Journal of General Virology (1995), 76, 37-45. Printed in Great Britain
37
Characterization of the P1 protein and coding region of the zucchini
yellow mosaic virus
G. C. Wisler,t D. E. Purcifull and E. Hiebert*
Department o f Plant Pathology, University o f Florida, 1453 Fifield Hall, PO Box 110680, Gainesville,
F L 32611-0680, USA
The nucleotide sequence of the 5'-terminal P1 coding
region of an aphid-transmissible isolate of zucchini
yellow mosaic virus (ZYMV; strain FL/AT), a mild
isolate (strain MD) and a severe isolate (strain SV), all
from Florida, were compared with two other ZYMV
isolates. The ZYMV MD and SV isolates and an isolate
from California (ZYMV CA) had 95-98 % sequence
similarities to FL/AT, whereas an isolate from Reunion
Island (ZYMV RU) had a 60 % sequence similarity to
FL/AT. ZYMV MD had an 18 nucleotide insert
following the start codon of the P1 coding region. The
P1 proteins of all ZYMV isolates shared conserved
amino acids in areas of the C terminus similar to those
reported for other potyviruses. Polyclonal antisera were
prepared to the P1 proteins of ZYMV FL/AT and RU
expressed in Escherichia coli. The FL/AT and RU P1
antisera showed varying degrees of reactivity in Western
blots with extracts of pumpkin (Cucurbitapepo L.) singly
infected with a number of distinct ZYMV isolates. The
reaction of the FL/AT P1 antiserum with isolate RUinfected tissue extracts was very weak compared to the
homologous reaction. Neither antiserum reacted with
extracts from plants singly infected with three other
potyviruses, a potexvirus, or a cucumovirus. The P1
proteins of ZYMV isolates ranged in molecular mass
from 33 kDa to 35 kDa. The P1 protein of strain MD
was larger (35 kDa) than that of FL/AT (34 kDa).
Indirect immunofluorescence tests with FL/AT P1
antiserum indicated that the P1 protein aggregates in
ZYMV-infected tissues. The antisera to the ZYMV P1
proteins have potential as serological probes for identifying ZYMV and for distinguishing ZYMV isolates by
immunoblotting.
Introduction
range from strains which induce very mild symptoms to
those which induce severe and necrotic symptoms
(Petersen et al., 1991; Lecoq & Purcifull, 1992). These
types of variants have been detected in geographically
distinct regions including France and the USA (Lecoq &
Purcifull, 1992). Biological variants have also been
observed which differ in the ability to be aphid
transmitted (Lecoq et al., 1991 ; Lecoq & Purcifull, 1992).
Many of the traditional and molecular studies involved
in distinguishing potyviruses have been confined to the
CP and to sequences of the 3' end (Shukla et al., 1991).
This has been based, in part, on the ease of purifying CP
or in the ease of cloning this coding region by oligo(dT)
priming. The product of the 5' coding region, P1, has not
been as well characterized as other regions of the
genome. The protein encoded by the 5'-terminal region
of the potyvirus genome is the most variable of those that
have been sequenced (Shukla et al., 1991) and shows the
greatest molecular mass variation, in over 30 potyviruses
which have been studied by in vitro translations (Hiebert
& Dougherty, 1988), with a size range from 32 to
64 kDa. The C terminus of P1 has been identified as a
serine-type protease responsible for the autocatalytic
Zucchini yellow mosaic virus (ZYMV) is one of several
members of the Potyviridae, which cause serious losses of
cucurbitaceous crops worldwide. Both serological and
biological variations have been reported for ZYMV
isolates (Lisa & Lecoq, 1984; Lecoq & Purcifull, 1992;
Wang et al., 1992). Serological relationships are often
complex and ZYMV has been reported to cross react
with watermelon mosaic virus 2 (WMV-2) in serological
studies of the coat protein (CP; Davis & Yilmaz, 1984;
Huang et al., 1986; Lisa & Lecoq, 1984; Purcifull et al.,
1984; Somowiyarjo et al., 1989) and cylindrical inclusion
(CI) protein (Suzuki et al., 1988). Biological variants
* Author for correspondence. Fax + 1 904 392 6532. e-mail
[email protected]. EDU
"~Present address: USDA-ARS Agricultural Research Station,
1636 East Alisal Street, Salinas, CA 93905, USA.
The sequence data reported in this paper have been deposited in
GenBank database under the followingaccessionnumbers: ZYMV
RU, L29569; ZYMV C, L31350; ZYMV MD, L35588; ZYMV SV,
L35589; ZYMVFL/AT, L35590.
0001-2511 © 1995SGM
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00
38
G. C. Wisler, D. E. Purcifull and E. Hiebert
cleavage between P1 and helper component/protease
(HC/Pro; P2) (Verchot et al., 1991). Brantley & Hunt
(1993) found that the expressed P1 for tobacco vein
mottling virus (TVMV) in Escherichia coli is an RNAbinding protein with a preference for ssRNA. RodriguezCerezo & Shaw (1991) prepared an antiserum to TVMV
P1 expressed in E. coli. A 31 kDa protein was detected at
low levels in TVMV-infected tissue extracts which had
been enriched for endoplasmic reticulum and mitochondria. Yeh et al. (1992), using monoclonal antibodies
to a 112 kDa protein product of papaya ringspot virus
(PRSV) type P, were able to detect both 51 and 64 kDa
proteins, which presumably correspond to the HC/Pro
and the P1 proteins, respectively. Canto et al. (1994)
reported that monoclonal antibodies to potato virus Y
(PVY) HC/Pro were useful in the identification of PVY
strains.
The high sequence variability of P1 in potyviruses
makes it an interesting protein coding region for study
and a target for the development of probes for
distinguishing potyviruses. The primary objectives of this
study were to (i) characterize the P1 protein and coding
region of an aphid-transmissible isolate of ZYMV from
Florida (FL/AT); (ii) compare the P1 protein and
coding region of ZYMV FL/AT to those of other
ZYMV isolates and other potyviruses; (iii) evaluate
antisera to the P1 protein as serological probes for
studying the variability of ZYMV isolates; (iv) evaluate
the serological relationship of this P1 protein to those of
other potyviruses infecting the Cucurbitaceae; and (v)
localize the P1 protein in ZYMV-infected tissues.
Methods
Virus isolates. An isolate of ZYMV from Florida (FC-1119; Purcifull
et al., 1984), which was maintained in a greenhouse by aphid
transmission, was used as the type isolate in this study and is hereafter
designated as ZYMV FL/AT. The other Florida isolates were a culture
of FC-1119 maintained by mechanical inoculation in the greenhouse
(FL/GH), a severe, necrotic isolate from Florida (FC-2088) designated
as SV, a mild isolate from Florida (FC-1994) designated as MD,
isolates FC-2000, -2050, -2154, -3179 through -3183, from the collection
of D. E. Purcifull and G. W. Simone, and isolate 81-25 from the
collection of W. C. Adlerz. The ZYMV isolate from Reunion Island
(RU) and isolates from France [weak, El5 and PAT (poorly aphid
transmissible)] were kindly provided by H. Lecoq (INRA, Station de
Pathologie Vegetale, Montfavet, France). The ZYMV isolate from
Italy (designated 'Italy') was obtained from V. Lisa. Isolates from
Israel included the HAT (highly aphid transmissible) and NAT (nonaphid transmissible), and were kindly provided by B. Raccah (Volcani
Center, Israel). The ZYMV isolates from Egypt, Connecticut (USA)
and Taiwan were from the ATCC. The other viruses were all from the
collection of D. E. Purcifull and G. W. Simone and were PRSV W,
CMV (cucumber mosaic virus isolate FC-2147), 2932 (an unidentified
potyvirus; Purcifull et al., 1991), WMV-2 and potex (a possible
potexvirus from cucurbits; Purcifull et al., 1988).
The sequence of P1 of ZYMV FL/AT was compared to a ZYMV
isolate from California (ZYMV CA; Balint et aL, 1990), one from
Reunion Island (RU; Baker et al., 1991, 1992) and Florida isolates SV
and MD, both of which were sequenced in this study.
Culture o f virus isolates. Host plants were either maintained in a
growth room with an approximately 16 h day length and an average
temperature of 23 °C or in a greenhouse. Isolates obtained from outside
the state of Florida were kept under quarantine conditions in a locked
growth room. Host plants used for routine assay and maintenance were
pumpkin (Cucurbita pepo L. ' Small Sugar'), squash (C. pepo L. ' Early
Prolific Straightneck'), watermelon [Citrullus lanatus (Thunb.) Matsumi & Nakai 'Crimson Sweet'] and cantaloupe (Cucumis melo L.
'Hales Best Jumbo').
Virus purification and R N A extraction. The protocol used for virus
purification was similar to that described by Lecoq & Pitrat (1985).
Virion RNA was isolated from a virus preparation (3 mg/ml) by
adding an equal volume (1 ml) of RNA dissociating solution (200 mraTris-HC1, 2 mra-EDTA, 2% SDS pH 9.0) and 6 ~tl of protease K
(20 mg/ml). After a 10 min incubation at room temperature, the RNA
was isolated by a linear-log sucrose density gradient as described
elsewhere (Dougherty & Hiebert, 1980).
Synthesis of Z Y M V clones. The initial cDNA library of the ZYMV
FL/AT RNA was made by using Lambda gtl 1 (Lambda Librarian;
Stratagene). Purified viral RNA (8.3 ~tg)was used as the template in the
first-strand (reverse transcription) synthesis reaction. Second-strand
synthesis and the ligation of EcoRI/NotI linkers were performed
according to the manufacturer's instructions (Stratagene). The cDNA
preparations with linkers were ligated to EcoRI-digested, calf intestinal
alkaline phosphatase-treated Lambda gtl 1 DNA (Protoclone Lambda
gtll system; Promega) and then packaged and titrated according to
manufacturer's instructions using the Packagene Lambda DNA
packaging system (Promega).
A library made specifically to represent the 5' terminus of the ZYMV
genome was constructed using the Lambda ZAP II EcoRI cloning kit
(Stratagene). A primer, with the sequence 5' CGGTGTGTGCGCTAC 3', which corresponded to the CI protein-encoding region, was
used in this cloning experiment and was synthesized at the University
of Florida Interdisciplinary Center for Biotechnological Research
(ICBR) DNA Synthesis core. The host strain used for this vector
system was E. coli XL1-Blue.
Clones identified in Lambda gtll were digested with EcoRI and
extracted from an agarose gel using a Prep-A-Gene DNA purification
kit (Bio-Rad). Fragments were then subcloned by ligating into EcoRIdigested pGEMEX-1 (Promega). Plasmid clones [pBluescript S K ( - ) ]
were isolated from Lambda ZAP II with the use of the helper phage
R408 according to manufacturer's instructions (Stratagene).
Immtmoscreening o f Z Y M V clones. Immunoscreening for clones
expressing specific regions of the ZYMV genome was conducted
essentially according to manufacturer's instructions as described in the
picoBlue immunoscreening kit (Stratagene) and by Short et al. (1988).
Antisera to the CP and CI proteins of ZYMV, to the small nuclear
inclusion protein (NIa) of tobacco etch virus (TEV), the HC/Pro
(provided by T. Pirone, Kentucky, USA) of TVMV and HC/Pro
(previously described as amorphous inclusion protein; de Mejia et al.,
1985) of PRSV W were used for primary antibody screening. The
antisera to the non-structural proteins used in screening were known to
react with corresponding proteins of ZYMV and other potyviruses.
DNA sequencing o f Z Y M V clones. The nucleotide sequences of
plasmid preparations and PCR products were determined using the
standard Sanger dideoxynucleotide chain termination method (Sanger
et al., 1977) employed in both USB and Pharmacia LKB sequencing
kits. Sequence analysis and comparisons were made using the
University of Wisconsin Genetics Computer Group sequence software
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00
Z Y M V P1 protein characterization
(GCG) available at the University of Florida ICBR Biological
Computing Facility.
The Pl-encoding regions of ZYMV SV and MD were cloned and
sequenced after amplification of the cDNA by PCR using primers
specific for P1 of FL/AT, following procedures similar to those
described by Robertson et al. (1991).
Amplifidation of P1 by PCR for subcloning and expression. Based on
the nucleotide sequence of the P1 coding region of FL/AT, primers
were made that corresponded to the N- and C-terminal regions. The
specific primers for production of P1 were, on the 5' terminus,
5' CATGAGAATTCAAGCTTACATGGCCTCTATCATG 3', and
on the 3' terminus, 5' CTGACTTCTAGACCTGTTCCAGCGCGTTCA 3'. Primers used for sequencing and PCR amplification were
obtained from the University of Florida ICBR DNA Synthesis facility.
For cloning of P1 of ZYMV FL/AT, restriction sites with five flanking
bases on the 5' end were incorporated into the primers to provide for
in-frame directional cloning into the pETH vector (McCarty et aL,
1991; Studier et al., 1990) at HindIII and BglII sites on the pETH
polylinker. The expressed protein contained 11 amino acid residues
from the N-terminal peptide of T7 gene 10 protein in the vector.
Induction and expression of the P1 protein. The pETH plasmid from
cultures which were identified as having P1 in the correct orientation
and reading frame was used to transform the appropriate host for
expression, E. coli strain BL21DE3pLysS, according to Studier et al.
(1990). An insoluble fusion protein of around 36 kDa was overexpressed. Cells were harvested by centrifugation at 5000 g, pellets were
resuspended in one half the original volume of TE buffer (10 mMTris-HC1, 1 mM-EDTA pH 8"0) and frozen at - 2 0 °C overnight.
Expressed proteins were analysed by SDS-PAGE. In all cases, induced
and non-induced recombinant plasmid cultures were tested, as well as
plasmid cultures containing no inserted gene.
Antigen preparation and antibody production. Cultures (50 ml) were
induced for large scale P1 protein production. The expressed P1 protein
was partially purified after sonication by.three cycles of centrifugation
of the insoluble fraction at 10000 g and resuspension with TE buffer.
The protein in the precipitate was further purified by preparatory
SDS-PAGE. The protein band was visualized by incubating the gel in
0.2 M-KC1 for 7 min at 4 °C after SDS-PAGE. The protein band was
excised, washed three times in cold distilled water, frozen at - 2 0 °C,
and eluted using a Bio-Rad Electro-eluter at 10 mA/tube, with constant
current for 5 h. The purified protein was dialysed overnight against
distilled water and then lyophilized. Purity of the eluted protein was
checked by analytical SDS--PAGE. Coomassie blue staining of the
purified P1 protein in SDS-PAGE revealed a single band of 36 kDa.
The antisera to ZYMV FL/AT (#1181) and RU (#1186) P1 proteins
were prepared in rabbits by an initial immunization with 2 mg of
antigen emulsified in Freund's complete adjuvant. Subsequent injections with Freund's incomplete adjuvant consisted of intramuscular
injections of 1 or 2 mg at 2 weeks, 3 weeks and 4~7 months after the first
injection.
Western blotting procedure. The Western blotting procedure was
conducted essentially as described by Towbin et al. (1979) using a BioRad Mini-PROTEAN II electrophoresis cell and Bio-Rad Trans-Blot
electrophoretic transfer cell. Blocking solutions contained E. co# lysate
at 1 mg/ml and extracts from non-infected plants (prepared by
triturating leaf tissue in water; 1:9 w/v).
Young, symptomatic leaves of inoculated test plants were harvested
between days 5 and 21 post-inoculation. Extracts for immunoblots
were prepared by triturating leaf tissue in extraction buffer (ES buffer;
Rodriguez-Cerezo & Shaw, 1991). The ES buffer consisted of 75 mMTris-HC1 pH 6.1 containing 9 M-urea, 7.5 % 2-mercaptoethanol and
4.5 % SDS. One part plant tissue was triturated in a mortar and pestle
with 2 parts of ES buffer. The triturate was squeezed through a single
39
layer of moistened cheesecloth, boiled for 2 min and centrifuged at
5000 g for 5 rain. Centrifuged samples were stored at - 20 °C. Each
isolate was tested from at least two different sources of tissue.
In vitro translation and immunoprecipitation. The wheat germ in vitro
translation procedure was the same as described by Cline et al. (1985).
RNA (3 ~tg) from ZYMV FL/AT, in a 50 ktl wheat germ extract
mixture containing 40 I~Ci of [*H]leucine was incubated at 25 °C for
60 min. Immunoprecipitation analyses were performed as described by
Dougherty & Hiebert (1980). Precipitated products were separated by
SDS-PAGE on a 10 % polyacrylamide gel and detected on dried gels
by fluorography as described by Bonnet & Lasky (1974). Antisera used
for immunoprecipitation of in vitro translation products were to PI and
CP of ZYMV and to HC/Pro of PRSV W.
Light microscopy and immunofluorescence tests. Indirect immunofluorescence tests were conducted as described by Hiebert et aL (1984)
with some modifications. Six tal of I0 % DMSO in PBS, 27 txl of healthy
plant extract (diluted l/10 in PBS containing 1% ovalbumin) and 27 ~tl
of antiserum were incubated together for 30 min prior to addition of
epidermal strips from plant tissue. Epidermal strips were incubated in
the antibody preparation in a 1.5 ml microfuge tube after vortexing for
10 s. Tissue was incubated in the antibody solution on a shaker for
3-4 h at room temperature in the dark. Rinsing between steps was done
twice in 1 ml of TBST (20 mM-Tri~HC1, 150 mM-NaC1, 0.1% Tween
20 pH 7.2) after vortexing for 10 s and once for 1 h in PBS while
shaking at room temperature in the dark. Rhodamine-conjugated
Protein A (Sigma) was used as a fluorescent probe. The rhodamine
conjugate was diluted 1 g/ml in PBS. The conjugate (8 pl) was then
mixed with 40 ktl of 10 % DMSO and 352 Ixl of PBS. After vortexing,
rinsed tissue was incubated in this solution at room temperature for
3-4 h in the dark while shaking. After a final rinse, tissue was mounted
on microscope slides using Aqua-mount (Lerner Laboratories).
'Crimson Sweet' watermelon was used as the host for immunofluorescence tests. Tissue sections were photographed with epifluorescence optics using a Nikon Fluophot microscope with a G2A filter.
Results
Similarities between the P1 of Z Y M V isolates
Sequence comparisons were made between the P1encoding regions of five ZYMV isolates, CA, RU,
FL/AT, SV and MD. The sequences of P1 from ZYMV
SV and MD were derived from clones produced by
reverse transcriptase (RT)-PCR using custom primers
for P1. An agarose gel comparison of P1 products from
RT-PCR for MD (mild) and SV (severe) isolates showed
a size difference between the two, with the mild being
slightly larger (Fig. 1). Amino acid sequence comparisons
revealed a six residue insert (corresponding to a larger
P1, see below) in the MD isolate immediately following
the initiation codon (Fig. 2). The P1 sequences for the
ZYMV FL/AT, SV and MD isolates were quite similar,
with a nucleotide sequence similarity of 98 % between
FL/AT and SV, and a 95 % sequence similarity between
FL/AT and MD. The P1 of ZYMV CA had a high
degree of similarity compared to FL/AT (96 %), whereas
RU was highly divergent, with only a 60 % nucleotide
sequence similarity compared to the P1 of FL/AT (Table
1). The ZYMV FL/AT P1 was also compared to the P1
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00
40
G. C. Wisler, D. E. Purcifull and E. Hiebert
1
2
3
FL/AT
MD
RU
bp
SV
CA
1
M ...... ASI MIGSISVpTA
.R I Q A L H . . . . . . . . . . . . . . .
. - ..... .A ..........
V
50
KTKQCANTQV
SNRVNIVAPG
~4ATCPLPLK
EH . . . . . . . . . . . . . . . . . . .
I ......
ESAR. .TV.T G ..........
V.V.KPQM.
. - .....
. . . . . . . . . . . . . . .
E . . . . . . . . . . .
.- .....
. . . . . . . . . . . . . . .
E . . . . . . . . . .
1636
SV
. . . . . . . . . . . . . . . . .
- . . . . . . . . . . . .
- . . . . . . . . . . . . . . . . . . .
CA
. . . . . . . . . . . . . . . . .
- . . . . . . . . . . . .
- . . . . . . . . . . . . .
150
TVFLEGNYDD
SITNLARVLP
A ...................
LPWRVYATVT
.. I. T F T D E R
SV
. . . . . . . . . . . . . . . . . . . . . . . . .
E.
A . . . . . . . . . . .
CA
. . . . . . . . . . . . . . . . . . . . . . . . .
E.
A . . . . . . . . . . . . . . . . . . .
FL/AT
MD
RU
151
FL/AT
MD
RU
506
396
344
298
Table 1. Nucleotide and amino acid sequence similarities
for the P1, P2 (HC/Pro) and P3 regions of four
Z Y M V isolates and five distinct potyviruses with respect
to Z Y M V F L / A T
Nucleotide (amino acid)
sequence similarity (%)*
Virus isolatet
ZYMV CA
SV
MD
RU
TEV
PVY N strain
TVMV
Plum pox virus
Pea seedborne mosaic virus
Pl
P2
P3
96 (97)
98 (97)
95 (97)
60 (70)
42 (45)
37 (46)
39 (48)
41 (38)
39 (37)
98 (98)
ND
ND
88 (96)
52 (63)
51 (64)
52 (64)
52 (65)
50 (58)
98 (99)
NO
NO
84 (96)
43 (54)
44 (49)
44 (52)
45 (50)
45 (52)
* Similarities were determined using the GCG Gap alignment
program.
t The sequences for the distinct potyviruses were from the GenBank
database.
ND, Not determined.
of five distinct potyviruses and similarities ranged from
3 7 4 2 % (Table 1).
Of 11 amino acid differences in P1 of the ZYMV SV
isolate compared to F L / A T , five were polar (Fig. 2;
positions 23, 35, 129, 144 and 262). In addition there was
a deletion of a histidine residue at P1 position 41 in the
SV isolate. There were six additional amino acids at the
N terminus, plus nine different amino acids, for MD
when compared to F L / A T (Fig. 2). Seven of these
pEVTHNVDVS
LTSSFYKRTY
. . . . . . . . . . . . .
NGIA-NS--.
. . . . . . . . . . . . .
.A
. . . . . . . . .
201
NKNIPVEMIG
KKERKKVAQK
QIVQAP-LNS
P . . . . . . . . . . . . . . . . . . . . . .
.R.P .... SC
SV
CA
FL/AT
MD
RU
Fig. 1. Electrophoretic gel (0.9 % agarose) analysis of PCR products of
P1 from ZYMV MD (lane 1) and SV (lane 2) using primers specific for
the P1 coding region. The arrow on the left indicates the PCR products
of approximately 930 bp. Lane 3 contains 1 kbp ladder markers, with
approximate sizes given on the right (kbp).
L .....
GRIVLRKPSK
QRVFARIEQD
--E-AARKKE
...A .....................
E.
. .M I L . . . R A ... L E . . S F E K I . K G . E R Q V
101
1018
- .........
. . . . . . . . . . . . . . . .
100
-EI~FRLTRN
~SKVKKGPS
- .... S V . . . . . . . . . . . . .
P..R ...............
N
FL/AT
MD
RU
2036
S..P..
A
~ E S K
KLMQSNK-SI
DILNNFFSTD
.................
- ............
S.S..K.A.E
..SKQASE..
N...S..D..
51
R..K..IVCE
IS
......
200
LCTRVLKIAR
- . . . . . . . . . . . . .
NV.RSASV.N
. .D
.......
P . . . . . . . . . . . . . . . . . . . . . .
- . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . .
- . . . . . . . . . . . . .
R.P
NKKARHTLTF
KRFRGYFVGK
*
VSVAHEEGRM
250
RRTE~ISYEQF
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
E .........
K..N .......
N.K.S.I
....
L.. .R.Q.
.HV
.......
SV
. . . . . . . . . . . . . . . . . . . . . . . . .
C . . . . . . . . . . . . . . . . . . . . . . . .
CA
. . . . . . . . . . . . .
C . . . . . . . . . . . . . . .
T . . . . . . . . . . .
FL/AT
251
KWILKAICQV
THTERIREED
RU
GF..Q...R.
.N.RCV.D
P . . . . .
*
IKPGCSGWVL
GTNHTLTKRY
.............
DD.E..QKF
H ........
300
SRLPHLV~R~
. .PC-.
SV
.....
CA
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
....
Y . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
301
FL/AT
MD
RU
RDDDGIVNAL
EQVLFYS
. . . . . . . . . . . .
...E .......
P.F..D
SV
. . . . . . . . . . . .
CA
. . . . . . . . . . . . . . . . .
Fig. 2. Amino acid sequence alignment of the P1 proteins of five
ZYMV isolates: FL/AT, MD, RU, SV and CA. Conserved residues
among ZYMV isolates are represented by (.) and missing residues by
( - ) . Underlined sequences indicate conserved residues among potyviruses. ZYMV MD and SV terminate at EQ due to primer selection
for PCR. The histidine and serine residues implicated in P1 protease
activity (Verchot et al., 1991) are designated by (*). Polar amino acid
residues for ZYMV SV at positions 23, 35, 129, 144 and 262 differ from
the FL/AT isolate sequence. Seven of the 16 differing amino acid
residues of the MD isolate compared to FL/AT contributed to the
charge or polarity of the protein (positions 2, 4, 7, 23, 24, 86 and 129).
contributed to the charge or polarity of the protein (Fig.
2; positions 2, 4, 7, 23, 24, 86 and 129). In spite of the
variability seen among the P1 coding regions for five
ZYMV isolates, certain consensus sequences of amino
acids believed to be involved or required for protease
activity of P1 were conserved. For example, all five
isolates had the conserved histidine residue at position
235, and the serine residue at position 276 within the
amino acid consensus sequence GXSG (Fig. 2). The
conserved potyvirus sequence of FIVRG (Verchot et al.,
1991) close to the P1/P2 cleavage site, was slightly
different, with a sequence of LVIRG for all five isolates
(Fig. 2).
Detection of P1 prote#7 #z plants infected with Z Y M V
Extracts of ZYMV-infected tissues with ES buffer gave
satisfactory reactions in Western blots using antiserum
to P1 of ZYMV F L / A T or RU as a probe. The F L / A T
antiserum reacted specifically to a protein of around
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00
41
Z Y M V P1 protein characterization
~
~
~
N
~
N
=
Z
~
U
[.-
~
N
N
N
N
,~
N
N
kDa
200
97
68
43
29
18
Fig. 3. Characterization of the reactions of the Pl-related proteins of 22 isolates of ZYMV in Western blots. Blots were probed with
antiserum # 1181 to the P 1 protein of ZYMV FL/AT. The isolate is identified above each lane. Prestained molecular mass markers are
shown in the right-hand lane, and the approximate values are indicated. The reaction of tissue extract from mock-inoculated plants
is also shown (mock lane).
(a)
(b)
(a)
(b)
kDa
- 200
97
-
-q97
-
68
-q68
--
43
:~-
-~ 43
-'129
Fig. 4. Western blots of extracts from plants singly infected with
selected ZYMV isolates. Blots were probed with the antiserum to P1 of
ZYMV R U (#1186) (a) and to P1 of ZYMV F L / A T (#1181) (b). The
ZYMV isolates are identified above each lane. The reaction at around
68 kDa with antiserum to the P 1 of ZYMV R U (# 1186) was also seen
with preimmune serum from the same rabbit. The positions of
prestained molecular mass markers are indicated on the right. The
reaction to tissue extract from mock-inoculated plants is also shown.
34 kDa in plant tissue infected with ZYMV F L / A T (Fig.
3). No protein was detected in extracts from healthy
plant tissues. Western blots with preimmune serum for
ZYMV F L / A T did not result in a detectable protein
reaction, whereas a prominent band of approximately
68 kDa was observed for RU preimmune serum (data
not shown) as well as for the immune serum #1186 (Fig.
4a). Heterogeneity was seen in the size of the P1 protein
among some of the other ZYMV isolates used in this
study (Fig. 3). The approximate size for the P1 protein
ranged from 35 kDa (five isolates) to 33 kDa (five
isolates). A larger protein of around 35 kDa was noted
29
Fig. 5. Western blots of extracts from plants singly infected with
selected ZYMV isolates. Blots were probed with the antiserum to P1 (a)
of ZYMV F L / A T (#1181) and to H C / P r o (P2) (b) o f P R S V W. Arrow
indicates the position of the 88 kDa protein of isolate FC-3182, which
reacted with both P 1 and H C / P r o antisera. The positions of prestained
molecular mass markers are indicated on the right. Healthy refers to
the tissue extract from mock-inoculated plants.
for three Florida isolates including MD, and for the
three isolates from France. P 1 products that were slightly
smaller than that ofZYMV F L / A T included the Florida
isolate SV and the isolates from Italy, Reunion Island,
Taiwan, Egypt and Connecticut. In addition to size
differences of the P1 protein, some isolates showed
possible breakdown products of about 31-33 kDa and
26-27 kDa, whereas for other isolates (FC-3182, weak
and El5) some extracts showed an 88 kDa product
(Figs 3 and 5) presumed to be due to incomplete
processing of P1 and HC/Pro. The 88 kDa product was
not detected consistently, however (for example, isolate
FC-3182 in Fig. 4). This product for FC-3182 also
reacted with antiserum to the HC/Pro of PRSV W (Fig.
5).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00
42
G. C. Wisler, D. E. Purcifull and E. Hiebert
~<
N
~
~
~
~
o
~
..-
kDa
200
97
68
43
29
18
: :
:: .:
Fig. 6. Specificity of antiserum (#1181) to P1 of ZYMV FL/AT in
Western blots. Extracts from samples infected with ZYMV FL/AT
show a prominent band at approximately 34 kDa and a weak band at
around 26 kDa. Note the lack of reactivitywith extracts from pumpkin
singly infectedwith any of three potyviruses(PRSV W, WMV-2, 2932),
a cucumovirus (CMV), a possible potexvirus (FC-1860) or from noninoculated pumpkin leaves (Mock).
kDa
200
97
68
"152
43
"~34
29
18
14
Fig. 7. Immunoprecipitation of wheat germ in vitro translation
products. TP, total products; P1, products immunoprecipitated with
ZYMV FL/AT P1 antiserum; AI, products immunoprecipitated with
antiserum to the HC/Pro of PRSV W; CP, products immunoprecipitated with antiserum to the CP of ZYMV FL/AT; NS, products
immunoprecipitated with preimmune serum. The positions of molecular mass markers (lane M) are indicated on the left.
The size differences between the P1 proteins of Z Y M V
F L / A T , M D and SV were consistent regardless of the
host used for Western blot assays. These three isolates
were tested in pumpkin, watermelon, cantaloupe and
squash (data not shown).
In addition to size differences noted for the P1 proteins
for the various Z Y M V isolates, some differences were
also noted in the reactivity of the two P1 sera. O f the
Z Y M V isolates tested in this study, RU-, SV- a n d ' Italy'infected tissue extracts reacted weakly or not at all with
the antiserum (#1181) to the P1 of F L / A T (Fig. 3 and
4b). The R U isolate extracts did react strongly with
antisera to CP of F L / A T , and to the CI protein and
H C / P r o of PRSV W in Western blots (data not shown).
The antiserum (#1186) to P1 of Z Y M V R U (after a
booster immunization) reacted strongly with RU-infected tissue extracts as well as with extracts from Z Y M V
isolates F L / A T , Italy, M D and SV (Fig. 4a).
Extracts from pumpkin singly infected with any of
several other viruses that infect cucurbits but are distinct
from Z Y M V were also tested in Western blots. These
included PRSV W, WMV-2, an unnamed potyvirus (FC2932) that is antigenically different from ZYMV, PSRV
W and WMV-2 (Purcifull et al., 1991), CMV and a
possible potexvirus of cucurbits (FC-1860; Purcifull et
al., 1988). All of these extracts were negative in Western
blot tests when tested against the antiserum to the P1 of
Z Y M V F L / A T (Fig. 6) and R U (data not shown).
Immunoprecipitation analysis of in vitro translation
products
Translation products obtained in the wheat germ in vitro
translation system, immunoprecipitated with antisera to
P1 and CP of Z Y M V F L / A T , to H C / P r o of PRSV W,
and with preimmune serum, were analysed by S D S PAGE. Only the P1 and H C / P r o were found to be
present in total translation products (Fig. 7). The antisera
to P1 and H C / P r o precipitated products of the appropriate molecular mass for each, 34 and 52 kDa,
respectively. Neither the CP nor preimmune serum
precipitated a protein product. Interestingly, the P1
antiserum also precipitated a smaller product of 25 k D a
which may be similar to the possible breakdown product
usually seen in immunoblots for that isolate.
Detection of P1 protein by indirect immunofluorescence
Fluorescence microscopy, using the P 1 protein antiserum
labelled with rhodamine-conjugated Protein A, showed
the presence of aggregates in the cytoplasm of epidermal
strips from ZYMV-infected watermelon. Z Y M V isolate
F L / A T showed accumulation of amorphous aggregates
with particulate fluorescing bodies in cells of epidermal
tissues when tested with the P1 antiserum of F L / A T
(Fig. 8 a). Similar results were seen with Z Y M V isolates
SV and FC-3182. Epidermal strips of plants infected
with Z Y M V F L / A T showed no fluorescence with
preimmune serum as a probe (Fig. 8 b), but aggregates
could be seen unstained in epidermal tissue. Epidermal
strips of Z Y M V SV- and FC-3182-infected plants also
did not show fluorescence when treated with preimmune
serum. Tissues of watermelon infected with Z Y M V R U
and healthy watermelon (mock-inoculated) were nega-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00
ZYMV
P1 protein characterization
43
Fig. 8. Immunofluorescenceof watermelon stem tissue infectedwith ZYMV FL/AT and probed with antiserum (#1181) to ZYMV
FL/AT P1 (a) and to normal serum (b). The antigen-antibody reaction was detected with rhodamine-protein A conjugate and
photographed with epifluorescenceoptics. The localization of P 1 is shown by the specificimmunofluorescenceof granular aggregates
in (a). The scale bars represent 100 gm.
tive for fluorescence with both antiserum to the P1 of
ZYMV F L / A T and preimmune sera (data not shown).
Discussion
The P1 coding region for four ZYMV isolates, three
from Florida and one from California, showed a high
nucleotide and deduced amino acid sequence similarity.
However, the P1 coding region for a ZYMV isolate from
Reunion Island had a low (60%) nucleotide sequence
similarity compared to these four ZYMV isolates. In
contrast, the H C / P r o (P2) and P3 genes of ZYMV R U
had 88% and 84% nucleotide sequence similarities,
respectively, compared to F L / A T and CA (Table 1;
Baker et al., 1992). In addition, the sequence of the CP
gene of R U is 88 % similar to that of CA (Baker et al.,
1991). According to the criteria set out by Shukla et al.
(1991), the nucleotide sequence similarity of the P1 gene
from R U compared to the P1 gene of other Z Y M V
isolates (60 %) could classify it as a distinct potyvirus,
whereas the sequence similarities of other regions of the
ZYMV R U genome (84-88%) are close to those
expected for an isolate of the same virus. It appears that
the sequence similarity from one area of the potyvirus
genome does not always predict the degree of sequence
similarity in other coding areas.
Nucleotide sequence similarities between the P1 gene
of Z Y M V F L / A T and those of five other potyviruses
ranged fronl 37 % to 42 % (Table 1). These similarities
also were lower than those for the H C / P r o (50-52%)
and P3 (43-45 %) genes compared to ZYMV F L / A T
(Table 1). These data are in agreement with Shukla et al.
(1991) in that the percentage sequence similarity between
distinct potyviruses is low, and that P1 is less conserved
than the H C / P r o - or P3-encoding region. The hypervariable regions of the potyviral genome, based on
comparisons of different potyviruses, also show variability at the virus strain/isolate level (Thole et al., 1993).
Antibodies produced to these hypervariable regions in
the potyviral genome have a potential to serve as very
specific probes for rapid identification of potyviral strains
(Purcifull & Hiebert, 1992).
Despite the high degree of sequence similarity among
four ZYMV isolates in the P1 coding region, significant
differences were detectable by S D S - P A G E and these
may be exploited in distinguishing these isolates. For
example, the additional 18 nucleotides in the 5' terminus
of the P1 gene of Z Y M V M D code for six additional
amino acids and result in a P1 product which is readily
resolved in Western blot analysis using antiserum to P1
of F L / A T . Some Z Y M V isolates also had a slightly
smaller P1 product. The SV isolate P1 differs from the
type isolate by the absence of a single histidine residue as
well as having a slightly smaller P1 by SDS-PAGE. Since
the P1 protein o f Z Y M V SV has only one less amino acid
residue, the smaller size of P1 seen in S D S - P A G E may
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00
44
G. C. Wisler, D. E. Purcifull and E. Hiebert
be due to the charge effect on mobility as a result of the
loss of the histidine. Sequence information is not
available for the other isolates with a smaller P1 protein
so we do not know whether this is due to deletions or to
amino acid residue differences which affect the mobility
in SDS PAGE analysis. Other variations such as
incomplete processing of the P1-HC/Pro polypeptides
and breakdown products of the P1 protein were evident
for some ZYMV isolates in the Western blot analysis and
are presumably due to sequence variations in the P1
coding region.
The amino acid residues for the N-terminal region of
P1 proteins of the five ZYMV isolates in this study were
less conserved than those in their C-terminal regions.
The additional six amino acids of ZYMV MD directly
followed the methionine at the N terminus. Most of the
changes in amino acids in both ZYMV MD and SV are
also in their respective N-terminal region, including the
histidine missing from the SV isolate.
The amino acid residue histidine, the serine residue
within the amino acid consensus sequence (GXSGS) and
a five amino acid motif (LVIRG) (Fig, 2) in the Cterminal half of P1, determined by Verchot et al. (1991)
to be essential for protease activity, were conserved in all
sequenced ZYMV isolates. Although the consensus
sequence LVIRG was the same for all ZYMV isolates, it
was slightly different from that (FIVRG) for 5 distinct
potyviruses (Verchot et al., 1991). The Y/S or D cleavage
sites between P1 and P2 (HC/Pro) were also conserved
among the ZYMV isolates.
The ZYMV P1 accumulates in infected cells to form
inclusions (Fig. 8) as do other non-structural potyviral
proteins (for example CI proteins). Further analysis by
electron microscopy is needed to determine the precise
morphology of the aggregates and their possible association with other viral proteins or with host components.
The antisera developed in this study have been useful
for detecting variability of ZYMV isolates by immunoblotting. There were differences between isolates in the
size of the P1 proteins, in the reactivity of the P1
proteins, in the presence of breakdown products and in
the incomplete processing of the P1 and HC/Pro
polyprotein. The antiserum to the P1 of ZYMV F L / A T
or RU did not react with extracts from plants infected
individually with three other potyviruses, one cucumovirus, or one potexvirus. Serological (polyclonal) probes
prepared to ZYMV P1 protein not only enable the clear
distinction of ZYMV from other potyviruses but may
also be used to characterize ZYMV strains.
The variation in the P1 coding region of the ZYMV
isolates also has been noted for other potyviruses
(Verchot et al., 1991; Thole et al., 1993; Duan et al.,
1993) and has led to speculation that the P1 may be
associated with virus-host interactions. Further studies
to elucidate this possible involvement of P1 in host
response will involve the use of full-length infectious
transcripts. With these transcripts the P1 from different
isolates could be interchanged to determine the possible
effects on the host response.
We are grateful to Kris Beckham, Eugene Crawford and Maureen
Petersen for expert technical assistance. This work was supported by
BARD US 1390-1987, USDA/CSRS CBAG 9003131 and Florida High
Technology and Industry Council grants. Florida Agricultural Experiment Station Journal Series Paper #R-03743.
References
BAKER, C. A., WISLER, G. C., MARLOW, G. C., HIEBERT, E. & LECOQ,
H. (1991). Sequence analysis at the 5'-end of three cucurbit
potyviruses. Phytopathology 81, 1222.
BAKER, C. A., HIEBERT, E., MARLOW, G. C. • WISLER, G. C. (1992).
Comparative sequence analysis of the Reunion isolate of zucchini
yellow mosaic virus. Phytopathology 82, 1176.
BALINT, R., PLOOY, I. & STEELE, C. (1990). The nucleotide sequence of
zucchini yellow mosaic virus. VIIIth bzternational Congress of
Virology, Berlin, Germany, abstract P84-017.
BONNER, W. M. & LASKY, R. A. (1974). A film detection method for
tritium-labeled proteins and nucleic acids in polyacrylamide gels.
European Journal of Biochemistry 46, 83 88.
BRANTLEY, J. D. & HUNT, A. G. (1993). The N-terminal protein of the
polyprotein encoded by the potyvirus tobacco vein mottling virus is
an RNA-binding protein. Journal of General Virology74, 1157 1162.
CANTO, T., ELLIS, P., BOWLER, G. & LOPEZ-ABELLA, D. (1994).
Monoclonal antibodies to potato virus y (PVY) helper component
are useful for PVY strain identification. Phytopathology 84, 1222.
CLINE, K., WERNER-WASHBURNE,M., LUBBEN,T. H. & KEEGSTRA, K.
(1985). Precursors to two nuclear-encoded chloroplast proteins bind
to the outer envelope membrane before being imported into
chloroplasts. Journal of Biological Chemistry 260, 3691-3696.
DAvis, R. F. & YILMAZ, M. A. (1984). Serological relationships and
host range properties of ZYMV and WMV-2 isolates. Phytopathology 74, 848.
DE MEJIA, M. V. G., HIEBERT, E., PURCIFULL, D. E., THORNBURY, D.
W. 8c PIRONE, T. P. (1985). Identification of potyviral amorphous
inclusion protein as a nonstructural, virus-specific product related to
helper component. Virology 142, 34-43.
DOUGHERTY, W. G. & HIEBERT, E. (1980). Translation of potyvirus
RNA in a rabbit reticulocyte lysate: reaction conditions and
identification of capsid protein as one of the products of in vitro
translation of tobacco etch and pepper mottle viral RNAs. Virology
101,466-474.
DUAN, Y. P., PURCIFULL, D. E. & HIEBERT, E. (1993). Characterization
of the P1 protein of papaya ringspot virus type W. Vlth International
Congress of Plant Pathology, Montreal, Canada, abstract 17.2.8.
HIEBERT, E. & DOUGHERTY,W. G. (1988). Organization and expression
of the viral genome. In The Viruses: Filamentous Viruses, pp.
159-178. Edited by R. G. Milne. New York: Plenum Press.
HIEBERT, E., PURCIFULL D. E. & CHRISTIE, R. G. (1984). Purification
and immunological analysis of plant viral inclusion bodies. In
Methods in Virology, vol. 8, pp. 225 280. Edited by K. Maramorosh
& H. Koprowski. New York: Academic Press.
HUANG, C. H., HSEU, S. H. & CHAO, Y. T. (1986). Purification and
serology of an isolate of zucchini yellow mosaic virus. Journal of
Agricultural Research of China 35, 495-503.
LECOQ, H. & PITRAT, M. (1985). Specificity of the helper-componentmediated aphid transmission of three potyviruses infecting muskmelon. Phytopathology 75, 890-893.
LECOQ, H. & PURCIEULL, D.E. (1992). Biological variability of
potyviruses, an example: zucchini yellow mosaic virus. Archives of
Virology Supplementum 5, 229-234.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00
ZYMV
LECOQ, H., BOWDEN,D., RACCAH, B., HIEEERT, E. & PURCIFULL, D. E.
(1991). Characterization of a zucchini yellow mosaic virus isolate
with a deficient helper component. Phytopathology 81, 1087-1091.
LISA, V. & LECOQ, H. (1984). Zucchini yellow mosaic virus. CMI/AAB
Descriptions of Plant Viruses, no. 282.
MCCARTY, D. R., HATTORI, Z., CARSON, C. B., VASIL, V., LAZAR, M.
VASIL,I. K. (1991). The viviparous- 1 developmental gene of maize
encodes a novel transcriptional activator. Cell 66, 895 905.
PETERSEN, M. A., EDWARDSON, J. R., LECOQ, H. & PURCIFULL, D. E.
(1991). Morphological variation of inclusions induced by zucchini
yellow mosaic virus isolates. Phytopathology 71, 1218.
PURCIVULL, D.E. & HtEBERT, E. (1992). Serological relationships
involving potyviral nonstructural proteins. Archives of Virology
Supplementum 5, 97 122.
PURCIFULL, D.E., ADLERZ, W.C., SIMONE, G.W., HIEBERT, E. &
CHRISTIE,S. R. (1984). Serological relationships and partial characterization of zucchini yellow mosaic virus isolated from squash in
Florida. Plant Disease 68, 230-233.
PURCIFULL, D. E., SIMONE,G. W., BAKER, C. A. & HIEBERT, E. (1988).
Immunodiffusion tests for six viruses that infect cucurbits in Florida.
Proceedings of Florida State Horticultural Society 101,400-403.
PURCIFULL, D. E., HIEBERT, E., PETERSEN, M.A., SIMONE, G.W. &
GOOCH, M. D. (1991 ). Partial characterization of a potyvirus isolated
from watermelon (Citrullus lanatus) in Florida. Phytopathology 81,
1244.
ROBERTSON, N. L., FRENCH, R. & GRAY, S. M. (1991). Use of groupspecific primers and the polymerase chain reaction for the detection
and identification of luteoviruses. Journal of General Virology 72,
1473-1477.
RODRIGUEZ-CEREZO, E. & SHAW, J.G. (1991). Two newly detected
nonstructural viral proteins in potyvirus-infected cells. Virology 185,
572 579.
SANGER,F., NICKLEN, S. & COULSON, A. R. (1977). DNA sequencing
with chain-terminating inhibitors. Proceedings of the National
Academy of Sciences, USA 74, 5463-5467.
SHORT, J. M., FERNANDEZ, J. M., SORGE, J. A. ~¢ HUSE, W. D. (1988).
P1 protein characterization
45
Lambda Zap: a bacteriophage lambda expression vector with in vivo
excision properties. Nucleic Acids Research 16, 7583 7599.
SHUKLA, D. D., FRENKEL, M. J. & WARD, C. W. (1991). Structure and
function of the potyvirus genome with special reference to the coat
protein coding region. Canadian Journal of Plant Pathology 13,
178-191.
SOMOWIYARJO,S., SAKO,N. & NONAKA,F. (1989). Dot-immunobinding
assay for zucchini yellow mosaic virus using polyclonal and
monoclonal antibodies. Annals of the Phytopathological Society of
Japan 55, 56-63.
STUDIER, F. W., ROSENBERG,A. H., DUNN, J. J. & DUBENDOREE, J. W.
(1990). Use of T7 RNA polymerase to direct expression of cloned
genes. Methods in En~vmology 185, 60-88.
SUZUKI, N., SHIRAKO,Y. & EHARA, Y. (1988). Isolation and serological
comparisons of virus-coded proteins of three potyviruses infecting
cucurbitaceous plants. Vth International Congress of Plant Pathology,
Kyoto, Japan, abstract p. 66.
THOLE, V., DALMAY,T., BLrRGYAN,J. & BALAZS,E. (1993). Cloning and
sequencing of potato virus-Y (Hungarian isolate) genomic RNA.
Gene 123, 149-156.
TOWBIN, H., STAEHELIN, T. & GORDON, J. (1979). Electrophoretic
transfer of proteins from polyacrylamide gels to nitrocellulose
sheets: procedure and some applications. Proceedings of the National
Academy of Sciences, USA 76, 4350~4354.
VERCHOT,J., KOONIN,E. V. & CARRINGTON,J. C. (1991). The 35-kDa
protein from the N-terminus of a potyviral polyprotein functions as
a third virus-encoded proteinase. Virology 185, 527-535.
WANG,H. L., GONSALVES,D., PROVVIDENTI,R. & ZITTER,T. A. (1992).
Comparative biological and serological properties of four strains of
zucchini yellow mosaic virus. Plant Disease 76, 530-535.
YEH, S.-D., WANG, C.-H. & CHEN, M.-J. (1992). Detection and
immunological analysis of a 112k protein of papaya ringspot virus
produced hi vivo. Botanical Bulletin Academia Sinica 33, 1-8.
(Received 18 March 1994; Accepted 8 September 1994)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 06:16:00