫾ 0.33
70 ⫾ 8
1.81 ⫾ 0.20
114 ⫾ 11
2.95 ⫾ 0.28
21 ⫾ 6
0.74 ⫾ 0.20
0.5 ⫾ 0.1
0.016 ⫾ 0.005
91 ⫾ 17
337 ⫾ 62
0.12 ⫾ 0.03
0.38 ⫾ 0.08
4.40 ⫾ 0.67
39 ⫾ 6
137 ⫾ 13
378 ⫾ 37
72 ⫾ 11
9.4 ⫾ 1.5
1856 ⫾ 173
67 ⫾ 6
91 ⫾ 1
5.07 ⫾ 0.08
3.2 (2.1, 3.9)
22 (15, 27)
1.38 ⫾ 0.16
105 ⫾ 12
82 ⫾ 8
0.93 ⫾ 0.09
195 ⫾ 11
5.06 ⫾ 0.28
64 ⫾ 5
1.65 ⫾ 0.13
115 ⫾ 10
2.98 ⫾ 0.25
241 ⫾ 78a
8.36 ⫾ 2.70a
6.7 ⫾ 2.3a
0.232 ⫾ 0.080a
89 ⫾ 13
327 ⫾ 48
0.13 ⫾ 0.03
0.43 ⫾ 0.08
4.41 ⫾ 0.59
39 ⫾ 5
165 ⫾ 17
456 ⫾ 48
72 ⫾ 15
9.4 ⫾ 2.0
1898 ⫾ 121
68 ⫾ 4
96 ⫾ 4
5.33 ⫾ 0.24
4.0 (3.0, 5.6)
28 (21, 39)
1.22 ⫾ 0.05
93 ⫾ 4
132 ⫾ 22
1.49 ⫾ 0.25
180 ⫾ 15
4.66 ⫾ 0.40
53 ⫾ 7
1.38 ⫾ 0.18
100 ⫾ 12
2.60 ⫾ 0.31
24 ⫾ 11
0.82 ⫾ 0.37
0.5 ⫾ 0.2
0.017 ⫾ 0.007
88 ⫾ 12
323 ⫾ 43
0.08 ⫾ 0.03
0.25 ⫾ 0.08
3.93 ⫾ 0.66
35 ⫾ 6
104 ⫾ 18
286 ⫾ 51
79 ⫾ 6
10.4 ⫾ 0.8
1703 ⫾ 168
61 ⫾ 6
95 ⫾ 3
5.28 ⫾ 0.15
3.3 (2.7, 4.5)
23 (19, 31)
1.25 ⫾ 0.07
95 ⫾ 6
108 ⫾ 19a
1.22 ⫾ 0.22a
180 ⫾ 12
4.67 ⫾ 0.31
54 ⫾ 6
1.40 ⫾ 0.17
105 ⫾ 8
2.72 ⫾ 0.21
23 ⫾ 8
0.79 ⫾ 0.27
0.4 ⫾ 0.1
0.014 ⫾ 0.004
114 ⫾ 18a
422 ⫾ 66a
0.09 ⫾ 0.03
0.27 ⫾ 0.09
5.51 ⫾ 1.27
49 ⫾ 11
141 ⫾ 12
388 ⫾ 33
71 ⫾ 8
9.3 ⫾ 1.1
1476 ⫾ 146
53 ⫾ 5
93 ⫾ 2
5.17 ⫾ 0.12
3.2 (2.7, 3.6)
22 (19, 25)
1.40 ⫾ 0.10
106 ⫾ 7
95 ⫾ 16
1.07 ⫾ 0.18
192 ⫾ 8
4.96 ⫾ 0.21
65 ⫾ 8
1.68 ⫾ 0.21
113 ⫾ 7
2.91 ⫾ 0.18
22 ⫾ 5
0.75 ⫾ 0.17
0.5 ⫾ 0.1
0.017 ⫾ 0.004
77 ⫾ 11
283 ⫾ 41
0.25 ⫾ 0.12
0.79 ⫾ 0.39
4.87 ⫾ 1.13
43 ⫾ 10
160 ⫾ 27
443 ⫾ 75
61 ⫾ 3
8.0 ⫾ 0.4
1651 ⫾ 200
59 ⫾ 7
95 ⫾ 2
5.27 ⫾ 0.11
4.0 (2.8, 4.9)
27 (19, 34)
1.43 ⫾ 0.09
109 ⫾ 7
105 ⫾ 23
1.19 ⫾ 0.26
188 ⫾ 9
4.86 ⫾ 0.24
54 ⫾ 6
1.39 ⫾ 0.16
112 ⫾ 8
2.91 ⫾ 0.20
22 ⫾ 5
0.77 ⫾ 0.17
0.4 ⫾ 0.1
0.014 ⫾ 0.004
92 ⫾ 23
340 ⫾ 84
1.16 ⫾ 0.42a
3.68 ⫾ 1.34a
5.00 ⫾ 1.00
44 ⫾ 9
135 ⫾ 21
371 ⫾ 58
72 ⫾ 10
9.4 ⫾ 1.3
1428 ⫾ 148
51 ⫾ 5
Data are expressed as mean ⫾ SEM or median (quartiles) for normally distributed and skewed data sets, respectively, after values were obtained
12 hours after the last dose of T or progesterone administration or removal of the last estradiol patch (see text for details).
a
Value significantly different (P ⬍ .05) from corresponding preintervention value.
pretreatment values (both P ⬍ .05; Table 2).
The average muscle protein FSR was unchanged in the
control group (Figure 3), and the time between the two
studies (31–78 d) did not correlate with the change in
muscle protein FSR (r ⫽ 0.06, P ⫽ .91). Estradiol treatment did not affect the muscle protein FSR, whereas both
T and progesterone treatment increased it by approximately 50% (both P ⬍ .01; Figure 3). T and estradiol
treatment had no effect on skeletal muscle MYOD1,
MSTN, FST, and FOXO3 mRNA expression; progesterone treatment significantly increased MYOD1 mRNA expression (P ⬍ .05) but had no effect on MSTN, FST, and
FOXO3 mRNA expression (Figure 4).
Discussion
Our study confirms previous observations by our own and
other research groups concerning the anabolic effect of T
(3–7) and an age-related up-regulation of both stimulatory and inhibitory muscle growth regulatory genes and
accelerated basal muscle protein turnover in women (14,
43, 44), which might be indicative of increased skeletal
muscle remodeling in post- compared with premenopausal women. In addition, it provides several novel find-
ings regarding female sex hormone action on muscle protein metabolism. We have demonstrated that estradiol has
no effect on muscle protein synthesis or the expression of
genes involved in the regulation of muscle mass, whereas
progesterone has potent stimulatory effects on muscle protein synthesis and MYOD1 mRNA expression. It is therefore unlikely that the greater rate of muscle protein synthesis and overexpression of muscle growth-regulatory
genes in older, postmenopausal compared with younger,
premenopausal women in the present and other studies
(14, 43, 44) are due solely to age- and menopause-associated changes in the plasma sex steroid milieu.
The lack of effect of estradiol on muscle growth-regulatory gene expression in our study is consistent with the
results from studies conducted in rodents. Several studies
have demonstrated that estradiol has no effect on basal
muscle growth-stimulatory factor expression in ovariectomized female and orchidetcomized male mice and rats
(45– 49). However, estradiol treatment augments muscle
MYOD1 expression during recovery from muscle injury
in ovariectomized rats (45, 46, 49) and prevents the orchidetcomy-induced decrease in FBXO32 expression
(47). Similar studies evaluating the effect of progesterone
have, to our knowledge, not been performed. The results
262
Smith et al
Sex Hormones and Muscle Protein Synthesis
Figure 3. Skeletal muscle protein FSR in postmenopausal women
during basal, postabsorptive conditions before and after no
intervention (control) or treatment with T, estradiol, or progesterone
(top) and the treatment-induced changes in FSR in each group
(bottom). Data are mean ⫾ SEM. *, Value significantly different from
corresponding value before treatment (P ⬍ .05); †, value significantly
different from corresponding value in the control group (P ⬍ .05).
from previous studies concerning the effects of female sex
steroids on muscle protein turnover are inconsistent. A
study conducted in ovariectomized rats demonstrated that
progesterone and estradiol suppress the rate of muscle
protein synthesis (13), whereas a study conducted in growing steer found that estradiol increases the rate of muscle
protein synthesis (50). The results from earlier studies conducted in postmenopausal women suggest that the basal
rate of muscle protein synthesis is less in women who received estrogen replacement therapy after hysterectomy
compared with age-matched postmenopausal women (15)
and less in women who use oral, combination birth control preparations than those who do not (16).
The interpretation of these results, however, is complicated by the following: 1) the overiectomy-induced
changes in physical activity and body weight in rats (51,
52), 2) the fact that muscle protein synthesis was not directly measured (but estimated based on indirect measures
of the muscle protein breakdown rate and net muscle protein mass changes) in growing steer (50), 3) the crosssectional nature of the human studies, and 4) the effect of
orally delivered sex steroids on anabolic and catabolic
plasma hormone (eg, IGF-I, T, and cortisol) concentrations (20 –22). We, in contrast, used a longitudinal, randomized, controlled study design and carefully selected
our treatments to mimic as closely as possible normal
physiological conditions; ie, we chose to provide 17␤-es-
J Clin Endocrinol Metab, January 2014, 99(1):256 –265
tradiol and micronized progesterone in replacement doses
and delivered them to tissues through the systemic circulation to avoid these confounding influences; in fact, none
of our hormone treatments affected the concentrations of
insulin, IGF-I, IGF-BP3, or cortisol or resulted in nonspecific sex hormone concentration changes.
The mechanism(s) responsible for the progesterone-induced increase in muscle protein synthesis are unclear.
However, our data suggest that the mechanism(s) responsible for the anabolic effect of progesterone is different
from that of T and therefore most likely the result of progesterone receptor rather than androgen receptor activation, which is consistent with the results from studies performed on rodent cardiac muscle (53) demonstrating that
blocking the progesterone receptor also blocks the stimulatory effect of progesterone on cardiac muscle protein
synthesis. Progesterone treatment induced a significant increase in MYOD1 mRNA expression, whereas congruent
with the results from studies conducted by other investigators (54, 55), T did not affect MYOD1 or MSTN mRNA
expression. Increased progesterone-induced MYOD1 expression suggests increased satellite cell activation may
play a role in this observation.
It is unlikely that the lack of an effect of estradiol was
due to lack of compliance or insufficient dosing. We chose
a dosing regimen that raises plasma estrogen to concentrations comparable with those in young healthy women
during the mid- to late-follicular phase of the menstrual
cycle (33), and plasma estrogen concentration was still
significantly increased 12 hours after patch removal in our
subjects. Furthermore, transdermal estradiol treatment
produced the well-known hypotriglyceridemic effect in
our women (56). It is also unlikely that the duration of
estradiol treatment in the present study was too short to
have an effect on the rate of muscle protein synthesis.
Both estradiol and progesterone were given for the same
amount of time, and progesterone increased the rate of
muscle protein synthesis. Furthermore, T and other
known anabolic steroids (4, 5, 57, 58) have been shown to
increase the rate of muscle protein synthesis within 5–28
days of treatment. It is conceivable (although we consider
it unlikely) that our study was underpowered to detect a
change in muscle protein FSR after estradiol treatment. In
fact, the pre- and posttreatment difference in muscle protein FSR in the estradiol group was so small (0.0003% ⫾
0.011%/h) that we would have needed more than 50 000
subjects to detect it with a sufficiently small probability of
type I error (␣ ⬍ .05) and sufficient power (ⱖ .80) to reject
the null hypothesis. Thus, we conclude that even if estradiol did affect muscle protein synthesis but we were not
able to detect it, the effect was likely to be negligible. We
recognize the limitations of our study and the fact that we
doi: 10.1210/jc.2013-2835
jcem.endojournals.org
263
that reports muscle protein breakdown rates in old compared with
young women. However, we (present study) and others (44) have observed
an
age-related
upregulation of catabolic genes (ie,
FOXO3 and MuRF1 mRNA expression) in muscle that supports this
concept and helps explain the ageassociated loss of muscle mass in the
face of an increased muscle protein
synthesis rate. Furthermore, the concomitant up-regulation of both muscle protein synthesis and breakdown
in old compared with young women
might further be indicative of increased skeletal muscle remodeling
in post- compared with premenopausal women.
Figure 4. Sex hormone treatment-induced changes in muscle MYOD1, FST, MSTN, and FOXO3
gene expression (relative to the average prepost change in the control group) in postmenopausal
In summary, we report an upwomen. Data are median (central horizontal line), 25th and 75th percentiles (box), and minimum
regulation of both stimulatory and
and maximum values (vertical lines). *, Significantly different from corresponding value in the
inhibitory muscle growth regulatory
control group (P ⬍ .05).
genes and a faster muscle protein
FSR in older, postmenopausal comare not able to determine whether larger, pharmacological
pared with carefully matched, younger, premenopausal
doses of estradiol, or more prolonged treatment, or estrawomen. These age-related differences in basal muscle prodiol and progesterone combination therapy would result
tein turnover in women do not appear to be explained by
in different outcomes; we will attempt to answer these
the age- and menopause-related changes in the plasma sex
questions in future studies.
We did not measure muscle protein breakdown rates or hormone milieu because we found that both testosterone
changes in muscle mass in response to the different sex (21 d of continuous delivery) and progesterone replacehormone treatments in this study. Therefore, we are un- ment (given for the equivalent of approximately three
able to tell whether the progesterone-induced increase in menstrual cycles) stimulate muscle protein synthesis,
muscle protein synthesis will ultimately result in net mus- whereas estradiol replacement (given for the equivalent
cle protein gain and increased muscle mass or whether the amount of time) does not affect the rate of muscle protein
lack of an effect of transdermally delivered estradiol on synthesis. The exact mechanisms by which progesterone
muscle protein synthesis rules out this treatment as a stimulates muscle protein turnover remain to be elucipotential muscle net growth agent in postmenopausal dated but may be related to increased satellite cell activawomen. To our knowledge, only two studies have evalu- tion as suggested by the increased MYOD1 expression.
ated the effect of transdermal estradiol therapy on lean
body (but not muscle) mass. One reported no estradiolinduced change in lean body mass (55) and the other re- Acknowledgments
ported an increase (56) but lacked a placebo control group
to rigorously judge the effect. Therefore, the effect of sys- We thank Sophie Julliand for help in subject recruitment,
temically delivered estradiol on muscle mass remains un- Dr Adewole Okunade and Jennifer Shew for their technical
known. We are not aware of any study that evaluated the assistance, the staff of the Clinical Research Unit for their help
effect of progesterone on muscle mass. On the other hand, in performing the studies, and the study subjects for their
participation.
our data from young, premenopausal vs older, postmenoThis study was registered in clinicaltrials.gov as trial number
pausal women (greater synthesis rate in old compared
NCT00805207.
with young women) and the well-established decline in
muscle mass with aging (59 – 61) indicate that older
Address all correspondence and requests for reprints to:
women must (by deduction) also have an increased rate of Bettina Mittendorfer, PhD, Division of Geriatrics and Nutrimuscle protein breakdown. We are not aware of any study tional Science, Washington University School of Medicine, 660
264
Smith et al
Sex Hormones and Muscle Protein Synthesis
South Euclid Avenue, Campus Box 8031, Saint Louis, MO
63110. E-mail: [email protected].
This work was supported by National Institutes of Health
Grants HD 57796, DK 94483, RR024994, and DK 56341 (to
the Nutrition and Obesity Research Center), Grant RR024992
(to the Washington University School of Medicine Clinical
Translational Science Award) and Grant RR-00954 (to the Biomedical Mass Spectrometry Resource).
Disclosure Summary: The authors have nothing to disclose.
J Clin Endocrinol Metab, January 2014, 99(1):256 –265
17.
18.
19.
20.
References
1. Forbes GB, Reina JC. Adult lean body mass declines with age: some
longitudinal observations. Metabolism. 1970;19:653– 663.
2. Lee SJ, Janssen I, Heymsfield SB, Ross R. Relation between wholebody and regional measures of human skeletal muscle. Am J Clin
Nutr. 2004;80:1215–1221.
3. Griggs RC, Halliday D, Kingston W, Moxley RT 3rd. Effect of
testosterone on muscle protein synthesis in myotonic dystrophy.
Ann Neurol. 1986;20:590 –596.
4. Urban RJ, Bodenburg YH, Gilkison C, et al. Testosterone administration to elderly men increases skeletal muscle strength and protein synthesis. Am J Physiol. 1995;269:E820 –E826.
5. Ferrando AA, Tipton KD, Doyle D, Phillips SM, Cortiella J, Wolfe
RR. Testosterone injection stimulates net protein synthesis but not
tissue amino acid transport. Am J Physiol. 1998;275:E864 –E871.
6. Wang X, Smith GI, Patterson BW, Reeds DN, Kampelman J, Magkos F, Mittendorfer B. Testosterone increases the muscle protein
synthesis rate but does not affect very-low-density lipoprotein metabolism in obese premenopausal women. Am J Physiol Endocrinol
Metab. 2012;302:E740 –E746.
7. Griggs RC, Kingston W, Jozefowicz RF, Herr BE, Forbes G, Halliday D. Effect of testosterone on muscle mass and muscle protein
synthesis. J Appl Physiol. 1989;66:498 –503.
8. Isidori AM, Giannetta E, Greco EA, et al. Effects of testosterone on
body composition, bone metabolism and serum lipid profile in middle-aged men: a meta-analysis. Clin Endocrinol (Oxf). 2005;63:
280 –293.
9. Wittert GA, Chapman IM, Haren MT, Mackintosh S, Coates P,
Morley JE. Oral testosterone supplementation increases muscle and
decreases fat mass in healthy elderly males with low-normal gonadal
status. J Gerontol A Biol Sci Med Sci. 2003;58:618 – 625.
10. Snyder PJ, Peachey H, Berlin JA, et al. Effects of testosterone replacement in hypogonadal men. J Clin Endocrinol Metab. 2000;
85:2670 –2677.
11. Wang C, Cunningham G, Dobs A, et al. Long-term testosterone gel
(AndroGel) treatment maintains beneficial effects on sexual function and mood, lean and fat mass, and bone mineral density in
hypogonadal men. J Clin Endocrinol Metab. 2004;89:2085–2098.
12. Loomba-Albrecht LA, Styne DM. Effect of puberty on body composition. Curr Opin Endocrinol Diabetes Obes. 2009;16:10 –15.
13. Toth MJ, Poehlman ET, Matthews DE, Tchernof A, MacCoss MJ.
Effects of estradiol and progesterone on body composition, protein
synthesis, and lipoprotein lipase in rats. Am J Physiol Endocrinol
Metab. 2001;280:E496 –E501.
14. Smith GI, Reeds DN, Hall AM, Chambers KT, Finck BN, Mittendorfer B. Sexually dimorphic effect of aging on skeletal muscle protein synthesis. Biol Sex Differ. 2012;3:11.
15. Hansen M, Skovgaard D, Reitelseder S, Holm L, Langbjerg H, Kjaer
M. Effects of estrogen replacement and lower androgen status on
skeletal muscle collagen and myofibrillar protein synthesis in postmenopausal women. J Gerontol A Biol Sci Med Sci. 2012;67:1005–
1013.
16. Hansen M, Langberg H, Holm L, et al. Effect of administration of
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
oral contraceptives on the synthesis and breakdown of myofibrillar
proteins in young women. Scand J Med Sci Sports. 2011;21:62–72.
Chevalier S, Goulet ED, Burgos SA, Wykes LJ, Morais JA. Protein
anabolic responses to a fed steady state in healthy aging. J Gerontol
A Biol Sci Med Sci. 2011;66:681– 688.
Miller BF, Hansen M, Olesen JL, et al. No effect of menstrual cycle
on myofibrillar and connective tissue protein synthesis in contracting skeletal muscle. Am J Physiol Endocrinol Metab. 2006;290:
E163–E168.
Guillet C, Masgrau A, Boirie Y. Is protein metabolism changed with
obesity? Curr Opin Clin Nutr Metab Care. 2011;14:89 –92.
Qureshi AC, Bahri A, Breen LA, Barnes SC, Powrie JK, Thomas SM,
Carroll PV. The influence of the route of oestrogen administration
on serum levels of cortisol-binding globulin and total cortisol. Clin
Endocrinol (Oxf). 2007;66:632– 635.
Sonnet E, Lacut K, Roudaut N, Mottier D, Kerlan V, Oger E. Effects
of the route of oestrogen administration on IGF-1 and IGFBP-3 in
healthy postmenopausal women: results from a randomized placebo-controlled study. Clin Endocrinol (Oxf). 2007;66:626 – 631.
Shifren JL, Desindes S, McIlwain M, Doros G, Mazer NA. A randomized, open-label, crossover study comparing the effects of oral
versus transdermal estrogen therapy on serum androgens, thyroid
hormones, and adrenal hormones in naturally menopausal women.
Menopause. 2007;14:985–994.
Legerlotz K, Smith HK. Role of MyoD in denervated, disused, and
exercised muscle. Muscle Nerve. 2008;38:1087–1100.
Amirouche A, Durieux AC, Banzet S, et al. Down-regulation of
Akt/mammalian target of rapamycin signaling pathway in response
to myostatin overexpression in skeletal muscle. Endocrinology.
2009;150:286 –294.
Welle S, Bhatt K, Pinkert CA. Myofibrillar protein synthesis in myostatin-deficient mice. Am J Physiol Endocrinol Metab. 2006;290:
E409 –E415.
Welle S, Burgess K, Mehta S. Stimulation of skeletal muscle myofibrillar protein synthesis, p70 S6 kinase phosphorylation, and ribosomal protein S6 phosphorylation by inhibition of myostatin in
mature mice. Am J Physiol Endocrinol Metab. 2009;296:E567–
E572.
Haidet AM, Rizo L, Handy C, et al. Long-term enhancement of
skeletal muscle mass and strength by single gene administration of
myostatin inhibitors. Proc Natl Acad Sci USA. 2008;105:4318 –
4322.
Lee SJ, McPherron AC. Regulation of myostatin activity and muscle
growth. Proc Natl Acad Sci USA. 2001;98:9306 –9311.
Sandri M, Sandri C, Gilbert A, et al. Foxo transcription factors
induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell. 2004;117:399 – 412.
Phelan N, O’Connor A, Kyaw-Tun T, et al. Lipoprotein subclass
patterns in women with polycystic ovary syndrome (PCOS) compared with equally insulin-resistant women without PCOS. J Clin
Endocrinol Metab. 2010;95:3933–3939.
Valkenburg O, Steegers-Theunissen RP, Smedts HP, et al. A more
atherogenic serum lipoprotein profile is present in women with polycystic ovary syndrome: a case-control study. J Clin Endocrinol
Metab. 2008;93:470 – 476.
Goncharov NP, Katsya GV, Chagina NA, Gooren LJ. Testosterone
and obesity in men under the age of 40 years. Andrologia. 2009;
41:76 – 83.
Harrison LL, Harari D. An evaluation of bioequivalence of two
7-day 17␤-estradiol transdermal delivery systems by anatomical
site. J Clin Pharmacol. 2002;42:1134 –1141.
Levy T, Gurevitch S, Bar-Hava I, et al. Pharmacokinetics of natural
progesterone administered in the form of a vaginal tablet. Hum
Reprod. 1999;14:606 – 610.
Wheeler MJ. The determination of bio-available testosterone. Ann
Clin Biochem. 1995;32(Pt 4):345–357.
Wang C, Catlin DH, Demers LM, Starcevic B, Swerdloff RS. Measurement of total serum testosterone in adult men: comparison of
doi: 10.1210/jc.2013-2835
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
current laboratory methods versus liquid chromatography-tandem
mass spectrometry. J Clin Endocrinol Metab. 2004;89:534 –543.
Smith GI, Villareal DT, Mittendorfer B. Measurement of human
mixed muscle protein fractional synthesis rate depends on the choice
of amino acid tracer. Am J Physiol Endocrinol Metab. 2007;293:
E666 –E671.
Patterson BW, Zhang XJ, Chen Y, Klein S, Wolfe RR. Measurement
of very low stable isotope enrichments by gas chromatography/mass
spectrometry: application to measurement of muscle protein synthesis. Metabolism. 1997;46:943–948.
Barber RD, Harmer DW, Coleman RA, Clark BJ. GAPDH as a
housekeeping gene: analysis of GAPDH mRNA expression in a
panel of 72 human tissues. Physiol Genomics. 2005;21:389 –395.
Touchberry CD, Wacker MJ, Richmond SR, Whitman SA, Godard
MP. Age-related changes in relative expression of real-time PCR
housekeeping genes in human skeletal muscle. J Biomol Tech. 2006;
17:157–162.
Watt PW, Lindsay Y, Scrimgeour CM, et al. Isolation of aminoacyltRNA and its labeling with stable-isotope tracers: Use in studies of
human tissue protein synthesis. Proc Natl Acad Sci USA. 1991;88:
5892–5896.
Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF,
Turner RC. Homeostasis model assessment: insulin resistance and
␤-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28:412– 419.
Raue U, Slivka D, Jemiolo B, Hollon C, Trappe S. Myogenic gene
expression at rest and after a bout of resistance exercise in young
(18 –30 yr) and old (80 – 89 yr) women. J Appl Physiol. 2006;101:
53–59.
Raue U, Slivka D, Jemiolo B, Hollon C, Trappe S. Proteolytic gene
expression differs at rest and after resistance exercise between young
and old women. J Gerontol A Biol Sci Med Sci. 2007;62:1407–1412.
Enns DL, Iqbal S, Tiidus PM. Oestrogen receptors mediate oestrogen-induced increases in post-exercise rat skeletal muscle satellite
cells. Acta Physiol (Oxf). 2008;194:81–93.
Velders M, Schleipen B, Fritzemeier KH, Zierau O, Diel P. Selective
estrogen receptor-beta activation stimulates skeletal muscle growth
and regeneration. FASEB J. 2012;26:1909 –1920.
Svensson J, Moverare-Skrtic S, Windahl S, Swanson C, Sjogren K.
Stimulation of both estrogen and androgen receptors maintains skeletal muscle mass in gonadectomized male mice but mainly via different pathways. J Mol Endocrinol. 2010;45:45–57.
Tsai WJ, McCormick KM, Brazeau DA, Brazeau GA. Estrogen effects on skeletal muscle insulin-like growth factor 1 and myostatin
jcem.endojournals.org
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
265
in ovariectomized rats. Exp Biol Med (Maywood). 2007;232:1314 –
1325.
Enns DL, Tiidus PM. Estrogen influences satellite cell activation and
proliferation following downhill running in rats. J Appl Physiol.
2008;104:347–353.
Hayden JM, Bergen WG, Merkel RA. Skeletal muscle protein metabolism and serum growth hormone, insulin, and cortisol concentrations in growing steers implanted with estradiol-17␤, trenbolone
acetate, or estradiol-17␤ plus trenbolone acetate. J Anim Sci. 1992;
70:2109 –2119.
Fonseca H, Powers SK, Goncalves D, Santos A, Mota MP, Duarte
JA. Physical inactivity is a major contributor to ovariectomy-induced sarcopenia. Int J Sports Med. 2012;33:268 –278.
Greising SM, Carey RS, Blackford JE, Dalton LE, Kosir AM, Lowe
DA. Estradiol treatment, physical activity, and muscle function in
ovarian-senescent mice. Exp Gerontol. 2011;46:685– 693.
Goldstein J, Sites CK, Toth MJ. Progesterone stimulates cardiac
muscle protein synthesis via receptor-dependent pathway. Fertil
Steril. 2004;82:430 – 436.
Lewis MI, Fournier M, Storer TW, et al. Skeletal muscle adaptations
to testosterone and resistance training in men with COPD. J Appl
Physiol. 2007;103:1299 –1310.
Kvorning T, Andersen M, Brixen K, Schjerling P, Suetta C, Madsen
K. Suppression of testosterone does not blunt mRNA expression of
myoD, myogenin, IGF, myostatin or androgen receptor post
strength training in humans. J Physiol. 2007;578:579 –593.
Wang X, Magkos F, Mittendorfer B. Sex differences in lipid and
lipoprotein metabolism: it’s not just about sex hormones. J Clin
Endocrinol Metab. 2011;96:885– 893.
Sheffield-Moore M, Paddon-Jones D, Casperson SL, et al. Androgen
therapy induces muscle protein anabolism in older women. J Clin
Endocrinol Metab. 2006;91:3844 –3849.
Sheffield-Moore M, Urban RJ, Wolf SE, et al. Short-term oxandrolone administration stimulates net muscle protein synthesis in
young men. J Clin Endocrinol Metab. 1999;84:2705–2711.
Kyle UG, Genton L, Hans D, Karsegard L, Slosman DO, Pichard C.
Age-related differences in fat-free mass, skeletal muscle, body cell
mass and fat mass between 18 and 94 years. Eur J Clin Nutr. 2001;
55:663– 672.
Gallagher D, Ruts E, Visser M, Baumgartner RN, et al. Weight
stability masks sarcopenia in elderly men and women. Am J Physiol
Endocrinol Metab. 2000;279:E366 –E375.
Kyle UG, Genton L, Slosman DO, Pichard C. Fat-free and fat mass
percentiles in 5225 healthy subjects aged 15 to 98 years. Nutrition.
2001;17:534 –541.