From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
HEMATOPOIESIS AND STEM CELLS
Estrogen receptor signaling promotes dendritic cell differentiation by increasing
expression of the transcription factor IRF4
Esther Carreras,1 Sean Turner,1 Mark Barton Frank,1,2 Nicholas Knowlton,1,2 Jeanette Osban,1,2 Michael Centola,1
Chae Gyu Park,3 Amie Simmons,4 José Alberola-Ila,4 and Susan Kovats1
1Arthritis
& Immunology Program, and 2Microarray Research Facility, Oklahoma Medical Research Foundation, Oklahoma City; 3Laboratory of Cellular
Physiology and Immunology, The Rockefeller University, New York, NY; and 4Immunobiology & Cancer Program, Oklahoma Medical Research Foundation,
Oklahoma City
During inflammation, elevated granulocyte macrophage–colony-stimulating factor (GM-CSF) directs the development of
new dendritic cells (DCs). This pathway is
influenced by environmental factors, and
we previously showed that physiologic
levels of estradiol, acting through estrogen receptor alpha (ER␣), promote the
GM-CSF–mediated differentiation of a
CD11bⴙ DC subset from myeloid progeni-
tors (MPs). We now have identified interferon regulatory factor 4 (IRF4), a transcription factor induced by GM-CSF and
critical for CD11bⴙ DC development in
vivo, as a target of ER␣ signaling during
this process. In MPs, ER␣ potentiates and
sustains GM-CSF induction of IRF4. Furthermore, retroviral delivery of the Irf4
cDNA to undifferentiated ER␣ⴚ/ⴚ bone
marrow cells restored the development of
the estradiol/ER␣-dependent DC population, indicating that an elevated amount
of IRF4 protein substitutes for ER␣ signaling. Thus at an early stage in the MP
response to GM-CSF, ER␣ signaling induces an elevated amount of IRF4, which
leads to a developmental program underlying CD11bⴙ DC differentiation. (Blood.
2010;115:238-246)
Introduction
Dendritic cell (DC) subsets in vivo are distinguished based on
location, surface markers, function, and migratory capacity, and
whether they are present in steady-state conditions or develop as a
consequence of inflammation.1 In non–lymphoid tissues such as
dermis and lung, 2 major populations of CD11c⫹ MHCII⫹ DCs
have been identified as CD11bhi CD103⫺ and CD11blo CD103⫹
⫹ or ⫺ 2,3
Langerin
. These interstitial DCs derive from monocytes or
blood-borne precursors that seed tissue, while a distinct population
of epidermal Langerin⫹ DCs (LCs) are replenished slowly from
local self-renewing precursors. The cytokines that mediate the
development of interstitial DCs during homeostasis are not defined,
and may include Flt3 ligand or micro amounts of granulocyte
macrophage–colony-stimulating factor (GM-CSF) or M-CSF
present in non–lymphoid tissue.3 During inflammation, DC differentiation from Gr-1hi monocytes is largely mediated by elevated
amounts of GM-CSF.4 This GM-CSF–driven pathway is elevated
in infection and autoimmune disease and leads to the appearance of
de novo DC populations in lymphoid organs and tissues.1,5 In
culture models, GM-CSF mediates CD11b⫹ DC differentiation
from monocytes and myeloid progenitors (MPs), and a subset of
the CD11bint DCs express Langerin.6,7 However, it remains unclear
how these DCs relate to Langerin⫹ epidermal LCs or populations
of CD11b⫹ or Langerin⫹ interstitial DCs.
The lineage fate of hematopoietic progenitor cells is determined
by ordered expression of transcription factors and receptor tyrosine
kinases such as Flt3, yet the molecular steps involved in the
development of specific DC subtypes from common precursors,
including myeloid and lymphoid progenitors, pro-DCs, and monocytes, are not completely defined. Genetic analyses have identified
several transcription factors, including Irf4, to be crucial for
development of specific DC subsets found in lymphoid organs.3
For example, mice deficient in relB, PU.1, or interferon regulatory
factor 4 (IRF4) lack splenic CD11bhi CD8␣⫺ CD4⫹ DCs, whereas
mice deficient in IRF8 lack splenic CD8␣⫹ CD4⫺ CD11b⫺ DCs
and plasmacytoid DCs. IRF4 also is necessary for the development
of MHC class II⫹ DCs during GM-CSF–mediated differentiation
from murine bone marrow (BM) or human monocytes in vitro.8-10
Less is known about transcription factor requirements for tissue
DCs, and factors directing the development of recently defined
interstitial CD11b⫹ or CD103⫹ Langerin⫹ DCs have not been
reported. Analyses of IRF4⫺/⫺ mice did not include assessments of
tissue DCs.8,9
Transcription factor dosage is often important in cell fate
specification. Relevant to our study, quantitatively different levels
of IRF4 protein alter B-cell differentiation pathways.11 IRF4 acts
alone or dimerizes with PU.1 or Spi-B to mediate transcription.12
Quantitative differences in PU.1 in hematopoietic progenitors also
lead to alternate myeloid or lymphoid fates.13,14 Thus, IRF4 and
PU.1 act as dosage-sensitive regulators to instruct distinct cell
differentiation programs, and therefore, factors (eg, hormones or
other transcription factors15,16) that regulate IRF4 expression are
likely to alter IRF4-mediated developmental pathways.
Environmental stimuli can influence DC differentiation, and we
previously have defined a role for estrogen receptor (ER) signaling
in DC development.17 ERs are ligand-dependent transcription
factors that regulate gene expression by forming complexes with
chromatin-modifying coregulators.18 Immune cells and their progenitors express ERs, suggesting that ER-mediated responses to
Submitted August 4, 2009; accepted October 7, 2009. Prepublished online as
Blood First Edition paper, October 30, 2009; DOI 10.1182/blood-2009-08236935.
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
The publication costs of this article were defrayed in part by page charge
© 2010 by The American Society of Hematology
238
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
circulating 17-␤-estradiol (E2) regulate cellular differentiation and
function. Indeed, elevated E2 levels decrease lymphopoiesis in
vivo by depleting primitive hematopoietic progenitors.19 E2 and
ER␣ promote murine and human DC differentiation mediated by
GM-CSF.20-22 We demonstrated that E2 specifically promotes the
GM-CSF–mediated differentiation of murine CD11c⫹ CD11bint
Ly6C⫺ Langerin⫹ or ⫺ DCs, a population that may represent in vivo
populations of tissue or inflammatory DCs.7 Estradiol acting via
ER␣, but not ER␤, was required for the development of this
CD11bint Ly6C⫺ DC population from highly purified MPs (Lin⫺
c-kithi sca-1⫺ IL-7R␣⫺ flt3⫹),17 but the molecular mechanism of
ER␣ action was unknown.
We now report that E2/ER␣ signaling increases Irf4 mRNA and
protein expression in differentiating MPs and CD11c⫺ precursors,
and promotes the development of the CD11cint Ly6C⫺ DC subset
expressing the highest levels of IRF4. Enforced expression of Irf4
cDNA in differentiating ER␣⫺/⫺ BM cells restored the development of the E2/ER␣-dependent CD11bint Ly6C⫺ DC population,
indicating that sufficiently high levels of IRF4 alleviate the
requirement for ER␣ signaling during GM-CSF–mediated DC
differentiation. Thus, an elevated amount of cellular IRF4 expression, which can be induced by E2/ER␣ signaling, is required for
CD11b⫹ and Langerin⫹ DC differentiation mediated by GM-CSF.
Methods
Mice
Female C57BL/6 mice (CD45.2⫹) and congenic CD45.1⫹ C57BL/6 mice
(8 to 12 weeks old) were purchased from the NCI Animal Production
Program. ER␣-deficient (B6.129-Esr1tm1KskN10) mice from JAX were bred
at Oklahoma Medical Research Foundation. The Oklahoma Medical
Research Foundation Institutional Animal Care and Use Committee
approved the studies.
GM-CSF–mediated DC differentiation
The GM-CSF–driven culture model for DC differentiation, in which E2
levels or ER signaling are manipulated, was used as described.17 Cultures
were initiated from total BM cells, Lin⫺ BM cells, or purified MPs.
Standard (hormone-replete) culture medium was RPMI, 10% fetal bovine
serum (FBS). Steroid hormone-deficient culture medium was phenol red
free RPMI, 10% charcoal dextran stripped FBS (Omega). E2 (SigmaAldrich) was dissolved in EtOH (vehicle), or was in water-soluble form as
cyclodextrin-encapsulated E2 with cyclodextrin as vehicle, and added to a
final concentration of 0.1nM to 1nM. ICI 182,780 was dissolved in DMSO
(vehicle) and added to a final concentration of 100nM.
Flow cytometry and myeloid progenitor isolation
Cells were prepared for flow cytometry as described.17 The goat anti-IRF4
antiserum M-17 (Santa Cruz Biotechnology) was detected with donkey
anti–goat Ig-Cy3, and isotype control goat IgG, or anti-IRF4 Ab preblocked
with cognate peptide, controlled for the specificity of binding.8 The
anti-Langerin mAb L31 was biotinylated and detected with streptavidinallophycocyanin.23 Samples were run on an LSRII instrument (Becton
Dickinson Biosciences) and analyzed with FlowJo software Version 8.8.5
(TreeStar). Lin⫺ cells and MPs were isolated as described.17
BM chimeric mice
Mixed ER␣⫹/ER␣⫺/⫺ BM chimeric mice were generated by transferring
equal numbers of ER␣⫹CD45.1⫹ and ER␣⫺/⫺CD45.2⫹ BM cells into
lethally irradiated [CD45.1xCD45.2]F1 recipients as described.24 On days 21
to 24 after reconstitution, BM was isolated and placed into GM-CSF–
ER SIGNALING INCREASES IRF4 EXPRESSION
239
driven DC differentiation cultures, or DC populations in BM were analyzed
directly ex vivo by flow cytometry.
Microarrays
MPs were incubated with 1nM E2 or vehicle for variable time periods
between 0 and 72 hours. Biotinylated amplified RNA was produced from
175 ng of total RNA per sample using an Illumina TotalPrep RNA
Amplification Kit (Ambion). Amplified RNA was hybridized overnight at
58°C to Sentrix Mouse-6 Expression BeadChips Version 1.1 (Illumina).
These arrays contain 50-mer oligonucleotides coupled to beads that are
mounted on glass slides. Each bead has an approximately 20- to 30-fold
redundancy. Microarrays were washed under high stringency, labeled with
streptavidin-Cy3, and scanned using an Illumina BeadStation 500 scanner.
To gain statistical power, gene expression response over time was
parameterized through a “mixed model”25 according to the following
equation: Normalized Fluorescent Units ⫽ ␣*Time ⫹ ␤1*Trx ⫹
␤2*Trx*Time, where ␣, ␤1, ␤2 are beta coefficients, Trx is Estrogen and
No Estrogen, and Time is in hours. The Trx*Time interaction P values were
adjusted with a False Discovery Rate (FDR).26 An FDR of 10% was
considered statistically significant. A first order autoregressive covariance
matrix was used to account for the correlation structure inherent in the
longitudinal measurements of gene expression. All mixed model analysis
was performed in the SAS system Version 9.1.3.
qPCR
RNA and cDNA were generated and quantitative real-time reverse transcriptase–
polymerase chain reaction (qPCR) was done as described.17 Relative
expression of genes was determined using the ⌬⌬Ct method with normalization to Gapdh expression, which does not change with E2 stimulation.
Specific primer sequences were: sense Gapdh 5⬘ AGGTCGGTGTGAACGGATTTG 3⬘, antisense Gapdh 5⬘ TGTAGACCATGTAGTTGAGGTCA 3⬘;
sense Irf4 5⬘ GCCCAACAAGCTAGAAAG 3⬘, antisense Irf4 5⬘ TCTCTGAGGGTCTGGAAACT 3⬘; sense Irf8 5⬘ GTTTACCGAATTGTCCCCGAG 3⬘, antisense Irf8 5⬘ CTCCTCTTGGTCATACCCATGTA 3⬘;
Sense Pu.1 5⬘ ATGTTACAGGCGTGCAAAATGG 3⬘, antisense Pu.1 5⬘
TGATCGCTATGGCTTTCTCCA 3⬘. Id2 primers (sequences proprietary)
were obtained from QIAGEN.
Retrovirus-mediated gene delivery
The Irf4 cDNA was cloned from murine DCs and inserted in front of the
Egfp gene in the retroviral vector MiG.27 To generate virus, MiG was
transfected with pCL/Eco plasmid into 293T cells. Lin⫺ BM cells from
ER␣⫺/⫺ mice were isolated and cultured for 16 hours in stem cell factor
(50 ng/mL), IL-3 (20 ng/mL), and IL-6 (50 ng/mL). For viral transduction,
1.5 ⫻ 105 Lin⫺ BM cells were mixed with 2 mL of retroviral supernatant
plus 10 ␮g/mL polybrene in 12-well plates and centrifuged for 1 hour.
Transduced Lin⫺ cells were cultured in GM-CSF in E2-deficient medium
for 5 days.
Statistical analyses
Statistical significance (P ⬍ .05) of differences in IRF4 mean fluorescence
intensity (MFI) values was determined using unpaired t tests in Prism
software. Significant differences between ER␣⫹ and ER␣⫺/⫺ DCs in mixed
BM chimeras were determined using paired t tests.
Results
An early and brief exposure to estradiol significantly increases
DC differentiation
Two major subsets of CD11c⫹ MHCII⫹ DCs (CD11bhi Ly6C⫹ and
CD11bint Ly6C⫺ Langerin⫹ or ⫺) differentiate from BM precursors
in GM-CSF–driven cultures.7 We previously showed that ER␣ and
physiologic amounts of E2 (0.1nM-1nM) were required for the
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
240
CARRERAS et al
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
Figure 1. A 6-hour E2 exposure to myeloid progenitors yields a
significant increase in DCs after 7 days. (A) MPs were stimulated
with GM-CSF and 0.1nM E2 in standard medium at time 0. At the
indicated times (0-96 hours), ER signaling was blocked by ICI 182,780
(100nM), such that E2 responsiveness was limited to the hour shown on
the x axis. All cells were analyzed by flow cytometry on day 7. Shown
are the average and range of percentages (left panel) and numbers
(right panel) of CD11c⫹ MHCII⫹ DCs in duplicate cultures. (B) Shown
are the relative percentages of 2 DC subsets (CD11bhi Ly6C⫹ and
CD11bint Ly6C⫺) present in cultures harvested on day 7 after E2
exposure for 0, 6, 48, or 168 hours. (C) Shown is the staining of
anti-Langerin mAb L31 in DCs in the absence or presence of E2.
Langerin⫹ DCs are within the CD11bint Ly6C⫺ population. Data are
representative of 2 independent experiments.
GM-CSF–mediated differentiation of the CD11c⫹ CD11bint Ly6C⫺
subset from MPs.17 To determine the temporal window of E2
exposure needed to augment DC differentiation, we incubated MPs
(Lin⫺ c-kithi sca-1⫺ IL-7R␣⫺ flt3⫹) in standard (hormone-replete)
medium supplemented with E2 (0.1nM) for various periods of time
(6 hours to 96 hours) before blockade of ER signaling by addition
of ICI 182,780, an ER antagonist that induces ER degradation.28
Cells were cultured for 7 days, and the percentage and numbers of
CD11c⫹ MHCII⫹ DCs were quantified by flow cytometry (Figure
1A). A 6-hour E2 exposure was sufficient to augment CD11c⫹ DC
development approximately 2-fold with a marked increase in the
CD11bint Ly6C⫺ population (Figure 1B). Within 48 hours of E2
exposure, the percentages of total differentiated CD11c⫹ MHCII⫹
DCs and the CD11bint Ly6C⫺ subset were comparable with that of a
7-day (168-hour) E2 exposure. Within the CD11bint Ly6C⫺ population, E2 exposure also increases the percentage of Langerin⫹ DCs
(Figure 1C). Thus, within 6 hours, E2/ER␣ signaling in MPs biases
the developmental program initiated by GM-CSF toward development of the CD11c⫹ CD11bint Ly6C⫺ DC subset.
Estradiol increases Irf4 mRNA levels in myeloid progenitors
To identify genes induced by E2/ER␣ signaling, we performed a
microarray experiment in which MPs were incubated with
vehicle or E2 (1nM) for variable times between 6 hours and
72 hours. This experiment identified Irf4 as an E2-induced
gene. We focused on IRF4 because it is critical for development of CD11c⫹ CD11b⫹ splenic DCs in vivo and in GM-CSF–
driven cultures.
To confirm E2 induction of Irf4 mRNA, independently isolated
MPs were incubated with GM-CSF and 1nM E2 (or vehicle) in
hormone-deficient medium for 3 to 48 hours before analysis of Irf4
expression by qPCR. E2 induced a marked (⬃ 3- to 4-fold over the
vehicle control) increase in Irf4 mRNA by 3 hours, which continued to increase throughout the 48-hour time point (to 6- to 7-fold
over the vehicle control; Figure 2A). In contrast, in the absence
of E2, the GM-CSF–induced increase in Irf4 mRNA was
significantly less and peaked at 6 hours. Due to these distinct
kinetics, the difference in Irf4 mRNA levels in the absence or
presence of E2 at the early time points was 2-fold at 6 hours,
with greater differences at 3 hours and 9 to 48 hours (Figure
2B). These data show that upon stimulation with GM-CSF, ER␣
signaling induces greater and more sustained amounts of Irf4
mRNA in MPs within 3 hours.
We investigated whether E2 exposure altered MP expression of
other transcription factors involved in DC differentiation. Unlike
Irf4, unstimulated MPs contained detectable levels of Irf8, Pu.1,
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
ER SIGNALING INCREASES IRF4 EXPRESSION
241
Figure 2. E2 exposure markedly increases the amount of
Irf4 mRNA present in GM-CSF–stimulated myeloid progenitors. MPs were stimulated with GM-CSF and 1nM E2 or
vehicle in hormone-deficient medium. At the indicated time
points, the amount of gene-specific mRNA was quantified
using qPCR of the sample in triplicate. The relative expression of each mRNA was calculated using the ⌬⌬Ct method.
(A) Irf4 mRNA was not present at time 0 and was increased
significantly in the presence of E2. (B) The fold increase in
Irf4 mRNA due to the presence of E2 at early time points was
reproducible. Error bars represent the range in 2 independent experiments. (C) Irf8, (D) Id2, and (E) Pu.1 mRNA were
present at time 0, as determined by the Ct values, and the
relative amounts did not differ in the presence or absence of
E2. Data are representative of 2 to 4 independent experiments.
and Id2 mRNA. The mRNA levels of these factors did not change
significantly (⬍ 2-fold) within 24 hours of GM-CSF stimulation,
nor in the presence of E2 (Figure 2C-E). Amounts of these
3 mRNA decreased at 48 hours, but this did not depend on the
presence of E2. Therefore, ER␣ signaling rapidly and specifically
increases Irf4 mRNA upon GM-CSF stimulation.
Estradiol increases IRF4 protein levels in differentiating
myeloid progenitors
Within 24 hours, GM-CSF–stimulated MPs exposed to E2 showed a
2-fold increase in IRF4 protein, relative to vehicle-treated MPs (Figure
3A). An E2-induced increase in IRF4 protein was also detected
Figure 3. E2 exposure increases the amount of IRF4 protein
in differentiating MPs 2-fold by 24 hours. MPs were stimulated with GM-CSF in hormone-deficient medium plus 1nM E2
or vehicle. (A) Shown is the binding of anti-IRF4 Ab to differentiating MPs in the absence (dotted line) or presence (solid line) of
E2 at 24 hours. The shaded histogram indicates the binding of
anti-IRF4 Ab preincubated with blocking peptide. The mean
fluorescence intensity (MFI; with value for anti-IRF4 Ab bound to
blocking peptide subtracted) of anti-IRF4 binding at 0 and
24 hours is plotted. Data are representative of 2 experiments.
(B) MPs were stimulated with GM-CSF in the presence of E2 or
E2 plus ICI 182,780 (100nM). The amount of intracellular IRF4
protein at 48 and 96 hours was assessed using flow cytometry.
Shown are the MFI values (mean ⫾ SD) of anti-IRF4 binding
(with value for anti-IRF4 Ab bound to blocking peptide subtracted) of cells in triplicate cultures. **P ⬍ .01, n ⫽ 3.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
242
CARRERAS et al
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
Figure 4. E2/ER␣ signaling promotes development of DCs that harbor increased amounts of IRF4 protein. (A) Lin⫺ BM cells were incubated with 1nM E2 or vehicle in
hormone-deficient medium. On day 7, IRF4 protein expression in CD11c⫺ and CD11c⫹ cells was determined. Shown are: binding of anti-IRF4 Ab to cells from vehicle-treated
cultures (dotted line); binding of anti-IRF4 Ab to cells from E2-treated cultures (solid line); binding of isotype control IgG on cells from the E2-treated cultures (shaded gray). MFI
values for anti-IRF4 binding with or without E2 are indicated (with value for isotype control IgG subtracted). Data are representative of 3 experiments. (B-E) MPs were incubated in standard
medium with ICI 182,780 (100nM) or vehicle. On day 7, the amount of IRF4 protein expression in CD11c⫺ and CD11c⫹ cells was determined. (B) CD11c expression on all cells; the
percentages of CD11c⫺ and CD11c⫹ cells are indicated. (C) Anti-IRF4 binding on CD11c⫺ and CD11c⫹ cells in the presence of ICI 182,780 (dotted line) or vehicle (solid line). The binding
of isotype control IgG on cells in vehicle-treated cultures is indicated (shaded gray). MFI values for anti-IRF4 binding with or without ICI 182,780 are indicated (with value for isotype control
IgG subtracted). (D) Within CD11c⫹ cells, CD11bint DCs express higher levels of IRF4 than CD11bhi DCs. The percentage of DCs within each gate is indicated. (E) MFI values for anti-IRF4
binding with or without ICI 182,780 are indicated for each DC subset. Data are representative of 2 experiments.
in undifferentiated CD11c⫺ precursors at 48 and 96 hours
(Figure 3B).
After 7 days of E2 exposure in cultures initiated from lineagenegative (Lin⫺) BM cells in hormone-deficient medium, CD11c⫺
precursors and fully differentiated CD11c⫹ cells contained 2-fold
more IRF4 protein than vehicle-treated cells (Figure 4A).
ICI 182,780 inhibited the increase in IRF4 expression in CD11c⫺
precursors that occurred in hormone-replete medium (Figure
4B-E). Within the CD11c⫹ cell fraction, the CD11bint Ly6C⫺ DC
subset, whose appearance is inhibited by ICI 182,780, expressed
2-fold more IRF4 than the CD11bhi Ly6C⫹ DC subset (Figure
4D-E). ER signaling also increased expression of IRF4 in the
CD11bhi Ly6C⫹ DC subset (Figure 4E). These data show that when
fully differentiated, the E2/ER␣-dependent CD11bint Ly6C⫺ DC
subset normally expresses 2-fold higher levels of IRF4 than the
CD11bhi Ly6C⫹ DC subset, suggesting that higher levels of IRF4
protein are required for their development and maintenance.
Ly6C⫹ DCs) expressed 2-fold more IRF4 protein than ER␣⫺/⫺ DCs
(composed primarily of CD11bhi Ly6C⫹ DCs; Figure 5A-D). One possibility was that DC precursors in ER␣⫺/⫺ mice are defective due to the
absence of factors supplied by estrogen-responsive BM stromal cells in
vivo.29 To determine whether the effect of ER␣ signaling on IRF4
expression was intrinsic to hematopoietic DC precursors, we generated
ER␣⫹/ER␣⫺/⫺ mixed BM chimeric mice, and BM cells from these
chimeric mice were placed into GM-CSF–driven cultures. After 7 days,
ER␣⫹ cells expressed higher amounts of IRF4 and had developed into
both CD11bhi and CD11bint DC subsets, whereas ER␣⫺/⫺ cells expressed lower amounts of IRF4 and had developed primarily into
CD11bhi DCs (Figure 5E,F). These data show that ER␣ signaling acts in
a cell-autonomous manner in DC precursors to increase expression of
IRF4. Thus, E2/ER␣ signaling in MPs or CD11c⫺ DC precursors leads
to a reproducible 2-fold increase in IRF4 protein by 24 hours, which is
maintained throughout the 7-day culture period and in fully
differentiated CD11c⫹ CD11bint Ly6C⫺ cells.
ER␣ signaling in hematopoietic cells increases IRF4
expression in a cell-autonomous manner
Enforced expression of IRF4 rescues the development of the
ER␣-dependent DC population from ER␣ⴚ/ⴚ BM precursors
Comparison of differentiating ER␣⫹ and ER␣⫺/⫺ BM cells showed that
on day 7, ER␣⫹ DCs (composed of CD11bint Ly6C⫺ and CD11bhi
To determine whether elevated amounts of IRF4 protein were
sufficient to induce differentiation of the CD11bint Ly6C⫺ DC
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
ER SIGNALING INCREASES IRF4 EXPRESSION
243
Figure 5. E2/ER␣ signaling acts in a cell-autonomous manner to increase expression of IRF4. (A-D) WT or ER␣⫺/⫺ BM cells were incubated with GM-CSF in standard
medium for 7 days. (A) The percentage of CD11c⫹ CD11b⫹ DCs was determined. (B) WT CD11c⫹ cells harbor both CD11bhi Ly6C⫹ and CD11bint Ly6C⫺ subsets, whereas
ER␣⫺/⫺ CD11c⫹ cells primarily harbor the CD11bhi Ly6C⫹ subset. (C) Binding of anti-IRF4 Ab to WT (solid line) or ER␣⫺/⫺ (dotted line) cells. The binding of isotype control IgG
on WT cells is indicated (shaded gray). MFI values for anti-IRF4 binding to cells are indicated (with value for isotype control IgG subtracted). (D) The average fold change in
IRF4 expression (anti-IRF4 Ab MFI) due to ER␣ in CD11c⫺ and CD11c⫹ is plotted; error bars represent the standard error in 5 independent experiments. (E-F) BM from
ER␣⫹/ER␣⫺/⫺ BM chimeric mice was incubated with GM-CSF in standard medium for 7 days. (E) The percentage of CD11c⫹ DCs in the WT/CD45.1 and ER␣⫺/⫺/CD45.2 cell
fractions was determined. (F) The bar graph shows MFI values of anti-IRF4 Ab binding to CD11c⫺ and CD11c⫹ cells, averaged (mean ⫾ SEM) from 4 BM chimeric mice
generated from the same BM transfer. Identical results were obtained upon analyses of 4 mice from a second BM chimera experiment. ***P ⬍ .001; *P ⬍ .05, n ⫽ 4.
subset in the absence of ER␣ signaling, we expressed the
Irf4 cDNA in Lin⫺ ER␣⫺/⫺ BM cells (Figure 6). Lin⫺ ER␣⫺/⫺
BM cells were transduced with MiG-GFP or MiG-IRF4-GFP
retroviruses and subsequently stimulated with GM-CSF. After
5 days, the phenotypes of cells in GFP⫹ and GFP⫺ fractions
were determined by flow cytometry. Enforced expression of
the Irf4 cDNA led to a 5-fold increase in the amount of
intracellular IRF4 protein in GFP⫹ cells, relative to GFP⫺ cells
in MIG-IRF4-GFP–transduced cultures (Figure 6H) or to cells in
the MIG-GFP–transduced cultures (Figure 6B). This was associated with a marked increase in the percentage of CD11c⫹
cells (Figure 6I-K). The difference in percentage of CD11c⫹
cells in GFP⫺ and GFP⫹ MiG-GFP–transduced cultures (Figure
6C,E) was not reproducible. While the majority of DCs was
CD11bhi Ly6C⫹ in the MiG-GFP–transduced cultures (Figure
6C-F) and in the GFP⫺ fraction of the MiG-IRF4-GFP–
transduced cultures (Figure 6I-J), the majority of DCs in the
GFP⫹ fraction of the MiG-IRF4-GFP cultures was CD11bint
Ly6C⫺ (Figure 6K-L). The CD11bint Ly6C⫺ population contained both Langerin⫹ and Langerin⫺ DCs (not shown).
Thus, increased expression of the Irf4 cDNA in differentiating
ER␣⫺/⫺ Lin⫺ cells restores the development of the E2/ER␣dependent CD11bint Ly6C⫺ DC population, indicating that
sufficiently high levels of IRF4 substitute for the requirement
for E2/ER␣ signaling during GM-CSF–mediated DC
differentiation.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
244
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
CARRERAS et al
Figure 6. Enforced IRF4 expression directs the development of the ER␣/E2-dependent CD11bint Ly6Cⴚ DC subset in the absence of ER␣ signaling. Lin⫺ ER␣⫺/⫺ BM
cells were transduced with MiG-GFP (A-F) or MiG-IRF4-GFP (G-L). Transduced cells were incubated in GM-CSF for 5 days before assessment of DC subsets by flow
cytometry. IRF4 expression was assessed in GFP⫺ (dotted line) and GFP⫹ (solid line) fractions in (A-B) MiG-GFP– or (G-H) MiG-IRF4-GFP– transduced cells. The MFI of
anti-IRF4 binding to GFP⫹ and GFP⫺ cells is indicated in panels B and H. The shaded histogram indicates the binding of anti-IRF4 Ab precincubated with blocking peptide. In
MiG-GFP–transduced cell cultures, CD11c⫹ DCs in the GFP⫺ (C) and GFP⫹ (E) cell fractions are primarily CD11bhi Ly6C⫹ (panels D and F gated on CD11c⫹ cells shown in
panels C and E). The percentage of cells with the bar or box gates is indicated. In MiG-IRF4-GFP–transduced cultures, CD11c⫹ DCs in the GFP⫺ cell fraction (I) are also
primarily CD11bhi Ly6C⫹ (J, gated on CD11c⫹ cells shown in panel I). In contrast, the percentage of CD11c⫹ DCs in the GFP⫹ fraction (K) is significantly increased, and the
majority of DCs is CD11bint Ly6C⫺ (L, gated on CD11c⫹ cells shown in panel K). Data are representative of 4 independent experiments.
ER␣ expression promotes CD11bⴙ DC development during
inflammation in vivo
Our results in the GM-CSF–driven culture model suggest that ER␣
signaling promotes new DC differentiation during inflammation in
vivo. To determine the relative efficiency of DC differentiation
from ER␣⫹ and ER␣⫺/⫺ BM precursors in vivo, we analyzed the
CD11c⫹ CD11b⫹ DC subset present in BM of mixed ER␣⫹/
ER␣⫺/⫺ BM chimeric mice at an early time point (⬃ day 23) after
reconstitution when myeloid cells, but few lymphocytes, have
developed. In this model, DC development occurs in the postradiation inflammatory environment, which is characterized by elevated
serum IL-6 and high levels of costimulatory molecules on newly
differentiated DCs, and normal levels of serum E2 (E.C., S. Bajaña,
H. Agrawal, S.K., manuscript in preparation). In the BM of these
chimeric mice, newly differentiated CD11b⫹ DCs were derived
preferentially from ER␣⫹ donor BM cells (⬃ 2:1 ratio of wild type
[WT] to ER␣⫺/⫺ DCs; Figure 7). Similar results were obtained
upon analyses of splenic and lymph node DC populations in these
chimeric mice (E.C., S. Bajaña, H. Agrawal, S.K., manuscript in
preparation). Thus, during radiation-induced inflammation in vivo,
ER␣ signaling in response to physiologic levels of endogenous
estrogens promotes CD11b⫹ DC development from short-term
repopulating BM progenitors.
Discussion
We have shown that an elevated amount of IRF4 protein,
induced by ER␣ signaling, promotes the GM-CSF–mediated
differentiation of CD11bint Ly6C⫺ DCs from MPs. There is a
precedent for high and low amounts of IRF4 protein directing
distinct transcriptional programs in differentiating cells. Differentiating B cells expressed graded amounts of IRF4 protein,
and high or low amounts of IRF4 specified plasma cell or
germinal center gene expression programs, respectively.11 PU.1
pairs with IRF4 to regulate genes and, like IRF4, is required
for the development of splenic CD11b⫹ DCs.3,12 Quantitatively different amounts (⬃ 4-fold) of PU.1 in hematopoietic
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
Figure 7. ER␣ expression promotes DC development during inflammation in
vivo. Using flow cytometry, conventional CD11c⫹ CD11b⫹ DCs (cDCs) were
identified in BM of ER␣⫹/ER␣⫺/⫺ BM chimeric mice on days 21 to 24 after reconstitution, a postradiation inflammatory environment. After gating on this DC population,
the percentage of cells bearing CD45.1 (WT ER␣⫹) or CD45.2 (ER␣⫺/⫺) was
determined. Shown are the (A) relative percentage and (B) number of cDCs derived
from WT and ER␣⫺/⫺ donor BM in individual mice (n ⫽ 13), with the mean and SEM
values indicated by the bars. Significant differences in the percentage and numbers
of WT and ER␣⫺/⫺ DCs were calculated using paired t tests. The total number of BM
cells in individual mice varied between 4 ⫻ 106 and 1 ⫻ 107.
progenitors also specify distinct myeloid and lymphoid cell
fates, in some cases because the ratio of PU.1 to other
transcription factors is altered.14,30 This supports the significance of a 4- to 7-fold difference in IRF4 levels in MPs within
3 to 9 hours of E2 exposure, and suggests that the ER␣/E2induced changes in IRF4 expression could lead to altered
interactions with other transcription factors and/or to distinct
transcriptional programs.
IRF4 acts alone by binding ISRE or is recruited to composite
IRF4/PU.1 binding sites by phosphorylated PU.1.12 Our data show
that in MPs, Pu.1 mRNA changed little in response to GM-CSF or
E2 stimulation over the 24-hour time period in which Irf4 mRNA is
significantly increased. Therefore, it is possible that increased
amounts of IRF4 protein alter the recruitment of IRF4/PU.1
complexes to target genes, as demonstrated for IRF8/PU.1 complexes.31 Autoregulation of the Irf4 gene also could be amplified by
ER␣ signaling because IRF4/PU.1 complexes bind to the Irf4
promoter.10 Alternately, elevated levels of IRF4 might allow IRF4
to act independently of PU.1 to regulate genes that promote
CD11b⫹ DC differentiation.
ER␣ binds directly to DNA at consensus estrogen response
elements (EREs) proximal to genes.32 Algorithms within the ECR
Browser (www.dcode.org) at the National Center for Biotechnology Information (NCBI) identified 4 conserved EREs proximal to
the murine Irf4 gene. ER␣ also may complex with other factors
such as Sp-1, NF-Y, FoxA1/HNF3␣, or AP-1,18 and binding sites
for these factors are also present proximal to the Irf4 gene.
Unbiased genome-wide chromatin binding (ChIP) and sequencing
approaches to identify ER␣ binding sites in E2-stimulated cells
revealed that many ER␣ binding sites and EREs are more than 5 kb
away from target genes.33 Intriguingly, ER␣ bound to a region that
is approximately 12 kb proximal to the start site of the human IRF4
gene.34 This region contains a consensus ERE site, which is
conserved in the same location 5⬘ to the murine Irf4 gene. This
information is consistent with the hypothesis that E2-bound ER␣
participates in a chromatin-modifying complex that directly regulates the Irf4 gene.
Alternately, ER␣ signaling may modulate expression or activity
of an intermediate molecule such as nuclear factor–␬B (NF-␬B).
Indeed, GM-CSF stimulated IRF4 expression in differentiating
human monocytes by activating NF-␬B,10 and the NF-␬B subunit
Rel induced IRF4 expression in lymphocytes.35 RelB is also
important for the development of IRF4-dependent CD11b⫹ splenic
DCs.36,37 ER interactions with NF-␬B in other cell types have been
reported.38
ER SIGNALING INCREASES IRF4 EXPRESSION
245
In the GM-CSF–driven cultures, E2/ER␣ signaling promotes
the development of CD11bint DCs, some of which are Langerin⫹. These could be the correlates of either epidermal Langerin⫹ DCs or populations of CD11b⫹ and CD103⫹ interstitial
DCs found in the dermis and lung. CD103 is expressed on a
significant portion of both the CD11bhi Ly6C⫹ and CD11bint
Ly6C⫺ DC subsets in our cultures (data not shown), so we could
not use differential CD103 expression to correlate them with
interstitial DC populations. A role for IRF4 in the development
of these tissue DC populations was not studied in published
reports of DC development in IRF4⫺/⫺ mice.8,9 Our data now
link IRF4 to the development of one or more of these tissue DC
subsets in vivo.
The higher amount of IRF4 protein in E2-dependent CD11bint
Ly6C⫺ DCs may have functional implications. Fully developed
human DCs, CD11b⫹ murine DCs, and macrophages retain
expression of IRF4, and IRF4 negatively regulates Toll-like
receptor signaling.39,40 Thus, IRF4hi DCs that develop in the
context of E2/ER␣ signaling may have a greater capacity to
regulate the magnitude of immune responses or promote
tolerance.
During inflammation and autoimmune disease, elevated
GM-CSF directs the development of new DCs from monocytes
or other proliferating precursors that infiltrate tissues and
secondary lymphoid organs.5 Increased estradiol synthesis also
has been linked to inflammation.41,42 Our data show that one
physiologic factor that regulates de novo inflammatory DC
differentiation is E2/ER␣ signaling, which leads to increased
expression of the IRF4 transcription factor that is critical to
CD11b⫹ DC development.
Acknowledgments
We thank J. Bass and D. Hamilton in the Oklahoma Medical
Research Foundation flow cytometry core facility, Drs H. Agrawal
and S. Bajaña for assistance with BM chimeras, and our Oklahoma
Medical Research Foundation colleagues for helpful discussions.
This work was supported by the Oklahoma Center for the
Advancement of Science & Technology grants HR06-157 (S.K.)
and AR081-006 (M.C.); and National Institutes of Health grants
AI079616 (S.K.), RR020143 (E.C., M.C., S.K.), RR015577 (S.K.,
M.C.), and RR16478 (M.B.F.).
Authorship
Contribution: E.C. designed and performed research, analyzed
and interpreted data, and wrote the manuscript; S.T. performed
research and analyzed and interpreted data; M.B.F. designed
research and analyzed and interpreted data; N.K. performed
statistical analysis; J.O. and A.S. performed research; M.C.
analyzed and interpreted data; C.G.P. contributed vital new
reagent; J.A.-I. designed research and analyzed and interpreted
data; and S.K. designed research, analyzed and interpreted data,
and wrote the manuscript.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Susan Kovats, Arthritis & Immunology Program, Oklahoma Medical Research Foundation, 825 NE 13th St,
Oklahoma City, OK 73104; e-mail: [email protected].
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
246
BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2
CARRERAS et al
References
1. Shortman K, Naik SH. Steady-state and inflammatory dendritic-cell development. Nat Rev Immunol. 2007;7(1):19-30.
2. Merad M, Ginhoux F, Collin M. Origin, homeostasis and function of Langerhans cells and other
langerin-expressing dendritic cells. Nat Rev Immunol. 2008;8(12):935-947.
3. Merad M, Manz MG. Dendritic cell homeostasis.
Blood. 2009;113(15):3418-3427.
4. Geissmann F, Auffray C, Palframan R, et al.
Blood monocytes: distinct subsets, how they relate to dendritic cells, and their possible roles in
the regulation of T-cell responses. Immunol Cell
Biol. 2008;86(5):398-408.
5. Hamilton JA. Colony-stimulating factors in inflammation and autoimmunity. Nat Rev Immunol.
2008;8(7):533-544.
6. Takahara K, Omatsu Y, Yashima Y, et al. Identification and expression of mouse Langerin
(CD207) in dendritic cells. Int Immunol. 2002;
14(5):433-444.
7. Mao A, Paharkova-Vatchkova V, Hardy J, Miller
MM, Kovats S. Estrogen selectively promotes the
differentiation of dendritic cells with characteristics of Langerhans cells. J Immunol. 2005;175(8):
5146-5151.
8. Tamura T, Tailor P, Yamaoka K, et al. IFN regulatory factor-4 and -8 govern dendritic cell subset
development and their functional diversity. J Immunol. 2005;174(5):2573-2581.
9. Suzuki S, Honma K, Matsuyama T, et al. Critical
roles of interferon regulatory factor 4 in
CD11bhighCD8alpha- dendritic cell development.
Proc Natl Acad Sci U S A. 2004;101(24):89818986.
10. Lehtonen A, Veckman V, Nikula T, et al. Differential expression of IFN regulatory factor 4 gene in
human monocyte-derived dendritic cells and
macrophages. J Immunol. 2005;175(10):65706579.
11. Sciammas R, Shaffer AL, Schatz JH, Zhao H,
Staudt LM, Singh H. Graded expression of interferon regulatory factor-4 coordinates isotype
switching with plasma cell differentiation. Immunity. 2006;25(2):225-236.
12. Marecki S, Fenton MJ. The role of IRF-4 in transcriptional regulation. J Interferon Cytokine Res.
2002;22(1):121-133.
13. Dakic A, Wu L, Nutt SL. Is PU. 1 a dosage-sensitive
regulator of haemopoietic lineage commitment
and leukaemogenesis? Trends Immunol. 2007;
28(3):108-114.
production by controlling the activity of IRF-4
transcription factor. Immunity. 2008;29(6):899911.
16. Gauzzi MC, Purificato C, Conti L, Adorini L,
Belardelli F, Gessani S. IRF-4 expression in the
human myeloid lineage: up-regulation during
dendritic cell differentiation and inhibition by
1alpha,25-dihydroxyvitamin D3. J Leukoc Biol.
2005;77(6):944-947.
17. Carreras E, Turner S, Paharkova-Vatchkova V,
Mao A, Dascher C, Kovats S. Estradiol acts directly on bone marrow myeloid progenitors to differentially regulate GM-CSF or Flt3 ligand-mediated
dendritic cell differentiation. J Immunol. 2008;180(2):
727-738.
zation and degradation of estrogen receptoralpha. J Biol Chem. 2006;281(14):9607-9615.
29. Yokota T, Oritani K, Garrett KP, et al. Soluble
frizzled-related protein 1 is estrogen inducible in
bone marrow stromal cells and suppresses the
earliest events in lymphopoiesis. J Immunol.
2008;181(9):6061-6072.
30. Nutt SL, Metcalf D, D’Amico A, Polli M, Wu L. Dynamic regulation of PU. 1 expression in multipotent hematopoietic progenitors. J Exp Med. 2005;
201(2):221-231.
31. Tamura T, Thotakura P, Tanaka TS, Ko MS, Ozato
K. Identification of target genes and a unique cis
element regulated by IRF-8 in developing macrophages. Blood. 2005;106(6):1938-1947.
18. Heldring N, Pike A, Andersson S, et al. Estrogen
receptors: how do they signal and what are their
targets. Physiol Rev. 2007;87(3):905-931.
32. O’Lone R, Frith MC, Karlsson EK, Hansen U.
Genomic targets of nuclear estrogen receptors.
Mol Endocrinol. 2004;18(8):1859-1875.
19. Medina KL, Garrett KP, Thompson LF, Rossi MI,
Payne KJ, Kincade PW. Identification of very
early lymphoid precursors in bone marrow and
their regulation by estrogen. Nat Immunol. 2001;
2(8):718-724.
33. Kininis M, Kraus WL. A global view of transcriptional regulation by nuclear receptors: gene expression, factor localization, and DNA sequence
analysis. Nucl Recept Signal. 2008;6:e005.
20. Paharkova-Vatchkova V, Maldonado R, Kovats S.
Estrogen preferentially promotes the differentiation of CD11c⫹ CD11b(intermediate) dendritic
cells from bone marrow precursors. J Immunol.
2004;172(3):1426-1436.
21. Douin-Echinard V, Laffont S, Seillet C, et al. Estrogen receptor alpha, but not beta, is required for
optimal dendritic cell differentiation and [corrected] CD40-induced cytokine production. J Immunol. 2008;180(6):3661-3669.
22. Komi J, Lassila O. Nonsteroidal anti-estrogens
inhibit the functional differentiation of human
monocyte-derived dendritic cells. Blood. 2000;
95(9):2875-2882.
23. Cheong C, Idoyaga J, Do Y, et al. Production of
monoclonal antibodies that recognize the extracellular domain of mouse langerin/CD207. J Immunol Methods. 2007;324(1-2):48-62.
24. Vremec D, Pooley J, Hochrein H, Wu L, Shortman K.
CD4 and CD8 expression by dendritic cell subtypes in mouse thymus and spleen. J Immunol.
2000;164(6):2978-2986.
25. Littell R, Milliken G, Stroup W, Wolfinger R,
Schabenberger O. SAS for Mixed Models. 2006.
Cary, NC: SAS Institute Inc.
26. Benjamini Y, Hochberg Y. Controlling the false
discovery rate: a practical and powerful approach
to multiple testing. J R Stat Soc Ser B. 1995;57:
289-300.
14. Laslo P, Spooner CJ, Warmflash A, et al. Multilineage transcriptional priming and determination of
alternate hematopoietic cell fates. Cell. 2006;
126(4):755-766.
27. Hernández-Hoyos G, Anderson MK, Wang C,
Rothenberg EV, Alberola-Ila J. GATA-3 expression is controlled by TCR signals and regulates
CD4/CD8 differentiation. Immunity. 2003;19(1):
83-94.
15. Chen Q, Yang W, Gupta S, et al. IRF-4-binding
protein inhibits interleukin-17 and interleukin-21
28. Long X, Nephew KP. Fulvestrant (ICI 182780)dependent interacting proteins mediate immobili-
34. Carroll JS, Meyer CA, Song J, et al. Genomewide analysis of estrogen receptor binding sites.
Nat Genet. 2006;38(11):1289-1297.
35. Grumont RJ, Gerondakis S. Rel induces interferon regulatory factor 4 (IRF-4) expression in
lymphocytes: modulation of interferon-regulated
gene expression by rel/nuclear factor kappaB.
J Exp Med. 2000;191(8):1281-1292.
36. Wu L, D’Amico A, Winkel KD, Suter M, Lo D,
Shortman K. RelB is essential for the development of myeloid-related CD8alpha- dendritic cells
but not of lymphoid-related CD8alpha⫹ dendritic
cells. Immunity. 1998;9(6):839-847.
37. Burkly L, Hession C, Ogata L, et al. Expression of
relB is required for the development of thymic
medulla and dendritic cells. Nature. 1995;373(6514):
531-536.
38. Kalaitzidis D, Gilmore TD. Transcription factor
cross-talk: the estrogen receptor and NF-kappaB.
Trends Endocrinol Metab. 2005;16(2):46-52.
39. Negishi H, Ohba Y, Yanai H, et al. Negative regulation of Toll-like-receptor signaling by IRF-4.
Proc Natl Acad Sci U S A. 2005;102(44):1598915994.
40. Honma K, Udono H, Kohno T, et al. Interferon
regulatory factor 4 negatively regulates the production of proinflammatory cytokines by macrophages in response to LPS. Proc Natl Acad Sci
U S A. 2005;102(44):16001-16006.
41. Cutolo M, Villaggio B, Seriolo B, et al. Synovial
fluid estrogens in rheumatoid arthritis. Autoimmun Rev. 2004;3(3):193-198.
42. Salama SA, Kamel MW, Diaz-Arrastia CR, et al.
Effect of tumor necrosis factor-alpha on estrogen
metabolism and endometrial cells: potential physiological and pathological relevance. J Clin Endocrinol Metab. 2009;94(1):285-293.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2010 115: 238-246
doi:10.1182/blood-2009-08-236935 originally published
online October 30, 2009
Estrogen receptor signaling promotes dendritic cell differentiation by
increasing expression of the transcription factor IRF4
Esther Carreras, Sean Turner, Mark Barton Frank, Nicholas Knowlton, Jeanette Osban, Michael
Centola, Chae Gyu Park, Amie Simmons, José Alberola-Ila and Susan Kovats
Updated information and services can be found at:
http://www.bloodjournal.org/content/115/2/238.full.html
Articles on similar topics can be found in the following Blood collections
Hematopoiesis and Stem Cells (3432 articles)
Immunobiology (5489 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.