FEMS Microbiology Ecology 15 (1994) 337-350
© 1994 Federation of European Microbiological Societies 0168-6496/94/$07.00
Published by Elsevier
337
FEMSEC 00579
Stability and conjugal transfer kinetics of a TOL
plasmid in Pseudomonas aeruginosa PAO 1162
Barth F. Smets *, Bruce E. R i t t m a n n 1 and David A. Stahl 1
Program of Environmental Engineering and Science, Department of Civil Engineering, University of Illinois, Urbana IL 61801, USA
(Received 10 March 1994; revision received 11 July 1994; accepted 12 July 1994)
Abstract: Batch mating experiments were employed to study the kinetics of the conjugal transfer of a TOL ptasmid, using the
transconjugant strain Pseudomonas aeruginosa PAO 1162 (TOL) as the plasmid donor and Pseudomonas putida PB 2442 and
Pseudomonas aeruginosa PAO 1162N as the plasmid recipients. Transfer rates from PAO 1162 (TOL) to PAO 1162N and PB 2442
measured for exponentially grown PAO 1162 (TOL) were 1.81 × 10-14 (standard error (S.E.) 1.25 x 10-15) ml. cell- i rain - 1 and
3.32 × 10-13 (S.E. 4.42 × 10-14) ml. cell- 1rain- 1, respectively. The instability of the TOL plasmid in PAO 1162 (TOL) was
evaluated under conditions that were non-selective for maintenance of the TOL catabolic functions. The measured rates of
instability were 6.7 10 -6 to 8.3 10 -6 min -1, and the loss of the catabolic functions was mainly caused by structural instability of the
plasmid.
Key words: TOL; Conjugation; Plasmid stability; Kinetics; Pseudomonas putida; Pseudomonas aeruginosa
Introduction
Horizontal gene transfer has been suggested as
an important process contributing to the development of novel biodegradative capacities of microbial communities exposed to organic pollutants
[1-3]. The contribution of gene transfer to new
biodegradative traits has indeed been demonstrated in several studies [2,4-8]. If gene transfer
is a generally important mechanism of community
* Corresponding author. Present address: Department of Environmental Systems Engineering, Clemson University,
Clemson SC 29634-0919 USA. Tel: (803) 656 5574, Fax:
(803) 656 0672.
1 Present address: Department of Civil Engineering, Northwestern University, Evanston IL 60208, USA.
SSDI 0 1 6 8 - 6 4 9 6 ( 9 4 ) 0 0 0 6 2 - X
adaptation, then promotion and steering of gene
transfer events may be a useful strategy for increasing and modifying the transformation capacities of existing microbial communities, and may
ultimately aid in the management of polluted air,
water, and soil. If rates of horizontal gene transfer are indeed significant, then direct genetic
transmission of limiting information may prove a
useful way of changing the catabolic diversity of
microbial communities.
To assess the importance of different horizontal gene transfer mechanisms, we examined the
transfer kinetics of conjugal catabolic plasmids.
Plasmids are one type of accessory genetic element thought to play a major role in horizontal
DNA exchange [9]. One event that affects the
fate of a plasmid in a microbial community is
338
conjugation, transfer mediated by cell-to-cell contact [9]; the kinetics of conjugal transfer, therefore, impact the contribution of plasmid-encoded
genes to community adaptation.
To allow comparison of transfer rates of conjugal plasmids determined in independent studies,
as well as to assist in the prediction of gene
transfer in environments other than those defined
by the experimental conditions, the kinetic parameters must be measured and expressed as
intrinsic quantities (i.e. independent of the experimental conditions such as cell densities, population ratios, and period of incubation). Therefore,
we designed and analyzed plasmid transfer experiments using a mass-action description of plasmid
transfer and loss [3,10,11]. In such a model, plasmid transfer rate coefficients are intrinsic and
expressed in units of L3 M -1 T -1, for example
ml. cell-1 min-1, while plasmid loss rate coefficients are in units of T-1, for example min-1.
The advantages of the mass-action approach
are made evident using data previously reported
by Fernandez-Astorga et al. [12] in the study of
conjugal transfer of a resistance plasmid among
E. coli strains (Fig. 1). A mass action model offers
a much more straightforward analysis of the resuits than was suggested by the authors [12]. The
continuous lines in Fig. 1 were constructed using
the following mass action equation to describe
the change in transconjugant cell concentration
and transfer efficiency:
d(T)
= ktl(D) (R)
(1)
dt
where (T), (D), and (R) are the concentrations
(cells ml-1) of transconjugant, donor, and recipient cells, respectively, t is time, and ktl is the
donor-to-recipient plasmid transfer rate coefficient (ml" cell -1 min-1). A value for k t l of 3.3 ×
10-12 ml • cell-1 min-1 was obtained by iteration
and the reported values for donor and recipient
concentration (from 1 × 104 to 1 × 108 cells m1-1)
and mating time (2 h) were used [12]. The massaction model describes the experimental observations well (Fig. 1). Moreover, as the entire pattern (Fig. 1) is determined by a single kinetic
parameter, ktl, it is more useful and efficient to
determine the intrinsic coefficient than to report
1E÷O0
Log [(T)/(D)]
.>,
==
1E-01
Drl
..............
o
o
o
0
0
0
..,..
1E-02
0
"%. D
1E-03
=.
0
t,.
o~
"% 0
1E-04
"% D
3
1E-05
1E-06
~%"°. 0
I
I
I
I
I
I
I
I
Log [(D)/(R)]
Fig. 1. Influence of ( D ) / ( R ) on plasmid transfer. The transfer
efficiencies estimated as (T)/(D) (circles and full lines) and
( T ) / ( R ) (squares and dashed lines) are shown. The discrete
symbols are the experimental data from Fernandez-Astorga et
al. [12]. The smooth curves are the best fit solutions computed
using Eq. 1 with ktl = 3.3 10 -12 ml'cel1-1 min -1.
all experimental ratios as suggested by Fernandez-Astorga et al. [12].
We reported previously on the rate coefficients of the interspecific conjugal transfer of the
TOL plasmid from its original host strain, P.
putida PAWl, to P. aeruginosa PAO 1162 [13].
Plasmid transfer models suggest, however, that
plasmid transfer from and stability in the secondary hosts are paramount in determining the
fate of a new plasmid in a community or population [3,14]. This was the motivation for conducting the present study. We report here on the
stability and kinetics of intra- and interspecific
conjugal transfer of the TOL plasmid from a new
host, P. aeruginosa PAO 1162.
Materials and Methods
Bacterial strains and plasmid
Pseudomonas aeruginosa PAO 1162 (leu-38,
r-m+)[15] and P. putida PB 2442 (trp, rif, str,
r - m +) [16] were gifts from M. Bagdasarian
(Michigan State University, USA). P. aeruginosa
339
PAO 1162N is a spontaneous naladixic acid resistant (@ 500 ~g m1-1) mutant of PAO 1162
isolated for use in the present study. PAO 1162
(TOL) was obtained by conjugal transfer of the
TOL plasmid from P. putida mt-2 (ATCC 33015).
with vigorous shaking (@ 140 strokes min -1) to
ensure aeration. Cell density was followed by
measuring absorbance at 660 nm (A660). Cultures
were harvested when they reached mid-exponential phase based on A660.
Growth and enumeration media
All bacterial strains were grown in a minimal
medium as reported before [13]. Solid media were
supplemented with agar (16 g 1-1). p. aeruginosa
PAO 1162N was enumerated on PLN, minimal
medium supplemented with leucine (20 ~g ml-1)
and naladixic acid (500 /.~g ml-1). Specific enumeration of P. aeruginosa PAO 1162 (TOL) used
PTL, minimal medium with m-toluic acid (0.8 g
1-1 ) replacing glucose and supplemented with
leucine. PAO 1162N (TOL) was enumerated on
PTLN, a medium identical to that for PAO 1162N
enumeration except that it contained m-toluic
acid (0.8 g 1-1) instead of glucose. P. putida PB
2442 was enumerated on a minimal medium supplemented with tryptophan (20 /xg m1-1) (PTr),
and strain PB 2442 (TOL) was enumerated on
PTTr, a minimal medium supplemented with
tryptophan (20 ~g ml-1) and m-toluic acid (0.8 g
1-1 ) instead of glucose. Cell enumeration was
performed by serial dilution in phosphate
buffered saline (PBS: 0.85% NaC1, 10 mM phosphate buffer, pH 7.2) and plating on appropriate
solid media. Plates were incubated at 35°C for 2
to 3 days prior to colony counting (Colony
Counter, Gallenkamp, Loughborough, UK). Average and standard error (S.E.) of cell concentrations were computed from the colony counts using standard methods [17].
Batch mating
All plasmid-transfer studies were performed
using batch-mating experiments as described before [13]. Briefly, donor and recipient cells were
grown separately in liquid media prior to mating.
Aliquots of the cultures at mid-exponential phase
were harvested by centrifugation for 5 min at
8100 x g (Eppendorf centrifuge 5415, Fremont,
CA). Supernatant was removed by aspiration, and
the cell pellet was resuspended by gentle vortexing in minimal medium supplemented with the
necessary amino-acids for both strains. Serial dilutions of the cell suspensions were made and
plated on the selective media. Then, both cultures were mixed in a 13-mm OD test tube. After
brief mixing, the mating mixture was incubated in
a 25°C water bath with shaking. The mixture was
periodically sampled and enumerated on the different selective media. Enumeration of donors
and recipients was routinely done at 60-min intervals during the first 240 min and at 120-min
intervals thereafter. Enumeration of transconjugants was routinely done at 30-min intervals during the first 240 min and at 60-min intervals
thereafter. In control experiments harvested
donor or recipient cultures were separately incubated in the mating medium and plated on the
three selective media after appropriate incubation times.
Batch culture
Liquid batch cultures were performed in
metal-capped, 13 mm OD test tubes containing
2.5 ml of growth medium. Stock plates maintained at 4°C were used to inoculate batch cultures. P. aeruginosa (TOL) was routinely grown in
the minimal medium with m-toluic acid (@ 0.8 g
1-1) as a sole carbon source (PTL), P. aeruginosa
PAO 1162N was grown in PLN, and P. putida PB
2442 was grown in PTr. The test tubes were
incubated at 25°C in a constant temperature water bath (Magniwhirl, Blue M, Blue Island IL)
Plasmid transfer model
With a mass action model describing plasmid
transfer, the following equality can be used to
calculate the plasmid transfer rate coefficient
[3,11], kt2 , from the results of batch-mating experiments:
(R'ln]n = L(R') Jl
(Ti) + (Ti+l)
+kt2
(ti+l --ti)
i=1
(2)
340
(T), (R'), and (T') refer, respectively, to the concentrations (in cell m1-1) of original transconjugant (P. aeruginosa PAO 1162 (TOL)), recipient
(P. aeruginosa PAO 1162N or P. putida PB 2442),
and newly formed transconjugant (P. aeruginosa
PAO 1162N (TOL) or P. putida PB 2442 (TOL))
cells. As the T O L plasmid originally resides in P.
putida mt-2, P. putida mt-2 is referred to as the
original donor strain; conjugal transfer to P.
aeruginosa PAO 1162 yielded the transconjugant
strain P. aeruginosa PAO 1162 (TOL). Although
P. aeruginosa PAO 1162 (TOL) has acquired a
donor phenotype, we prefer to refer to P. aeruginosa PAO 1162 (TOL) as a transconjugant, abbreviated T, in order to differentiate it from the
original T O L harboring strain. P. putida PB 2442
and P. aeruginosa PAO 1162N are termed recipient strains, abbreviated R'; and conjugal transfer
of T O L to P. putida PB 2442 or P. aeruginosa
PAO 1162N yields new transconjugants, abbreviated T', differentiating them from P. aeruginosa
PAO 1162 (TOL). The kinetic coefficient kt2 has
units of ml - cell-1 min-1. Eq. 2 indicates that a
plot of [(T')/(R')] n as a function of En=l[(Ti)+
(Ti+ 1)]/2(ti+ 1 - ti) yields a linear curve with slope
kt2. All data of the short-term batch-mating experiments were transformed to allow analysis with
Eq. 2.
Plasmid stability experiments
Short-term and long-term experiments were
performed to study plasmid stability. In the
short-term experiments, P. aeruginosa PAO 1162
(TOL) was grown in a TOL-selective medium (i.e.
PTL) to ensure the stable inheritance of the xyl
genes and, by inference, the T O L plasmid. At
mid- to late-exponential phase, the culture was
harvested by centrifugation at 8100 × g for 5 min,
the supernatant was decanted, and the pellet was
resuspended in 10 volumes of minimal medium
with glucose as sole carbon source and supplemented with leucine (PL). The resuspended cells
were transferred to a 13-mm OD test tube and
incubated at 25°C with shaking. At 1-h intervals
up to 20 h, samples were withdrawn. Serial dilutions were made in PBS, and the culture was
enumerated on PL, P T L and Luria-Bertini agar
(LB) [18]. After incubation at 35°C for 2 days, the
colony number was counted. Those colonies not
expressing catechol 2,3-dioxygenase ( C 2 3 0 - )
were identified by spraying the PL and LB plates
with catechol (0.5 M) and counting white
colonies[16].
Long-term experiments involved growth and
serial transfer under non-selective conditions to
allow the accumulation of a large fraction of
xyl-deficient cells. Selectively grown PAO 1162
(TOL) were diluted 100- to 200-fold in PL; when
late exponential phase was reached after 24 h
incubation, the culture was again diluted 100- to
200-fold in PL and reincubated at 25°C with
shaking. These serial transfers were repeated up
to 15 times at 24-h intervals. Just prior to transfer, cells were enumerated and the C 2 3 0 - fraction was determined as before. To confirm that a
C 2 3 0 - response was indicative of xyl gene loss,
putative C 2 3 0 - colonies (white) were restreaked
on PTL, incubated at 35°C for 3 days, and scored
for growth.
Plasmid loss model
The following equations, based on the mass
action model of plasmid transfer, describe events
when a plasmid-bearing strain is introduced in a
medium that allows expression of plasmid instability (i.e. when the medium does not preclude
loss of the plasmid-encoded genes):
d(T)
at - k t 2 ( T ) ( R ) - bp(T) + fg,(T)
d(R)
dt
- - k t 2 ( T ) ( R ) + bp(T) + fgr(R)
(3)
(4)
bp, which has units of min -1, is the plasmid
instability rate coefficient; bp includes both structural and segregational instabilities, as previously
defined [19]. This model assumes that all the cells
deficient in the catabolic gene, which are derived
from the transconjugant cells either through loss
of the plasmid or by other modifications of the
plasmid, can participate as recipients in conjugation with a donor cell, and therefore reacquire
the intact plasmid, fgt and fgr represent the specific growth rate functions of T and R, respectively, and have units of min-1. Eqs. 3 and 4 are
also descriptive of the events occuring in serial
341
transfer experiments with the additional consideration that cell concentrations obtained for T
and R are decreased 100- to 200-fold at 24 h time
intervals by dilution at each transfer. Numerical
solutions for Eqs. 3 and 4 were obtained using a
StellaTM computer program (High Performance
Systems Inc., Lyme, NH; available upon request).
Molecular methods
Small scale plasmid preparations used 1.25- to
2.5-ml of overnight grown cultures and a modification of the method of Kado and Liu [20-22].
Large-scale plasmid preparations (500 ml cultures) were based on the method of Hansen and
Olsen [23]. Supercoiled DNA was isolated by
equilibrium centrifugation in cesium chlorideethidium bromide gradients[18]. Restriction enzymes were used according to manufacturer's instructions (BRL, Bethesda, MD). Digested DNA
was analyzed by horizontal agarose gel electrophoresis [18].
Construction of hybridization probes
The xylE probe was derived from plasmid
pEPA 52, which carries a xylE insert [24], and
was isolated using an alkaline lysis method [18].
Two oligodeoxynucleotide primers (xylEA: 5'TGAACAAAGGTGTAATGCGAC3' and xylEB:
5'TCAGCACGGTCATGAATCGTF3') were designed (synthesized at the Biotechnology Center
of the University of Illinois, Urbana, IL) to amplify a 967-bp sequence containing the entire
xylE gene [25] using the polymerase chain reaction (PCR) [26]. The reaction mixture (in
GeneAmp TM reaction buffer, Perkin Elmer Cetus, Norwalk, CT) consisted of dATP, dCTP,
dGTP, and dTTP, each at 200 tzM; oligodeoxynucleotide primers at 0.5 /zM each; pEPA 53 at 10
ng; and 2.5 U Taq polymerase (Perkin Elmer
Cetus, Norwalk, CT). The mixture was subjected
to 25 cycles of incubation for 2 min at 95°C, 2 rain
at 62°C, and 3 min at 72°C in a thermal cycler
(Perkin Elmer Cetus, Norwalk, CT). The reaction
product was cleaned using an Ultrafree-MC TM
filter (30000 NMWL, Millipore, Bedford, MA)
according to manufacturer's specifications. The
amplified product was labeled by nick translation
according manufacturer's instruction (BMB, Indi-
anapolis, IN) using a-32p-deoxyguanosine-5'-triphosphate (ICN Biomedicals Inc., Irvine, CA).
Unincorporated nucleotides were removed from
the PCR reaction with a NenSorb TM) 20 column
(NEN Dupont, Wilmington, DE). For construction of the TOL plasmid probe, cesium chloride
purified TOL plasmid DNA was labeled by nick
translation (as above). An oligonucleotide probe
complementary to the 16S rRNA of P. aeruginosa
PAO 1162 (Paeru197) was constructed. This
oligonucleotide probe (3'-TCCCCCCCTAGGAGCCTGGA-5') was designed using available sequence information (NSF rRNA Database Project, University of Illinois, Urbana, IL) and labeled at the 5' end with 32p using T4 polynucleotide kinase and 3'- 32p-deoxyadenosine-5'-triphosphate (ICN Biomedicals Inc., Irvine, CA)
[27]. Appropriate hybridization conditions for
Paeru197 were determined from Ta studies [28]
that assessed probe binding to RNA from target
and non-target organisms.
Nucleic acid hybridizations
Plasmid DNA was resolved on agarose gels,
and the gels were used for a direct (in-gel) hybridization method [29]. Hybridization solution 1
consisted of 5 × Denhardt's solution[18], 5 x
SSPE [18], 0.1% sodium-dodecyl-sulfate (SDS),
100/~g ml-1 polyadenylic acid (Sigma, St. Louis,
MO), and 50% formamide. The gel was incubated at 50°C in a constant temperature incubator (Hybridization Incubator, Robbins Scientific,
Mountain View, CA) with continuous agitation
for 5 h prior to addition of the labeled probe.
The probe was denatured by boiling for 5 min
immediately before addition; incubation continued for 20 h. Excess hybridization fluid was
poured off, and the gels were washed for 1.5 h at
50°C in 0.1% SDS in 0.1 × SSC [18], followed by
30 min at 68°C in 0.1% SDS in 0.1 × SSC. Airdried gels were exposed to X-ray film (X-Omat
XRP-5, Eastman Kodak Co, Rochester, NY).
Serial rDNA and plasmid DNA colony hybridization [30]
Nylon membranes (Magnagraph, 0.22/xm pore
size, 82 mm diameter, MSI-Fisher, Chicago, IL)
were placed on 85-mm ID petri dishes containing
342
solid medium and allowed to wet for a few minutes. Appropriate dilutions of cell cultures were
spread on the membranes, and plates were incubated at 35°C. When colonies on the filter pads
were about 1 mm in diameter (after about 40 h of
incubation), standard procedures for colony lysis
and D N A denaturation were performed [18]. The
membrane was first hybridized to the probe
Paeru197 in solution 2, as described for the T d
studies. Baked filters and approximately 1.25 ml
hybridization solution filter-1 were transferred to
340-ml screw-capped glass tubes. Tubes were
mounted in a 40°C constant temperature incubator. After 3 h, the labeled Paeru197 probe was
added to approximately 2 × 106 cpm filter-1 and
incubated for 18 h. Excess hybridization fluid was
poured off, and filters were washed twice for 1 h
each at 40°C in 1% SDS in I × S S C . A final
stringent washing step was carried out using the
experimentally determined T d, 30 min at 40°C in
1% SDS in 1 × SSC. After air drying, filters were
exposed to X-ray film. The bound oligonucleotide
probe was removed prior to hybridization with
the plasmid D N A probe by washing twice for 30
min at 69°C in 0.1% SDS in 0.1 × SSC. After air
drying, filters were exposed to X-ray film to verify
removal of probe. The membranes were then
hybridized with the xylE probe. Baked filters
were incubated at 50°C for 5 h in a hybridization
incubator in approximately 1.5 ml hybridization
buffer 1 per filter (as described for plasmid hybridization). The probe was denatured by boiling
for 5 min immediately before its addition (approx. 1 × 10 6 cpm filter-I), and incubation continued for 20 h. Excess hybridization fluid was
poured off, and filters were washed for 1.5 h at
50°C (0.1% SDS in 0.1 × SSC) and for 30 min at
68°C following transfer to new fluid. Air dried
filters were exposed to X-ray film.
Results
Conjugal transfer experiments
Plasmid transfer from T to R was examined to
compare rates of transfer from transconjugants
and the original plasmid donors [13]. The effects
of transconjugant growth rate and substrate avail-
1E÷08 I
1E+07
v
g
1E÷06
=.
g
0
¢~
•
TransconjugantCells
•
Donor Cells
•
RecipientCells
1E+05
1E+04
1E+03
1E÷02
I
I
I
I
60
120
180
24O
Time (min)
Fig. 2. Evolution of different cell types in a typical batch
mating experiment with P. aeruginosa P A O 1162 (TOL) as
plasmid donor and P. aeruginosa P A O 1162N as recipient
strain.
ability on the T to R plasmid transfer rate were
not examined in this study. Therefore, batch experiments were always performed in mating
medium containing 2.5 g 1-1 glucose-C, and with
cells that had been harvested in exponential
phase. During the time of the short-term batch
experiments, the concentration of the parental
cell types (transconjugant and recipient cells) typically remained nearly constant (significant growth
did not commence until after 4 h), while the
concentration of the newly formed cell type (new
transconjugants) gradually increased (Fig. 2). Data
from the short-term batch experiments were
transformed for analysis with Eq. 2.
The individual data sets for the mating experiments with PAO 1162N as recipient strain show a
clear linear profile (Fig. 3; P < 0.01, R 2 > 0.9),
which indicates, as observed before [13], that Eq.
2 suffices to describe short-term batch mating
experiments, and that the slope of the linear
regression line is a measure of the plasmid-transfer coefficient, k t2. Additionally, the individual
profiles were very similar, indicating the reproducibility of the mating experiments. Qualitatively similar responses were obtained when PB
2442 was used as a recipient strain in matings
with PAO 1162 (TOL). The average value from
three replicate experiments for T O L transfer from
343
PAO 1162 (TOL) to PAO 1162 was 1.81 x 10 -14
ml.cel1-1 min -1 (S.E. 1.25x 10 -15 ml.cel1-1
min-1). The average estimate from three replicate experiments for TOL transfer from PAO
1162 (TOL) to PB 2442 was 3.32 x 10 -13 mlcell- 1 min- 1 (S.E. 4.42 X 10-14 ml • cell- 1
min-1). The average plasmid transfer rate to PB
2442 was statistically greater than the average
plasmid transfer rate to PAO 1162N (t-test, P =
0.05).
10000
1000
lOO
8
10
o
Short-term plasmid loss experiments
Ceils deficient in the plasmid-encoded xyl
genes, defined as cells that had lost the TOL
catabolic functions, were counted as the colonies
that scored negative in the catechol dioxygenase
assay. This enumeration method of xyl-deficient
cells limited the sensitivity of detection. The total
number of colonies that could be determined
accurately on a typical agar plate (64 crn2) was of
the order of 102 . Therefore, the lowest fraction of
xyl deficient colonies (i.e. (R)/(T + R)) that could
be accurately determined was around 10 -2 for
the short-term experiments. This detection limit,
in turn, determined the lower limit of the plasmid
instability rate coefficient, bp.
2.5E-04
0
500
1000
Time (min)
Fig. 4. Evolution of the ratio of total cell number to the
C 2 3 0 - cell number in short-term plasmid-gene loss experiments with P. aeruginosa PAO 1162 (TOL). The solid lines
are numerical predictions of the ratio with values for b o =
10 -6, 10 -5, 10 -4, 10 -3, or 10 -2 min -x. The horizontal line
reflects the approximate detection limit of the total cell number to C 2 3 0 - cell number ratio. The kinetic coefficients fgt,
fgr were obtained by fitting an exponential growth function to
the evolution of the total cell number, ( T + R ) , in each individual run. The specific growth rates of the total cell population, the transconjugant cells, and the plasmid-gene deficient
cells were assumed to be equal, i.e. fgt = fgr = fg(t+r)" The
average exponential growth rate of the four experiments of
4.25x10 -3 min -~ was used in the numerical solution. A
value for kt2 of 2.0 10-14 ml. cell- 1 m i n - 1 was obtained from
prior mating experiments. The initial conditions imposed were:
(T) + ( R ) = 5 106 cell m1-1 and (R) = 0 cell m1-1.
T
T,,el
2.0E-04
expt 3 \
1,5E-04
.L~,,_"
T ~ ~"'~;4NN
,'?"
expt 2
[]
1.0E-04
5.0E-05
i
~
cl
~".;'~k'"~
a ' ,~4
~ l ° []
expt 1
0.0E+00
0.0E÷00
:
5.0E+09
i=1
[]
expt2
[]
expt 3
i
1.0E+10
,
1.5E+10
(Ti) + (Ti+ 1)(ti + 1-ti)
2
Fig. 3. Evolution of the ratio [(T')/R')] as a function of
E n = 1 [ ( T i ) + ( T i + l ) ] / 2 ( t i + l - t i) for batch mating experiments
with P. aeruginosa PAO 1162 (TOL) as plasmid donor and P.
aeruginosa PAO 1162N as recipient strain.
Solving Eqs. 3 and 4 for (T) and (R) as a
function of time permits the calculation of the
fraction of xyl-deficient cells, (R)/(T + R), and
the inverse fraction, (T + R)/(R). Eqs. 3 and 4
predict that the ratio (R)/(T + R) starts at 0 at
time 0 and monotonically increases with increasing time. However, all experiments showed a ratio of (R)/(T + R) close to the detection limit of
0.01, giving (T + R)/(R) around 100/1 (Fig. 4).
Additionally, (T + R)/(R) data obtained for individual experiments did not yield a simple trend:
Soon after the transfer to the non-selective
medium, values for (T + R)/(R) were around 100,
and remained fairly stable around this value during one experiment. Thus, estimation of bp by
fitting experimental (T + R)/(R) to the model
predicted (T + R)/(R) failed.
344
The occurrence of plasmid instability was further confirmed by restreaking individual C 2 3 0 colonies recovered from PL on an agar medium
containing m-toluate as the sole carbon source
(i.e. PTL). A large fraction of these colonies was
unable to grow on PTL, indicating that these cells
could not express the T O L catabolic genes.
Although an accurate estimate of bp was impossible, an upper limit on the bp values could be
obtained by another analysis of the data. The
profile of the ( T + R ) / ( R ) ratio for the four
short-term experiments was compared to the profile of this ratio calculated from the predicted
values of (T) and (R) from Eqs. 3 and 4 solved
numerically using the Stella TM computer program
(Fig. 4). Except for the early-time data points, the
experimental data fall within the numerical predictions with xyl loss rates varying between 10 -5
and 10 -4 min -1 (Fig. 4). Additionally, the minimum b v observable in the short-term experiments
was approximately 10 -5 min -~, as bp values
smaller than 10 -5 m i n - I yield fractions of xyldeficient cells smaller than the approximate detection limit of 100 for (T + R ) / ( R ) (Fig. 4).
Long-term plasmid-gene loss experiments
A more precise calculation of bp used two
serial transfer experiments to allow accumulation
of a higher fraction of xyl deficient cells, such
that more significant trends in the number or the
fraction of these xyl-deficient ceils were measurable. Scoring the C 2 3 0 - colonies from either PL
or LB plates on PTL indicated that a variable
fraction of the C 2 3 0 - colonies retained the ability to grow on m-toluate as the sole carbon-source.
The C230- colonies that were unable to grow on
PTL were, therefore, taken as an estimate of the
xyl-deficient cells. Growth of a 100% plasmidharboring inoculum in a non-selective medium
was allowed for 24 h, at which time cell concentrations were instantaneously decreased to 1% or
0.5%, reflecting a 100- or 200-fold dilution into
fresh non-selective medium followed by another
24-h growth period. Values for T at time = 0 and
/x were obtained from the individual experimental
runs. An average exponential tx for each batchgrowth i was computed as ( 1 / 2 4 h - 1 ) . l n [ ( X i •
Vcul,i)fl(Xi
1 " V i ..... i)], where Xi_ 1 and X i a r e the
,,~
÷
0.20
~ ~
o.is
.~~ . u~
0.10
A: bp= 8.3x 10-6~in-1 J
B:~=o.7xlo* mi.l
. ~ *
I
~fii-A
I
0.00
100
200
300
400
500
Time (hrs)
Fig. 5. Evolution of the fraction of cells deficient in the
TOL-catabolic genes during two serial transfer experiments
with P. aeruginosa PAO 1162(TOL). The solid lines are best
numerical fits with a bo of 8.3 × 10 -6 min -1 (A) and 6.7× 10 -6
rain i (B).
total cell concentration at the end of batch i - 1
and i, and V i.... i and Vcul,i are the volume of
inoculum used for batch i and the total culture
volume of batch i, respectively. The average value
for/z was 0.200 h-1 (S.E. = 0.035 h - l ) for experiment 1 and 0.225 h -1 (S.E. = 0.011 h -1) for experiment 2. The cyclic evolution of the experimental total cell concentration during a serial
transfer experiment was well approximated using
these numbers (results not shown). Figure 5 shows
the evolution of the fraction of the ceils that were
deficient in the T O L catabolic genes, ( R ) / ( T +
R), for two serial-transfer experiments. Good
agreement between the initial experimental data
points and the fraction predicted by solving Eqs.
3 and 4 was possible (Fig. 5). Both experiments
could be fit with numerical solutions having very
similar plasmid-instability coefficients. The bestfit curves were generated with a b v value of
8.3 × 10 -6 min -~ and 6.7 × 10 -6 min - t , respectively for experiments 1 and 2. The best-fit values
for b o obtained in the long-term experiments are
consistent with the maximum value for bp of 10 -4
min-~ that was derived from the short-term experiments.
Molecular confirmation of catabolic gene loss
Because of the repetitive culture handling during serial-transfer experiments, the culture purity
345
was confirmed throughout the experiment with
the Paeru197 probe specific to P. aeruginosa.
Also, the loss or presence of the TOL catabolic
genes was confirmed unambiguously with the xylE
probe specific for the meta-pathway genes on the
TOL plasmid. For this purpose, cell enumeration
was performed on non-selective medium overlaid
with nylon filters and colonies subjected to a
serial rDNA and plasmid DNA hybridization.
Paeru197 hybridized with all colonies, while a
fraction of these colonies did not hybridize with
the xylE probe (results not shown). This confirmed that physical loss of the TOL catabolic
functions from P. aeruginosa PAO 1162 was being observed.
A second issue was whether or not the loss of
the catabolic TOL functions involved the loss of
the entire plasmid or loss of function. We evaluated these alternatives by direct examination of
plasmid DNA. Colonies deficient in the TOL
catabolic functions (inability to grow on m-toluate
as a sole carbon source) were used for small-scale
plasmid preparations. Plasmids were also isolated
from P. putida PAW1 (TOL), P. aeruginosa PAO
1162 (TOL), and P. aeruginosa PAO 1162 and
separated by agarose gel electrophoresis. The
DNA, after denaturation within the agarose gel,
was hybridized with a composite probe obtained
by nick-translation of the entire TOL plasmid.
The resultant autoradiogram (results not shown)
revealed that the composite TOL probe hybridized with a plasmid isolated from each of the
clones deficient in the TOL catabolic functions
(five clones examined), indicating that the loss of
the entire TOL plasmid was not required for the
loss of the catabolic TOL functions from P.
aeruginosa PAO 1162.
Discussion
Clearly, PAO 1162 (TOL) transferred TOL
intraspecifically and interspecifically to P. putida.
This is in agreement with a finding by Nakazawa
[31]: P. aeruginosa PAO 1161 (TOL), a close
relative of PAO 1162 [15], transferred TOL back
to P. putida TN 2100. The transfer rates to PB
2442 were almost 20-fold higher than to PAO
1162N. Because donor and recipient cells were
always harvested in exponentially growing phases
and all matings were performed in media with
the same composition, differences in growth rate
and substrate availability, previously shown to
have a strong influence on conjugal plasmid
transfer kinetics [13,32,33], probably do not account for the large difference in observed plasmid transfer rates. The only significant difference
in these experiments was the recipient organism.
The transfer rate from exponentially grown
PAO 1162 (TOL) to PB 2442 is very similar to the
observed plasmid-transfer rate from exponentially grown PAWl to PAO 1162 [32]. The apparently lower plasmid transfer rate from PAO 1162
(TOL) to PAO 1162, compared to transfer from
PAO 1162 (TOL) to PB 2442, may reflect the
origin of the TOL plasmid. The TOL plasmid was
originally identified in PAW1, a derivative of P.
putida mt-2, and the plasmid may be more stable
in these hosts which would make plasmid transfer
to such hosts more efficient. PB 2442, derived
from PB 2440, is also a derivative of P. putida
mt-2 [16].
The long-term experiments for xyl loss yielded
a more accurate estimate for bp than the shortterm experiments for two reasons. First, longer
times allowed plasmid-gene loss to result in accumulation of a large fraction of cells deficient in
the xyl genes. Therefore, a clear trend in fraction
of cells deficient in the TOL-catabolic genes could
be measured. Second, a different method for
enumeration of the xy/-deficient cells was employed in both experiments. While in the shortterm experiments, the computation of the deficient fraction relied on determination of the
C 2 3 0 - fraction using the catechol spray assay, in
the long-term experiments, this C 2 3 0 - fraction
was checked for loss of the TOL-catabolic genes
by restreaking on a m-toluate medium (PTL).
This procedure revealed that the catechol spray
assay overestimated the fraction that had lost the
TOL-catabolic genes by as much as 10-fold. Such
an overestimate also would result in an overestimate of the xyl loss rate. Thus, the maximum xyl
loss rate likely was much smaller than the proposed 10 -4 min -1 upper value from the shortterm experiments. The xyl loss coefficient of
346
6.7 × 10 -6 to 8.3 × 10 -6 min -1 (from the longterm experiments) for the T O L plasmid in P.
aeruginosa compares favorably with the range of
reported plasmid-gene loss coefficients for conjugal plasmids of 2.8 x 10 -6 to 1.4 x 10 -3 min -1
(See Table 2 in [3]). This plasmid-gene-loss coefficient also is smaller than the maximum
plasmid-gene loss coefficient of 5 x 10 - 4 min -1
suggested for the conjugal RP 4 plasmid [33]. The
only other report on the loss of plasmid-catabolic
genes was by Duetz et al., who reported loss rates
of 1.04X 10 -6 to 1 . 8 3 × 1 0 -6 min -a for the
TOL-catabolic genes by Pseudomonas putida
P A W l , the original donor cell [34]. Thus, the
stability of the T O L catabolic genes in P. aeruginosa PAO 1162 is only slightly lower than in P.
putida PAW1 (loss rates of 6.7 x 10 - 6 to 8.3 ×
10 -6 min -1 and 1 . 0 4 × 1 0 -6 to 1 . 8 3 × 1 0 -6
m i n - 1, respectively).
An implicit assumption in Eqs. 3 and 4 is that
the xyl-harboring and xyl-deficient cells exhibit
the same growth kinetics in the non-selective
environment. This contrasts with a recurrent assumption that plasmid-harboring cells have a
lower metabolic fitness than the isogenic
plasmid-free cells in the absence of selection.
Reduced fitness is attributed to the metabolic
burden imposed on the cell by the expression and
maintenance of plasmid genes [34-41]. Although
the cells deficient in the catabolic gene in this
study maintained a fractional T O L plasmid, it
could be hypothesized that such cells would have
a growth advantage over cells that harbor the
intact T O L plasmid. The impact of such growth
rate differences on the outcome of the serial
transfer experiments can be evaluated through
numerical predictions. With all other parameters
as before (Fig. 5, curve B) the evolution of the
xyl-deficient fraction in serial transfer experiments with an average growth advantage of the
catabolic-gene deficient cells of 0, 1, 2.5, or 5%
(i.e. the average /z for the catabolic-gene deficient cells is 0, 1, 2.5, and 5% more than the
average /x for the catabolic-gene harboring cells)
was evaluated. The initial profiles are very similar
when growth rate differences are not more than
1% (Fig. 6). Although the inclusion of a 1%
growth rate difference allowed a slightly better fit
0.25
;5%
I
t
I
~
o.2o
i
t
,5
,/
U
41 ~ . .
u ~
/
~, 1'/,
i
'
,
,,~
S
.,," 0.5 %
..."
0%
0.10
J"
0.00
J , ' ,
100
•
200
,
,
300
4o0
I
500
Time(hrs)
Fig. 6. Predicted evolution of the fraction of cells deficient in
the TOL-catabolic genes during serial transfer experiments of
P. aeruginosa P A O 1162 (TOL) when catabolic-gene deficient
cells are at a 0, 1, 2, or 5% growth rate advantage. Other
parameters were those used to generate curve B in Fig. 5. The
experimental data points of experiment 2 in Fig. 5 are also
shown.
to the two final data points of experiment 2 (Fig.
2), the overall fit was not improved (Fig. 6). The
error introduced by the assumption of identical
growth rates for both cell types is therefore small,
as the profiles up to 1% growth-rate difference
are very similar (Fig. 6). Thus, even when the
growth-rate differences between cells harboring
and deficient in the catabolic genes are ignored,
the initial evolution of the fraction deficient in
the plasmid gene can provide good estimates of
bp when the growth rate difference are not very
large.
All examined clones derived from P. aeruginosa PAO 1162 (TOL) that failed to grow on
m-toluate retained a plasmid moiety that crosshybridized with the T O L plasmid. This suggests
that the major mechanism of plasmid instability
observed in this study was the loss of the catabolic
genes from the parent plasmid. A similar finding
was made previously for loss of the T O L catabolic
functions from the T O L plasmid in P. putida
[34,41-44]. In those studies, the loss is the result
of the specific excision of a 40-kb segment by
reciprocal recombination at a pair of directly
repeated sequences on the plasmid [43]. Although a further identification of the excised
347
fragment was not performed, an excision event is
a probable explanation for the loss of the catabolic
TOL functions in the xyl-deficient clones of PAO
1162 (TOE).
With the reported plasmid transfer and stability coefficients, a preliminary assessment of the
potential contribution of conjugal gene transfer
to the expansion of the catabolic range of simple
microbial ecosystems can be made. For instance,
a plasmid fate model [14], can be used to predict
whether or not plasmid transfer alone is sufficient to maintain plasmid-encoded genes of interest in a defined microbial community under conditions that are not selective for the target genes.
The measured kinetic values for TOL transfer
and stability can be used to predict the fate of
TOL catabolic genes in a continuous suspendedgrowth reactor system consisting of P. aeruginosa
PAO 1162 and P. putida PB 2442 cells growing
on a non-selective carbon-source. Assuming a
growth rate difference of 1% between cells with
and without the plasmid-encoded genes and an
overall system specific growth rate of i day-1, the
plasmid fate model of Simonsen suggests that a
concentration of 2.6 108 to 4.8 109 cells m1-1
would be sufficient to retain the plasmid genes in
such a community [14] through conjugal transfer.
Several factors must be considered, however,
when extrapolating these findings to environmental settings. First, although cell concentrations on
the order of 108 to 109 cells m1-1 are achievable
under certain conditions and localities, typically
cell concentrations in environmental settings are
lower. Second, the previous analysis assumes that
all cells are active in plasmid transfer, while probably only a fraction of the ceils in any community
would be able to participate in plasmid transfer.
Third, a strong dependence of the plasmid transfer rate on the growth rate has been reported
earlier [13]. The plasmid transfer rates reported
here for exponentially growing donor cells probably overestimate the rates that would be observed
in the typical low growth rate environment. Thus,
although in engineered systems, where the growth
rate and the community make-up can be altered,
horizontal plasmid transfer may suffice to maintain plasmid encoded genes in a community, under typical environmental conditions the mea-
sured values suggest that the contribution of conjugal transfer alone to altered community genetic
make-up and associated adaptation would be
minimal. If, however, some of the genes on the
plasmid are mobile, the transient presence of a
plasmid in a community could serve to deliver
genes from the plasmid to the chromosome (or
other plasmid) without the requirement for stable
maintenance. In support of this scenario, an increasing number of plasmid or chromosomally
located catabolic operons are now recognized to
be derived from or part of active transposable
elements [45-53].
It is notable that the kinetic parameters kt2
and bp measured under non-selective conditions
for TOL in this study compare favorably with
measured kinetics for antibiotic resistance factors
(see e.g. [11,54-57]). This comparison, therefore,
suggests that the horizontal spread of catabolic
plasmids may be as significant as the spread of
antibiotic resistance plasmids. It seems necessary,
therefore, to investigate whether selective pressures exist, comparable to selection by antibiotics,
that might promote observed catabolic plasmid
transfer. The existence of such selective pressures
would further substantiate the contribution of
conjugal catabolic plasmid tranfer to community
adaptation.
Acknowledgements
This research was funded in part by the United
States Environmental Protection Agency through
cooperative agreement CR-812582-03 to the Advanced Environmental Control Technology Research Center. Additional funding was provided
by the Amoco Oil Company.
References
1 Beringer, J.E. and Hirsch, P.R. (1984) The role of plasmids in microbial ecology. In: Current Perspectives in
Microbial Ecology(Klug, M.J. and Reddy,C.A., Eds.), pp.
63-70. American Society for Microbiology,Washington
DC.
2 Slater, J.H. (1984) Genetic interactions in microbial communities. In: Current Perspectives in Microbial Ecology
348
(Klug, M.J. and Reddy, C.A., Eds.), pp. 87-93. American
Society for Microbiology, Washington.
3 Smets, B.F., Rittmann, B.E. and Stahl, D.A. (1990) The
role of genes in biological processes: part 2 of a two-part
article. Environ. Sci. Technol. 24, 162-169.
4 Hartmann, M., Reineke, W. and Knackmuss, H.-J. (1979)
Metabolism of 3-chloro, 4-chloro, and 3,5-dichlorobenzoate by a Pseudomonas. Appl. Environ. Microbiol. 37, 421428.
5 Kellog, S.T., Chatterjee, A.K. and Chakrabarty, A.M.
(1981) Plasmid assisted molecular breeding: new technique
for enhanced biodegradation of resistent toxic chemicals.
Science 214, 1133-1135.
6 Latorre, J., Reineke, W. and Knackmuss, H.-J. (1984)
Microbial metabolism of chloroanilines: Enhanced evolution by natural genetic exchange. Arch. Microbiol. 140,
159-165.
7 Kr6ckel, L. and Focht, D.D. (1987) Construction of
chlorobenzene-utilizing recombinants by progenitive manifestation of a rare event. Appl. Environ. Microbiol. 53,
2470-2475.
8 Sahasrabudhe, S.R. and Modi, V.V. (1987) Microbial
degradation of chlorinated aromatic compounds. Microb.
Sci. 4, 300-303.
9 Reanney, D.C., Gowland, P.C. and Slater, J.H. (1983)
Genetic interactions among microbial communities. In:
Microbes in their Natural Environments (Slater, J.H.,
Whittenbury, R. and Wimpenny, J.W.T., Eds.), pp. 379421. Cambridge University Press, Cambridge, UK.
10 Stewart, F.M. and Levin, B.R. (1977) The population
biology of plasmids. A priori conditions for the existence
of conjugationally transmitted factors. Genetics 87, 209228.
11 Levin, B.R., Stewart, F.M. and Rice, V.E. (1979) The
kinetics of conjugative plasmid transmission: Fit of a single
mass action model. Plasmid 2, 247-260.
12 Fernandez-Astorga, A., Muela, A., Cisterna, R., Iriberri,
J. and Barcina, I. (1992) Biotic and abiotic factors affecting
plasmid transfer in Escherichia coli strains. Appl. Environ.
Microbiol. 58, 392-398.
13 Smets, B.F., Rittmann, B.E. and Stahl, D.A. (1993) The
specific growth rate of Pseudomonas putida PAW1 influences the conjugal transfer rate of the TOL plasmid. Appl.
Environ. Microbiol. 59, 3430-3437.
14 Simonsen, L. (1991) The existence conditions for bacterial
plasmids: theory and reality. Microb. Ecol. 22, 187-205.
15 Dunn, N.W. and Holloway, B.W. (1971) Pleiotropy of
p-fluorophenylalanine-resistant and antibiotic hypersensitive mutants of Pseudomonas aeruginosa. Genetic Research, Camb. 18, 185-197.
16 Bagdasarian, M., Lurz, R., RiJckert, B., Franklin, F.C.H.,
Bagdasarian, M.M. and Timmis, K.N. (1981) Specific purpose cloning vectors. If. Broad host range, high copy
number RSF 1010-derived vectors and a vector system for
gene cloning in Pseudomonas. Gene 16, 237-247.
17 Finney, D.I. (1978) Statistical Methods in Biological Assay
(3d edn.) Charles Griffin and Co Ltd., London.
18 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor
Laboratory, Cold Spring Harbor NY.
19 Cooper, N.S., Brown, M.E. and Caulcott, C.A. (1987) A
mathematical method for analysing plasmid stability in
micro-organisms. J. Gen. Microbiol. 133, 1871-1880.
20 Top, E., Mergeay, M., Springael, D. and Verstraete, W.
(1990) Gene escape model: Transfer of heavy metal resistance genes from Escherichia coli to Alcaligenes eutrophus
on agar plates and in soil samples. Appl. Environ. Microbiol. 56(8), 2471-2478.
21 Mach, P.A. and Grimes, D.J. (1982) R-plasmid transfer in
a wastewater treatment plant. Appl. Environ. Microbiol.
44, 1395-1403.
22 Kado, C.I. and Liu, S.-T. (1981) Rapid procedure for
detection and isolation of large and small plasmids. J.
Bacteriol. 145, 1365-1373.
23 Hansen, J.B. and Olsen, R.H. (1978) Isolation of large
plasmids and characterization of the F2 incompatibility
group plasmids PMG2. J. Bacteriol. 135, 227-238.
24 Cuskey, S.M. and Sprenkle, A.B. (1988) Benzoate-dependent induction from the OP2 operator-promotor region of
the TOL plasmid pWWO in the absence of known plasmid
regulatory genes. J. Bacteriol. 170, 3742-3746.
25 Nakai, C., Kagamiyama, H. and Nozaki, M. (1983) Complete nucleotide sequence of the metapyrocatechase gene
on the TOE plasmid of Pseudomonas putida rot-2. J. Biol.
Chem. 258(2923-2928).
26 lnnis, M.A., Gelfald, D.H., Snisky, J.J. and White, J.T.
(1990) PCR Protocols. A Guide to Methods and Applications. Academic Press Inc., San Diego CA.
27 Maxam, A. and Gilbert, W. (1980) Sequencing end-labeled
DNA with base-specific chemical cleavage. Methods in
Enzymology 65, 499-560.
28 Stahl, D.A. and Amann, R. (1991) Development and application of nucleic acid probes. In: Nucleic Acid Techniques in Bacterial Systematics (Stackebrandt, F. and
Goodfellow, M., Eds.), pp. 205-248. John Wiley and Sons
Ltd, West Sussex, UK.
29 Ehtesham, N.Z. and Hasnain, S.E. (1991) Direct in-gel
hybridization, without blotting, using nick-translated
cloned DNA probe. BioTechniques 11, 718-722.
30 Smets, B.F. and Stahl, D.A. (1992) Serial rDNA and
Plasmid DNA Colony Hybridization: A Technique for
Tracking DNA Sequences in Different Bacterial Host
Strains. Preprints of the 204th National Meeting of the
American Chemical Society, 32 (2) (pp.128-133) Washington DC.
31 Nakazawa, T. (1978) TOL plasmid in Pseudomonas aeruginosa PAO: Thermosensitivity of self maintenance and
inhibition of host cell growth. J. Bacteriol. 133, 527-535.
32 Smets, B.F. (1993) Kinetics of the conjugal transfer of a
TOL plasmid. Ph.D. Thesis, University of Illinois,
Urbana-Champaign, USA.
33 MacDonald, J.A., Smets, B.F. and Rittmann, B.E. (1992)
The effects of energy availability on the conjugative transfer kinetics of plasmid RP4. Wat. Res. 26, 461-468.
349
34 Duetz, W.A., Winson, M.K., van Andel, J.G. and Williams,
P.E. (1991) Mathematical analysis of catabolic function
loss in a population of Pseudornonas putida mt-2 during
non-limited growth on benzoate. J. Gen. Microbiol. 137,
1363-1368.
35 Zund, P. and Lebek, G. (1980) Generation-time prolonging R-plasmids: correlation between increases in the generation time of Escherichia coli caused by R-plasmids and
their molecular size. Plasmid 3, 65-69.
36 Numan, Z., Venables, W.A. and Wimpenny, J.W.T. (1991)
Competition between strains of Escherichia coli with and
without plasmid RP 4 during chemostat growth. Can. J.
Microbiol. 37, 509-512.
37 Jones, I.M., Primrose, S.B., Robinson, A. and Ellwood,
D.C. (1980) Maintenance of some ColEl-type plasmids in
chemostat culture. Mol. Gen. Genet. 180, 579-584.
38 Godwin, D. and Slater, J.H. (1979) The influence of the
growth environment on the stability of a drug resistance
plasmid in Eschericia coli K12. J. Gen. Microbiol. 111,
201-210.
39 Wouters, J.T.M., Driehuis, F.L., Polaczek, P.J., van Oppenraay, H.A. and van Andel, J.G. (1980) Persistence of
the pBR 322 plasmid in Escherichia coli K 12 grown in
chemostat culures. Antonie Van Leeuwenhoek 46, 353362.
40 Nancib, N., Mosrati, R. and Boudrant, J. (1992) Study of
population dynamic for a recombinant bacterium during
continuous cultures: Application of data filtering and
smoothing. Biotechnol. Bioeng. 39, 398-407.
41 Duetz, W.A. and van Andel, J.G. (1991) Stability of TOL
plasmid pWWO in Pseudomonas putida mt-2 under nonselective conditions in continuous culture. J. Gen. Microbiol. 137, 1369-1374.
42 Bayley, S.A., Duggleby, C.J., Worsey, M.J., Williams, P.A.,
Hardy, K.G. and Broda, P. (1977) Two modes of loss of
TOL function from Pseudomonas putida mt-2. Mol. Gen.
Genet. 154, 203-204.
43 Meulien, P., Downing, R.G. and Broda, P. (1981) Excision
of the 40 kb segment of the TOL plasmid from Pseudomonas putida mt-2 involves direct repeats. Mol. Gen.
Genet. 184, 97-101.
44 Williams, P.A., Taylor, S.D. and Gibb, L.E. (1988) Loss of
the toluene-xylene catabolic genes of TOL plasmid pWWO
during growth of Pseudomonas putida on benzoate is due
to a selective growth advantage of "cured" segregants. J.
Gen. Microbiol. 134, 2039-2048.
45 van der Meer, J.R., Zehnder, A.J.B. and de Vos, W.M.
(1991) Identification of a novel composite transposable
46
47
48
49
50
51
52
53
54
55
56
57
element, Tn5280, carrying chlorobenzene dioxygenase
genes of Pseudomas sp. strain P51. J. Bacteriol. 173(70777083).
Tsuda, M. and Iino, T. (1990) Naphtalene degrading genes
on plasmid NAH7 are on a defective transposon. Mol.
Gen. Genet. 223, 33-39.
Tsuda, M., Minegishi, K.-I. and Iino, T. (1989) Toluene
transposons Tn 4651 and Tn 4652 are class II transposons.
J. Bacteriol. 171, 1386-1393.
Tsuda, M. and Iino, T. (1988) Identification and characterization of Tn 4653, a transposon covering the toluene
transposon Tn 4651 on TOL plasmid pWWO. Mol. Gen.
Genet. 213, 72-77.
Tsuda, M. and lino, T. (1987) Genetic analysis of a transposon carrying toluene degrading genes on a TOL plasmid
pWWO. Mol. Gen. Genet. 210, 270-276.
Tomasek, P.H., Frantz, B., Sangodkar, U.M.X., Haugland,
R.A. and Chakrabarty, A.M. (1989) Characterization and
nucleotide sequence determination of a repeat element
isolated from a 2,4,5,-T degrading strain of Pseudomonas
cepacia. Gene 76, 227-238.
Thomas, A.W., Slater, J.H. and Weightman, A.J. (1992)
The dehalogenase gene dehl from Pseudomonas putida
PP3 is carried on an unusual mobile genetic element
designated DEH. J. Bacteriol. 174, 1932-1940.
Slater, J.H., Weightman, A.J. and Hall, B.H. (1985) Dehalogenase genes of Pseudornonas putida PP3 on chromosomally located transposable elements. Mol. Biol. Evol. 2,
557-567.
Nakatsu, C., Ng, J., Singh, R.K., Straus, N.A. and Wyndham, R.C. (1991) Chlorobenzoate catabolic transposon
Tn5271 is a composite class I element with flanking class
II insertion sequences. Proc. Natl. Acad. Sci. USA 88,
8312-8316.
Simonsen, L., Gordon, D.M., Stewart, F.M. and Levin,
B.R. (1990) Estimating the rate of plasmid transfer: an
end-point method. J. Gen. Microbiol. 136, 2319-2325.
Freter, R., Freter, R.R. and Brickner, H. (1983) Experimental and mathematical models of Escherichia coli plasmid transfer in vitro and in viro. Infect. Immun. 39, 60-84.
Gordon, D.M. (1992) Rate of plasmid transfer among
Escherichia coli strains isolated from natural populations.
J. Gen. Microbiol. 138, 17-21.
Levin, B.R. and Stewart, F.M. (1980) The population
biology of bacterial plasmids: A priori conditions for the
existence of mobilizable nonconjugative factors. Genetics
94, 425-443.