Clemson University
TigerPrints
All Dissertations
Dissertations
5-2012
GENETIC ENGINEERING OF TURFGRASS
FOR ENHANCED PERFORMANCE UNDER
ENVIRONMENTAL STRESS
Man Zhou
Clemson University, [email protected]
Follow this and additional works at: http://tigerprints.clemson.edu/all_dissertations
Part of the Genetics and Genomics Commons
Recommended Citation
Zhou, Man, "GENETIC ENGINEERING OF TURFGRASS FOR ENHANCED PERFORMANCE UNDER ENVIRONMENTAL
STRESS" (2012). All Dissertations. Paper 920.
This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by
an authorized administrator of TigerPrints. For more information, please contact [email protected].
GENETIC ENGINEERING OF TURFGRASS FOR ENHANCED PERFORMANCE
UNDER ENVIRONMENTAL STRESS
A Dissertation
Presented to
the Graduate School of
Clemson University
In Partial Fulfillment
of the Requirements for the Degree
Doctor of Philosophy
Genetics
by
Man Zhou
May 2012
Accepted by:
Dr. Hong Luo, Committee Chair
Dr. William R. Marcotte, Jr.
Dr. Guido Schnabel
Dr. Chinfu Chen
i
ABSTRACT
Turfgrass species are agriculturally and economically important perennial crops
that are susceptible to biotic stress (e.g. fungal pathogens) and abiotic stress (e.g. salinity
and drought). Every year, environmental stress significantly influences turfgrass quality
and production causing economic loss globally. My research explores the feasibility of
using two novel transgenes - Penaeidin4-1 (Pen4-1) from shrimp (Litopenaeus setiferus)
and microRNA319a (miR319a) from rice (Oryza sativa) to genetically engineer turfgrass
for enhanced tolerance to environmental stress.
The antimicrobial peptide - Pen4-1 has been reported to possess in vitro
antifungal and antibacterial activities against various economically important pathogens.
In this study, two DNA constructs were prepared containing either the coding sequence
of a single peptide, Pen4-1 or the DNA sequence coding for the transit signal peptide of
the secreted tobacco AP24 protein translationally fused to Pen4-1 coding sequence.
Transgenic turfgrass plants containing different DNA constructs exhibited significantly
enhanced resistance to dollar spot and brown patch, the two major fungal diseases in
turfgrass. My results demonstrated the effectiveness of Pen4-1 in a perennial species
against fungal pathogens and may suggest a potential strategy for engineering broadspectrum fungal disease resistance in crop species.
The miR319 family is one of the first characterized miRNA families in plants and
it has been demonstrated to target TEOSINTE BRANCHED/CYCLOIDEA/PCF (TCP)
genes encoding plant-specific transcription factors. Transgenic plants overexpressing the
ii
rice miR319 gene, Osa-miR319a, exhibited dramatic morphological changes, including
significantly decreased tiller numbers, wider and thicker leaves, larger stems, larger
weight:area ratio and more total wax coverage. Overexpression of miR319 also led to
enhanced drought and salt tolerance in transgenics, which might be attributed to the
increased weight:area ratio and total wax coverage as well as less sodium uptake. Gene
expression analysis in both wild-type and transgenic plants indicated that at least four
putative miR319 target genes in turfgrass AsPCF5, AsPCF6, AsPCF8 and AsTCP14 were
down-regulated in transgenic plants.
These results provide important information leading to the development of novel
molecular strategies to genetically engineer crop species for enhanced performance under
unfavorable environmental conditions, contributing to agriculture production.
iii
TABLE OF CONTENTS
Page
TITLE PAGE ...................................................................................................................... i
ABSTRACT ......................................................................................................................... i
List of tables ....................................................................................................................... vi
LIST OF FIGURES .......................................................................................................... vii
CHAPTER 1 - LITERATURE REVIEW ........................................................................... 1
1.1 Agricultural Biotechnology for Crop Improvement ................................................. 1
1.1.1 Challenges for current agriculture...................................................................... 1
1.1.2 Genetic engineering of crops to cope with environmental challenges.............. 3
1.1.3 Novel sources of transgenes for genetic engineering of enhanced stress
tolerance in transgenic plants ..................................................................... 6
1.2 Plant Genetic Engineering Using Antimicrobial Peptides for Enhanced
Biotic Stress Tolerance ............................................................................................. 9
1.2.1 General introduction to antimicrobial peptides (AMPs) .................................... 9
1.2.2 Application of AMPs in agriculture ................................................................. 11
1.2.3 Animal derived AMP- Pen4-1 ......................................................................... 12
1.3 Genetic Engineering of MicroRNAs for Enhanced Abiotic Stress Tolerance ....... 16
iv
1.3.1 General introductions to microRNAs and miR319 .................................................. 16
1.3.2 Origin, biogenesis and modes of actions of plant miRNAs ..................................... 19
1.3.3 Regulatory roles of miRNA-target nodes ................................................................ 26
1.3.4 Current understanding of miR319-mediated plant morphogenesis and
abiotic stress response ...................................................................................... 33
CHAPTER 2 - EXPRESSION OF A NOVEL ANTIMICROBIAL PEPTIDE
PENAEIDIN4-1 IN CREEPING BENTGRASS
(AGROSTIS STOLONIFERA L.) ENHANCES
PLANT FUNGAL DISEASE RESISTANCE ...................................................... 57
CHAPTER 3 -CONSTITUTIVE EXPRESSION OF A MIR319
GENE ALTERS PLANT DEVELOPMENT AND
INCREASES SALT AND DROUGHT TOLERANCE
IN TRANSGENIC CREEPING BENTGRASS
(AGROSTIS STOLONIFERA L.) ........................................................................ 103
CHAPTER 4 - CONCLUSIONS AND FUTURE DIRECTIONS ................................ 164
APPENDIX A - SUPPLEMENTARY FIGURES .......................................................... 168
v
LIST OF TABLES
Table
Page
1.1 A range of microbial organims Pen4-1 can fight against ......................................... 16
vi
LIST OF FIGURES
Figure
Page
1.1 Three structures of AMPs. ........................................................................................ 11
1.2 Structure of Pen4-1 ................................................................................................... 14
1.3 Biogenesis of plant miRNA. ..................................................................................... 21
1.4 Mechanisms of plant miRNA precursor processing ................................................. 24
1.5 Modes of miRNA actions ......................................................................................... 26
1.6 MiR 319 family presented in various land species ................................................... 34
1.7 Coordinated action of miRNA nodes in regulating cell
proliferations in plant leaves ..................................................................................... 36
1.8 MiR319 mediated plant leaf morphology change ..................................................... 37
2.1 Generation and molecular analysis of the transgenic lines expressing Pen4-1 ........ 64
2.2 Nucleotide and deduced amino acid sequences of the Pen4-1 gene ......................... 65
2.3 Response of transgenic creeping bentgrass plants expressing Pen4-1
to R. solani
infection - in vitro plant leaf inoculation assay .................................. 68
2.4 Response of transgenic creeping bentgrass plants expressing
Pen 4-1 to R. solani infection - in vivo direct plant inoculation
bioassays with lower dose of R. solani ..................................................................... 70
2.5 Response of transgenic creeping bentgrass plants expressing Pen 4-1
to R. solani infection - in vivo direct plant inoculation bioassays
with higher dose of R. solani .................................................................................... 71
vii
List of Figures (Continued)
Figure
Page
2.6 Response of transgenic creeping bentgrass plants expressing Pen 4-1 to S.
homoeocarpa infection - in vitro plant leaf inoculation assay. ................................ 73
2.7 Response of transgenic creeping bentgrass plants expressing Pen 4-1 to S.
homoeocarpa infection - in vivo direct plant inoculation bioassays with
higher dose of S. homoeocarpa ................................................................................ 75
3.1 Generation and molecular analysis of the transgenic lines expressing
Osa-miR319 ............................................................................................................ 109
3.2 Morphology change in transgenic plants overexpressing Osa-miR319a ................ 111
3.3 Tillering and plant development under normal growth conditions ......................... 113
3.4 Response of WT and TG plants to salt stress ......................................................... 116
3.5 Mineral contents in WT and TG plants under normal and salinity conditions ...... 118
3.6 Response of WT and TG plants to drought stress. ................................................. 121
3.7 Tillering and plant development of WT and TG plants under
the drought stress for 60 days after 30 days normal development
starting from a single tiller ...................................................................................... 103
3.8 Leaf relative water content (RWC) and leaf electrolyte leakage (EL)
of WT and TG plants under normal and drought stress conditons ......................... 123
3.9 Photosynthetic characteristics of WT and a representative
Osa-miR319a TG line (TG-1) measured under normal growth
conditions and 5 days after dehydration stress ....................................................... 124
viii
List of Figures (Continued)
Figure
Page
3.10 Measurement of leaf weight/area ratio and total leaf cuticle wax
coverage of WT and a representative Osa-miR319a TG line (TG-1) ................... 126
3.11 Comparison of target sites in the 5 putative miR319 target genes in rice
and creeping bentgrass with the mature sequence of Osa-miR319. ...................... 128
3.12 Expression levels of the 5 putative miR319 target genes in WT and
TG plant leaves and roots ...................................................................................... 129
3.13 Expression levels of AsNAC60 in WT and TG plant leaves and roots ................. 130
3.14 Time course expression pattern of the 5 putative miR319 target genes
in WT plants under 200 mM NaCl treatment ....................................................... 132
3.15 Time course expression pattern of putative miR319 targets under
dehydration treatment ........................................................................................... 133
3.16 Time course expression pattern of AsNAC60 under 200 mM
NaCl treatment ..................................................................................................... 134
A1
A close look of the leaves and stems of WT and TG plants
subjected to 60-day limited water supply ............................................................ 168
A.2 Alignments between 5 putative miR319 targets in turfgrass
and their corresponding homologues in rice ........................................................ 173
A.3 Stomata study in WT and TG turfgrass plants ...................................................... 174
A.4 The performance of WT and TG plants 5 days after 200 mM NaCl treatment .... 175
ix
List of Figures (Continued)
Figure
Page
A.5 The performance of WT and TG plants under the extreme salinity and
drought stress......................................................................................................... 177
A.6 Alignment between AsNAC60 and ONAC60. ........................................................ 178
x
CHAPTER 1 - LITERATURE REVIEW
Part of the following contents has been published in “Methods and compositions for
transgenic plants producing antimicrobial peptides for enhanced disease resistance. U.S.
Patent Application No. 61/247,103” and SIVB conference abstracts “In Vitro Cellular &
Developmental Biology 45 (issue abstract): 34-35” and “In Vitro Cellular &
Developmental Biology 47 (issue abstract): 37”.
1.1 Agricultural Biotechnology for Crop Improvement
1.1.1 Challenges for current agriculture
By 2050, the world population will reach roughly 9 billon (Tester and Langridge,
2010). Increasing food production will have an important role in solving the problem of
how to feed humans. However, it will be constrained by competing interests in land and
resources, global climate change, increasing environmental stresses and current trends in
land degradation (Godfray et al., 2010). Among these problems, environmental stresses
are regarded as the most limiting factors for agricultural productivity (Cherry et al., 2000).
Environmental stresses can be divided into biotic stress and abiotic stress. The
abiotic stress include drought, salinity, chilling, cold, freezing, heat, nutrient deficiency,
sun burn, ozone and anaerobic stresses (Mittler and Blumwald, 2010). Take drought as an
example, which is one of the most important environmental stresses affecting agriculture
1
worldwide (Yang et al., 2010). There was a Europe-wide reduction of crop productivity
due to heat and drought in 2003 (Ciais et al., 2005). Between 1980 and 2004 the US
suffered an excess of $20 billion in damages due to drought solely and $120 billion due
to the combination of drought and heat (Mittler, 2006; Mittler and Blumwald, 2010) . The
intergovenmental panel on climate change (IPCC) concludes that by the end of this
century, the general drying of subtropics will cause drought stress worldwide due to the
climate change and the increased accumulation of greenhouse gas (IPCC, 2007; Yang et
al., 2010).
Salinity is another severe abiotic stress negatively impacting agricultural yields,
because it is detrimental to plant growth and already affects a vast terrestrial areas of the
world (Yamaguchi and Blumwald, 2005). Currently, it is estimated that at least 20% of
irrigated land is under saline stress (Yamaguchi and Blumwald, 2005; FAO, 2008). Not
only is the farmland experiencing serious soil salinization problems, but also are other
ecosystems. Every year, vast natural ecosystems are transformed into farming systems.
For example, in central Argentina, a large amount of natural woodland and grassland are
converted to soybean fields. This expansion increased the groundwater levels and salinity,
thus affecting long-term agricultural productivity (Jayawickreme et al., 2010). Besides
the problems of soil salinization, the scarcity of fresh water resources forces farmers to
use brackish water or salty water to irrigate. Therefore, it is important to develop crop
cultivars to better adapt saline soil and inferior quality of irrigation water (Yamaguchi and
Blumwald, 2005; Barrett-Lennard and Setter, 2010).
2
In addition to the abiotic stress challenges mentioned above, the incidence of
biotic stress, such as pests and diseases, is another major limiting factor to worldwide
agricultural productivity (Century et al., 2008; Varshney et al., 2011). The crop yields
were reduced by 30% worldwide because of biotic stress, and this value is higher in
developing countries (Christou and Twyman, 2004; Farre et al., 2010). Overcoming the
biotic constraints reducing yields would be a desirable problem to solve.
1.1.2 Genetic engineering of crops to cope with environmental
challenges
The objective of crop improvements for stress adaptation by agricultural
biotechnology is to accumulate favorable alleles in genomes leading to better stress
tolerance. Although conventional breeding has historically been playing an important role
in crop improvements, it suffers several constraints (1) it takes longer time; (2)
undesirable traits can also be transferred during the process; (3) the reproductive barriers
limit the gene sources from various species; (4) complexity of the trait (Nelson et al.,
2007; Yang et al., 2010; Varshney et al., 2011).
Agricultural biotechnology is a viable option, which can circumvent some of the
constraints mentioned above. Generally there are two approaches for agricultural
biotechnology, molecular breeding (MB) and genetic engineering (GE). Comparing to
MB, GE has an advantage which has no barrier to transfer useful genes or alleles from
different species even different kingdoms to target plants, indicating that it might be a
3
very applicable and efficient strategy to conduct crop improvements (Christou and
Twyman, 2004; Varshney et al., 2011).
In recent years there are quite a few examples demonstrating that GE crops have
significantly improved biotic stress tolerance (Tricoli et al., 1995; Ferreira et al., 2002;
Castle et al., 2006) and abiotic stress tolerance under field conditions (Wang et al., 2005b;
Hu et al., 2006; Nelson et al., 2007; Vanderauwera et al., 2007; Castiglioni et al., 2008;
Oh et al., 2009; Wang et al., 2009; Xiao et al., 2009), not to mention tremendous
examples tested under laboratory conditions (Oh et al., 2005; Sade et al., 2010; Gao et al.,
2011b; Zhang et al., 2011; Zhou et al., 2011). For examples, transgenic rice plants with
elevated accumulation of abscisic acid (ABA) have greater drought tolerance under field
conditions (Xiao et al., 2009). Overexpression of a rice transcription factor AP37
elevated the transcription level of its target genes and increased the yield around 17%56% under the field drought conditions (Oh et al., 2009). Transgenic rice plants
overexpressing the stress-responsive NAC1 showed higher tolerance to salt and drought
stress under field conditions (Hu et al., 2006). Transgenic maize plants with increased
ZmNF-YB2 expression are more tolerant to drought (Nelson et al., 2007).
Compared with plants engineered for abiotic stress resistance, GE crops with
enhanced biotic stress tolerance have gone farther and were commercialized more than a
decade ago. For example, transgenic cotton and corn with Bt genes have been on the
market for over 10 years with increased quality and quantity. Moreover, Bt corn has
lower level of mycotoxin than non-Bt corn as a result of killing insects such as corn
4
earworm carrying mycotoxin-containing fungi (Castle et al., 2006). Second generation of
transgenic cotton entered the market in 2003 by Monsanto with the introduction of
stacked genes (e.g. combined two Bt genes for broader spectrum of insects and herbicide
resistance) (Castle et al., 2006). Several squash varieties resistant to various viruses
developed by Asgrow Seed Company have also been commercialized (Tricoli et al., 1995;
Castle et al., 2006). The most successful transgenic product is transgenic papaya
engineered to be resistant to papaya ringspot virus. This transgenic product has saved the
Hawaii papaya industry from collapse and made the expansion of papaya plantations to
other areas (Ferreira et al., 2002; Castle et al., 2006).
In general, GE technology is becoming more popular, and has the potential to
help address challenging problems in agriculture production. Although GE crops are not
magic wands, which can free agriculture from all challenges and problems, many benefits
have already been demonstrated. I support the view that genetic engineering is one of the
most effective strategies to significantly enhance agricultural development (Christou and
Twyman, 2004; Varshney et al., 2011). In this dissertation, I report research conducted to
explore the use of agricultural biotechnology for improvement of turfgrass, an
economically and environmentally important perennial crop species for enhanced
performance under adverse environmental stress.
5
1.1.3 Novel sources of transgenes for genetic engineering of enhanced
stress tolerance in transgenic plants
Using recombinant DNA and transgenic technologies, many genes from various
sources have been used to genetically engineer enhanced stress tolerance in transgenic
plants. Different levels of manipulation of target genes encoding either upstream
regulatory proteins and signaling molecules or downstream functional proteins using
either gain- or loss-of-function approaches have led to production of transgenic plants
with enhanced tolerance to various environmental stresses (Mittler and Blumwald, 2010).
In this dissertation research, I focus on genetic manipulation of two novel transgenes –
antimicrobial peptide (AMP) and microRNA (miRNA) in transgenic perennial species to
study their impact on plant response to environmental stress. I also conduct research to
study physiological and molecular mechanisms of miRNA-mediated plant response to
stress aiming at developing new biotechnology approaches to genetically improve crop
plants with enhanced performance, significantly contributing to agriculture production.
Novel antimicrobial peptides
Pathogenic fungi are among the most important biotic stresses plants face and
fight against. They are responsible for numerous crop diseases, and in some cases
conventional chemical methods are insufficient to control them. Besides decreasing
yields, they also produce mycotoxins which are stored in plant organs and negatively
affect human health (Punja, 2001; Christou and Twyman, 2004). One important strategy
to engineer plants with fungal resistance is to express molecules which can kill
6
pathogenic fungi or stop their growth. Pathogenesis-related (PR) proteins such as
chitinases and glucanases have been engineered for over 10 years in at least 20 plant
species including some agriculturally and economically important crops. These PR
proteins can hydrolyze the major component of fungal cell walls thus inhibiting hypha
growth. However, in most cases, the disease spreading may be restricted, but the overall
effect on disease control is not ideal. New sources of transgenes for enhancing general
defense responses to prevent fungal diseases still need to be further explored (Punja, 2001;
Christou and Twyman, 2004).
Small peptides with anti-fungal activity have also been largely tested in
laboratories to confer resistance to pathogenic fungi (Osusky et al., 2000; Sharma et al.,
2000a). Here, in my dissertation, I provide evidence demonstrating the effectiveness of a
new option of the small peptide Penaeidin4-1 (Pen4-1) from Atlantic white shrimp for
engineering fungal disease resistance in transgenic turfgrass. The data obtained point to
the great potential of using Pen 4-1 for engineering broad-spectrum fungal disease
resistance in crop species.
MicroRNAs
Breeding for enhanced plant tolerance to drought and salinity has always been
very challenging due to the complex nature of these stresses. For example, different
timing, duration, intensity and frequency of the stress can significantly impact
experimental quantification and repeatability (Varshney et al., 2011). The heterogenic
field conditions are very different from laboratory settings, adding additional layers of
7
complexity (Mittler and Blumwald, 2010; Varshney et al., 2011). Promising greenhouse
experimental results would not necessarily guarantee success under field conditions.
Moreover, multiple molecular pathways are involved in controlling plant response to salt
and drought stress, thus making the breeding task more challenging (Century et al., 2008).
In recent years, with the help of increasing genomic data and bioinformatics tools,
light has been shed on the molecular regulatory networks controlling plant abiotic stress
tolerance, and various upstream regulators have been identified as candidates for genetic
manipulation. These include the ABA-dependent AREB/ABF regulon, the Snf1-related
protein kinases , CBF/DREB regulon, the ABA-independent NAC/ZF-HD regulon,
microRNAs and others, of which microRNAs have become increasingly attractive for
study due to the important roles they play in plant responses to abiotic stress (Chen et al.,
2008; Nakashima et al., 2009; Mittler and Blumwald, 2010). MiR398, 393, 395, and 399
have been shown to regulate gene expression during abiotic stresses including
dehydration, salinity, cold, and oxidative stresses (Sunkar et al., 2006; Lu and Huang,
2008; Kawashima et al., 2009; Mittler and Blumwald, 2010; Gao et al., 2011a; Zhu et al.,
2011). Here I report our novel finding that miR319 is also involved in plant response to
abiotic stress, and try to answer a key question: how it functions in plants during abiotic
stress.
In the following section, I will focus on AMPs and miRNAs, provide specific
information about these two groups of novel transgenes, and explain how they can be
employed in plant genetic engineering.
8
1.2 Plant Genetic Engineering Using Antimicrobial Peptides
for Enhanced Biotic Stress Tolerance
1.2.1 General introduction to antimicrobial peptides (AMPs)
AMPs are short sequence peptides which play important roles in plant and animal
immune systems serving as a first line of defense. They generally consist of fewer than
50 amino acid residues. They are widespread in nature with high selectivity against target
organisms (Zasloff, 2002).
Based on the most important characteristic of AMPs-electrostatic charge, AMPs
can be subdivided into two major groups (Vizioli and Salzet, 2002; Keymanesh et al.,
2009). The larger group of AMPs is comprised of cationic molecules, while the much
smaller group of AMPs is comprised of non-cationic molecules including aromatic
peptides, anionic peptides and peptides derived from oxygen-binding proteins. The term
“AMPs” often refers to cationic AMPs (Zasloff, 2002; Keymanesh et al., 2009).
Based on structural features, AMPs can be subdivided into three classes (Figure
1.1) (1) “linear peptides often adopting α-helical structures”; (2) “cysteine-rich openended peptides containing a single or several disulfide bridges”; and (3) “cyclopeptides
forming a peptide ring” (Montesinos, 2007). All these AMPs share certain common
structural characteristics such as (1) cationic and hydrophobic residues are most abundant
in their amino acid composition; (2) amphipathicity; and (3) structures and conformations
are diverse (Vizioli and Salzet, 2002; Keymanesh et al., 2009). In fact, the second
9
characteristic, amphipathicity, can facilitate interactions between AMPs and microbial
membranes (Zasloff, 2002). Some AMPs are enriched in certain amino acids. For
example, a large amount of cationic AMPs are rich in cysteines forming a single or
several disulfide bridges (e.g., Ib-AMP4 from balsamine and Penaeidins from shrimp),
which makes their structures more compact and stable against complicated cell
biochemical conditions such as protease degradation. This group of AMPs is widely
spread in nature and exhibits a remarkable sequence and structure diversity (Vizioli and
Salzet, 2002; Hancock and Sahl, 2006).
AMPs can act potently towards pathogens but without damaging host cells. This
selectivity may profit from the structure differences between host and target membranes
(Yount and Yeaman, 2005). Although the details of how AMPs function towards target
microorganisms are still remained further explored, it is generally accepted that the
amphipathiciy, cationic charge and small size of AMPs have played important roles to
allow AMPs to attach to and insert into bacterial membrane bilayers. After insertion into
the membrane, antimicrobial peptides act by either disrupting the membrane bi-layer
physically or trans-locating themselves across membranes and inhibit certain internal
targets (Yount and Yeaman, 2005; Hancock and Sahl, 2006).
10
Figure 1.1 Three structures of AMPs. Adapted from Montesinos (2007).
The exceptionally broad range of microbial targets of antimicrobial peptides, and
the absence of side effects to host organisms arouse interests in exploiting the great
potential of these molecules in agricultural application (Hancock and Sahl, 2006).
1.2.2 Application of AMPs in agriculture
Transgenic technology accelerates genetic engineering of various crop species
with AMP-encoding genes (Van der Biesen, 2001). It allows the transfer of antimicrobial
genes into target plants from other species, thus overcoming the sexual barriers among
different species, which limit the conventional breeding of disease resistance. In fact,
agricultural uses of antimicrobial genes for plant improvement have been quite extensive,
as demonstrated in tobacco, potato, tomato, oilseed crops and trees (Keymanesh et al.,
2009). For example, expression of the mammalian antimicrobial peptide cecropin P1 with
31 amino acid residues conferred enhanced resistance to several phytopathogenic bacteria
11
to transgenic tobacco (Zakharchenko et al., 2005). Expressing of Alfalfa antifungal
peptide (alfAFP) from seeds of Medicago sativa in transgenic potato led to enhanced
resistance to fungal diseases (Gao et al., 2000). Expression Mj-AMP1 from Mirabilis
jalapa in transgenic tomato led enhanced resistance to early blight disease (Schaefer et al.,
2005). Expression of cecropin B from Bombyx mori, in transgenic rice plants could
confine lesion development of bacterial leaf blight (Sharma et al., 2000a).
However, there have been few reports on the introduction of antimicrobial genes
into turfgrass plants for improving disease resistance. Recently, a truncated dermaseptin
SI gene encoding a peptide with 18 amino acid residues was introduced into tall fescue
(Dong et al., 2007). The resulted transgenic plants displayed normal morphology and
greater resistance to gray leaf spot (M. grisea) and brown patch diseases (R. solani). This
encouraging result (Dong et al., 2007), together with the above mentioned reports of
transgenic tobacco, potato, tomato, oilseed crops and trees, suggest the potential of using
AMPs to generate resistance to a wide range of pathogens in turfgrass.
1.2.3 Animal derived AMP- Pen4-1
Besides plant derived AMPs, animal derived AMPs have also been considered and
demonstrated to be useful for plant genetic engineering, because they have already been
shown to be inhibitory to plant pathogenic pathogens by in vitro and in vivo study
(reviewed by Meng et al., 2010). For example, an animal derived AMP esculentin-1 with
46 amino acid residues present in the skin secretions of Rana esculenta, with the
12
substitution Met-28Leu, was introduced into tobacco. The transgenic plants exhibited
resistance against bacterial and fungal phytopathogens (Ponti et al., 2003). Additionally
expression of the mammalian AMP cecropin P1 in transgenic tobacco resulted in
increased resistance to several phytopathogenic bacteria (Zakharchenko et al., 2005).
Moreover some plant pathogens may have already evolved and gained tolerance to plant
derived AMPs, thus decreasing the effects of the AMPs in vivo (Li et al., 2001).
Penaeidins, a family of AMPs originally isolated from the haemocytes of penaeid
shrimp, are considered to be a source of AMPs which have the potential to apply in
agriculture to deliver disease resistance to plants. Shrimp mainly rely on innate immune
system (Cuthbertson et al., 2004), in which penaeidin antimicrobial peptides are one of
the key elements (Cuthbertson et al., 2006). Penaeidins have a unique two-domain
structure including an unconstrained proline-rich N-terminal domain (PRD) and a
cysteine-rich domain (CRD) with a stable α–helical structure (Cuthbertson et al., 2005)
(Figure 1.2). They primarily act against Gram-positive bacteria and fungi (Destoumieux
et al., 1999), and are synthesized in granular haemocytes. Upon infection, penaeidins are
released into the plasma and localized to tissues, eventually binding to cuticle surfaces
(Destoumieux et al., 2000a; Destoumieux et al., 2000b; Muñoz et al., 2002). The
complexity inherent in the multi-domain structure of the peptide may contribute to its
broad range of microbial targets (Destoumieux et al., 2000a; Destoumieux et al., 2000b;
Yang et al., 2003).
13
Figure 1.2 Structure of Pen4-1. Adapted from Cuthbertson et al. (2005). This figure was
originally published in Journal of Biological Chemistry. Cuthbertson et al. Solution
structure of synthetic penaeidin-4 with structural and functional comparisons with
penaeidin-3. Journal of Biological Chemistry. 2005; 280: 16009-16018. © the American
Society for Biochemistry and Molecular Biology.
The penaeidin family is comprised of four classes, designated 2, 3, 4 and 5, and
each class consists of different isoforms displaying a significant level of sequence
diversity (Chen et al., 2004; Cuthbertson et al., 2006). Pen4-1, a class four isoform one
penaeidin, isolated from Atlantic white shrimp (Litopenaeus setiferus). It contains 6
cysteine residues forming 3 disulfide bridges, and is the shortest isoform in penaeidin
family with a length of 47 amino acids (Figure 1.2). It can inhibit multiple plant
pathogenic fungal species, including the Botrytis. cinera, Penicillium. crustosum, and
Fusarium. oxysporum (Bachère et al., 2000). It is also effective at preventing growth of
the Gram-positive bacteria including the species Micrococcus. luteus and Aerococcus.
14
viriduans, and it is inhibitory against the Gram-negative bacteria - Escherichia. coli at
relatively high concentrations (Cuthbertson et al., 2006). Notably, Pen4-1 can fight
against multidrug-resistant fungi species: Cryptococcus neoforman (Steroform A,
Steroform B, Steroform C, Steroform D) and Candida spp (Candida lipolytica, Candida
inconspicua, Candida krusei, Candida lusitaniae, Candida glabrata) (Cuthbertson et al.,
2006) (Table 1.1). Compared with other penaeidins, penaeidin class 4 has been shown to
be highly effective against fungi (Cuthbertson et al., 2006). Additionally, the unusual
amino acid composition of PRD Pen4-1 may confer resistance to proteases (Cuthbertson
et al., 2006). These results suggest that Pen4-1 is an ideal candidate for genetic
engineering of enhanced disease resistance in turfgrass.
15
Table 1.1 A range of microbial organims Pen4-1 can fight against. Adapted from
Cuthbertson, et al. (2006)
Although the mechanism of how penaeidins act towards microorganisms has not
yet been revealed, recent work with other proline-rich AMPs indicates that penaeidins
might function through targeting certain cytosolic proteins (Otvos, 2000; Cuthbertson et
al, 2004). For example, the proline-rich AMP apidaecin originally isolated from honey
bee, can not only penetrate the microbial membrane but also internalize itself, and then
target the heat-shock protein 70, an important molecular chaperone (Zasloff, 2002; Otvos
2000; Cuthbertson et al, 2004). It is hypothesized that a more complex mechanism rather
than simple membrane disruption, i.e., targeting a specific microbial cytosolic component
is adopted by Pen4-1 (Otvos, 2000; Cuthbertson et al, 2004, Cuthbertson et al, 2006).
1.3 Genetic Engineering of MicroRNAs for Enhanced Abiotic
Stress Tolerance
1.3.1 General introductions to microRNAs and miR319
The first glance in the world of small RNAs was the identification of microRNA
(miRNA) genes, lin-4 and let-7 in nematodes. Lin-4 and let-7 control nematode
development timing by regulating gene expression at post-transcriptional level. It was the
first time people identified small RNAs and demonstrated that they negatively regulated
16
gene expression and were involved in development. (Slack et al., 2000). After the
identification of a large number of miRNAs in other species, we now know that they are
a universal element in animals, plants and humans. Although the studies on miRNAs
have been more advanced in animals, for the past several years, our understanding and
knowledge of miRNAs in plants have grown very rapidly. Since 2002, more than 180
genes and over 2500 genes encoding miRNAs in Arabidopsis and across all plant species
respectively, have been annotated (miRBase).
MiRNAs are a class of 20 to 22 nt non-coding RNAs. They are encoded by
miRNA genes and transcribed into primary transcript, which are then processed into pre
and mature RNAs. The mature RNA can either direct cleavage or translational repression
of its target genes. In plants, the main mode of action is direct cleavage by being recruited
into RISC where many proteins are present (Jones-Rhoades et al., 2006).
Identifying and annotating plant miRNAs are more complicated in plants than in
animals not only because of the slightly different characteristics the plant miRNAs
possess but also because of the fact that the plant miRNAs are only minorities in the large
and complex populations of small RNAs, which is in contrast to the case in some of the
vertebrates and flies where miRNAs are majority in the small RNA populations (Meyers
et al., 2008). With the identification of hundreds of miRNAs, the challenge, then, is to
understand each miRNA’s specific biological functions. To date, miRNAs have been
shown to play a critical roles in development, abiotic and biotic stress response, and
17
nutrient homeostasis via interaction with their targets (Jones-Rhoades et al., 2006;
Meyers et al., 2008).
My present project focuses on studying the regulatory roles of microRNA 319
(miR319) in controlling plant morphology and abiotic stress tolerance. The miR319
family is one of the first characterized and conserved miRNA families in plants, and it
has been demonstrated to target TEOSINTE BRANCHED/CYCLOIDEA/PCF (TCP)
genes encoding plant-specific transcription factors known to be largely involved in leaf
development (Palatnik et al., 2003). MiR319 family is one of the most ancient and
conserved miRNAs found in a large number of plant species (Axtell and Bowman, 2008;
Cuperus et al., 2011). It has a very unique loop-first processing mechanism which makes
its fold-back structure widely conserved in the evolution (Bologna et al., 2009). This may
indicate its importance in controlling plant development and suggests that it could be a
candidate target of genetic manipulation for plant trait modifications. Recently, an
increasing number of microarray data demonstrated potential involvement of the miR319
genes in plant response to abiotic stress response (Sunkar and Zhu, 2004; Liu et al., 2008;
Zhou et al., 2010a; Zhou et al., 2010b), but direct experimental proof about the
contribution of the miR319 family to plant abiotic stress response is still lacking.
The impact of miR319 on plant morphogenesis has been studied in dicots.
However, there has been no published data reporting similar research in monocots,
especially in perennial grass species. Here, we use creeping bentgrass as an example to
try to answer three questions which have not been addressed before:
18
(1) What impact the miR319 gene family may have in plant development in perennial
grasses?
(2) Is miR319 involved in plant abiotic stress response in perennial grasses?
(3) What is the molecular mechanism of miR319-mediated plant tolerance to abiotic
stress in perennial grasses?
1.3.2 Origin, biogenesis and modes of actions of plant miRNAs
1.3.2.1. General biogenesis of plant miRNAs
MiRNAs are fundamental and key post-transcriptional regulators of eukaryotic
gene expression. Plant pri-miRMAs are transcribed by Pol II (RNA polymerase II) from
miRNA genes mostly located far from protein-coding genes (Jones-Rhoades et al., 2006).
As Figure 1.3 demonstrated, the RNA-binding protein DDL (DAWDLE) is presumed to
stabilize pri-miRNAs for their later splicing. The conversion to pre-miRNA happened in
D-bodies (nuclear processing centers) (Voinnet, 2009; Mateos et al., 2011). Here, three
important components - SE (C2H2-zinc finger protein SERRATE), HYL1 (the doublestranded RNA-binding protein HYPONASTIC LEAVES1) and DCL1 (Dicer-like 1)
function coordinately (Voinnet, 2009; Mateos et al., 2011). Pre-miRNAs are then cut into
mature miRNAs duplexes - miRNA/miRNA* by DCL1 (miRNA is the guide strand, and
miRNA* will be degraded), and methylated by HEN1, which is an action to prevent them
from being degraded by SDN (SMALL RNA DEGRADING NUCLEASE) class of
exonucleases. Mature miRNAs are then exported to the cytoplasm possibly by plant
19
exportin 5 ortholog HASTY and other unknown factors. The guide strand is then
incorporated into ARGONAUTE (AGO) proteins to carry out their silencing function
(Xuemei, 2005; Voinnet, 2009; Mateos et al., 2011) (Figure 1.3).
20

Figure 1.3 Biogenesis of plant miRNAs. Adapted from Voinnet (2009).
21
1.3.2.2. Mechanisms of plant miRNA precursor processing
A common core step in miRNA biogenesis is precursor processing. The precision
of this process is responsible for the miRNA specificity and ultimately for their correct
function (Mateos et al., 2011). In animals, DROSHA cuts at approximately 11 nt from
“the joint between the single-stranded RNA and double-stranded stem” to produce premiRNA (Han et al., 2006). After exporting pre-miRNA to nucleus, Dicer performed the
second cut at around 21 nt from the end of the pre-miRNA to release the
miRNA/miRNA* duplex (Carthew and Sontheimer, 2009; Mateos et al., 2011). Slightly
different from animal pri-miRNAs which are normally homogenous fold-back structures,
plant pri-miRNAs are a collection of diverse stem-loop structures with different sizes and
shapes, thus making it more difficult to define its mechanism (Mateos et al., 2011).
Recent studies indicate that there are two processing mechanisms in plant
miRNAs - “base-to-loop” and “loop-to-base” (Bologna et al., 2009; Mateos et al., 2011).
The majority of the plant miRNAs adopts the “base-to-loop” processing mechanism,
which is a mode more similar to animal precursor processing (Addo-Quaye et al., 2009;
Bologna et al., 2009; Werner et al., 2010). In this model, the precursor is comprised of 3
regions: (1) a partially structured 15-nt lower stem, (2) miRNA/miRNA* duplex, and (3)
a terminal loop (Werner et al., 2010; (Mateos et al., 2011). The lower stem located below
the miRNA is first recognized and cut. Then a second cleavage is followed to release the
mature miRNA (Figure 1.4a). The whole processing appears to depend on lower stem,
and even a single change in this region is able to fail its processing (Werner et al., 2010).
22
However, the family of miR319/159 is an exception of this canonical model. They
have large fold-back sequences consisting of 4 parts (1) lower stem (LS), (2)
miRNA/miRNA* (duplex M/M*), (3) upper stem (US) and (4) terminal loop (TL)
(Addo-Quaye et al., 2009; Mateos et al., 2011). Unlike other plant miRNAs, the
processing begins with a first cleavage to release TL instead of LS. Next, 3 more dicing
events occur until the duplex M/M* is finally liberated (Addo-Quaye et al., 2009) (Figure
1.4b). In contrast to “base-to-loop” mechanism, LS is not important in this model.
Actually, a miR319a precursor without LS was processed efficiently in vivo. However,
this processing is extremely sensitive to modifications in US and TL (Addo-Quaye et al.,
2009; Bologna et al., 2009). In addition, the bulges present in the fold-back structure help
the accumulation of miRNAs instead of other small RNAs. This unique “loop to base”
processing mechanism of miR319 is conserved in Arabidopsis and moss, indicating that
this mechanism is evolutionarily ancient (Addo-Quaye et al., 2009; Bologna et al., 2009).
23
Figure 1.4
Mechanisms of plant miRNA precursor processing (a) Base-to-loop
processing mechanism for plant miRNA biogenesis. (b) Noncanonical loop-to-base
processing of miR319 precursor. Adapted from Mateos et al. (2011).
1.3.2.3. MicroRNA-directed mRNA cleavage
MicroRNAs regulate gene expression by two basic mechanisms: RNA cleavage
and translational repression. It has been indicated that the complementarity of target sites
between miRNAs and their target mRNAs are key determinants of which mode to be
adopted. Perfect complementarity may lead to the mechanism of slicing, whereas
mismatch in the central area of the target site is supposed to trigger translational
inhibition (Hutvágner and Zamore, 2002; Song et al., 2004). Unlike animal miRNAs,
plant miRNAs show perfect or near-perfect match with their targets, and they are
believed to adopt the slicing mode more frequently (Brodersen et al., 2008). In slicing
mode, miRNA guides AGO to cleave a single phosphodiester bond within target mRNA
molecules. After the direct cleavage, AGO is freed to carry out other slicing (JonesRhoades et al., 2006).
24
However, by 2007 there are already several examples demonstrating the existence
of translational expression - miR172 as a translational repressor of AP2 in Arabidopsis
flower development and miR156/157 as an inhibitor of SP13 translation (Chen, 2004;
Gandikota et al., 2007). In 2008, a breakthrough was made by Brodersen et al.
demonstrating that “plant miRNA-guided silencing has a widespread translational
inhibitory component that is genetically separable from endonucleolytic cleavage”
(Brodersen et al., 2008).
In 2009, combining all the data, a general model was proposed to explain the
mode of miRNA actions (Brodersen et al., 2008; Voinnet, 2009) (Figure 1.5). In this
model, it is suggested that slicing was predominantly adopted by plant miRNAs and
suited to produce irreversible switches (Figure 5, left). Nonetheless, when a reversible
switch was needed, translational repression would be suited, for instance, to coordinate
and reset stress-responsive gene expression (Figure 5, middle) (Voinnet, 2009). These
two layers of regulation could be brought together by plants, yet they may not coincide
spatially or temporally (Figure 5, right) (Voinnet, 2009).
25
Figure 1.5
Modes of miRNA acitons (a) Slicing (b) Translational inhibition
(c)Translational inhibition and slicing. Adapted from Voinnet (2009).
1.3.3 Regulatory roles of miRNA-target nodes
1.3.3.1. Concept of miRNA-target nodes
A miRNA node is “an interface that comprises the regulatory relationship
between a specific locus from a miRNA family and the direct targets under its control”
(Rubio-Somoza et al., 2009; Rubio-Somoza and Weigel, 2011). MiRNA nodes can either
infer to a certain specific case such as the relationship between one miRNA locus and one
target (e.g. miR319a-TCP2 node) or the relationship between all miRNA loci of a family
and all its targets (e.g. miR319-TCP) (Rubio-Somoza and Weigel, 2011). Many predicted
miRNA targets encode regulatory proteins such as transcription factors, suggesting a role
of miRNAs as master regulators and pointing miRNA-target nodes to be the core of gene
regulation networks (Jones-Rhoades et al., 2006).
26
1.3.3.2. Identification of miRNA-target nodes
To identify the miRNA-target nodes in plant regulatory work, the first two things
needed to do are to identify novel miRNA genes and their targets.
(1) Identification of plant miRNA genes
The following 3 methods are most commonly used to identify novel plant miRNA
genes (Jones-Rhoades et al., 2006).
i)
Direct cloning and sequencing
Directly isolate small RNAs from plant samples, ligate them to adaptor
oligonucleotides, and do reverse transcription, amplification, and
sequencing (Jones-Rhoades et al., 2006). The early sequencing method
is conventional sanger sequencing (Reinhart et al., 2002; Sunkar and
Zhu, 2004), which generates a lot of false positives (Jones-Rhoades et
al., 2006; Jones-Rhoades, 2011). Later the emergence of deep
sequencing first in 2005 (Lu et al., 2005) has much facilitated our
understanding on identification and annotating plant miRNAs.
ii) Forward genetics
Although miRNAs were first discovered by forward genetic screens in
C. elegans (Lee et al., 1993), few plant miRNAs were discovered by
this method (Jones-Rhoades, 2011). This is mainly because of function
redundancy among different members of a miRNA family and small
target sizes for mutagenesis (Jones-Rhoades, 2011).
27
iii) Bioinformatics predictions followed by experimental confirmation
Annotate homologs of miRNA discovered by cloning using
bioinformatics tools. For example, a genome is sequenced and
assembled. Except some evolutionarily young miRNAs, it is
convenient to annotate the homologs of known miRNAs by analyzing
conservation in sequence and secondary structure (Jones-Rhoades et al.,
2006; Meyers et al., 2008).
(2) Identification of miRNA targets
Because of high complementarity between targets and a microRNA mature
sequence is required for the interactions, target identification in plants is much easier
compared with animals (Schommer et al., 2008). This also facilitates the prediction of
targets by algorithm based on homology query
Based on high complementarity, a set of miRNA targets can be identified by
bioinformatics tools, especially for those miRNA-target pairs conserved across species
(Reinhart et al., 2002; Rhoades et al., 2002; Jones-Rhoades and Bartel, 2004; JonesRhoades, 2011). A set of experimental techniques can then be used to corroborate the
miRNA-target relationship. Another strategy to identify miRNA targets is to do mRNA
expression arrays in genome-wide screens (Jones-Rhoades et al., 2006). For example,
expression array data demonstrated that the expression of 5 TCP genes was
downregulated in Arabidopsis plants overexpression miR319 (Palatnik et al., 2003;
Jones-Rhoades et al., 2006).
28
1.3.3.3. The scope of diverse regulatory roles of miRNA nodes
(1) MiRNA networks and plant development
Two reverse genetic strategies are commonly used to investigate the function of
particular miRNA nodes. The first is an overexpression strategy to potentially downregulate all possible target genes controlled by the miRNA. The second strategy is to
make transgenic plants expressing a modified version of targets which are resistant to its
corresponding miRNA (Palatnik et al., 2003; Jones-Rhoades et al., 2006).
By using these strategies, functions of several miRNA nodes have been identified.
Later the network of these nodes is revealed gradually, demonstrating that plant miRNA
notes play a pivotal role in plant development such as phase change, architecture and
stress response (Rubio-Somoza and Weigel, 2011). Several miRNA nodes participating
in different developmental events have been characterized (Rubio-Somoza and Weigel,
2011) and there are several examples described in the following paragraphs.
Currently, the most known mechanisms of leaf senescence involve two miRNA
nodes including miR319-TCP and miR164-NAC. Expression of miR164 declines as leaf
aging thus leading to increased expression of its targets NAC1, ORE1 which promote leaf
senescence. Accordingly, miR164 ectopic or constitutive expression would promote leaf
longevity (Kim et al., 2009; Rubio-Somoza and Weigel, 2011). MiR319 actively
participates in many plant developmental events, among which is leaf senescence (RubioSomoza and Weigel, 2011). Ectopic expression of miR319 would make Arobidopsis
leaves stay greener, and delay the onset of leaf senescence compared with wild type
leaves. Its target TCP4 gene was demonstrated to be active in many old leaves. It is
29
proposed that the down-regulation of TCP genes by miR319 leads to low expression level
of LOX2 (LIPOXYGENASE2) gene, which is positively regulated by TCP transcription
factors and is one the most important JA (Jasmonic acid) synthesis enzymes. Since JA
negatively regulates leaf senescence, low levels of JA promote leaf longevity in plants
with impaired miR319-TCPs activity (Schommer et al., 2008). Although these 2 nodes
are all involved in the similar process, the problem whether they cross talk still remains to
be addressed (Rubio-Somoza and Weigel, 2011).
The large number of amazing variety of leaf shapes is a mystery which fascinated
people for centuries till the discovery of miRNAs. It is first unrevealed in Arabidopsis
that specific and systematic regulation by miRNAs play the primary role on leaf
patterning responsible for the majority of phenotypes (Todesco et al., 2010; RubioSomoza and Weigel, 2011). Regulating leaf morphogenesis mainly includes three aspects,
organ polarity, cell proliferation, and vascular development, in which various miRNA
nodes are involved. For example, At least four miRNA nodes (miR164, miR319, miR396
and miR390) are involved in regulation of the cell proliferation (Rubio-Somoza and
Weigel, 2011), which will be discussed in more detail in 1.3.4. Organ polarity including
abaxial/adaxial differentiation consists of at least miR165/166 and miR390. For vascular
development, miR165/166 and miR159 nodes play essential roles (Donner et al., 2009;
Rubio-Somoza and Weigel, 2011).
30
(2) Regulatory roles of miRNAs in plant stress response
The exploration of the relationship between miRNA expression and stress
responses has just started. It is discovered that reduced expression of miR398 leads to
improved tolerance to oxidative stresses through regulation of its target genes (Sunkar et
al., 2006). Additionally, expression of miR395 increases upon sulfate starvation (JonesRhoades and Bartel, 2004). MiR399 down-regulates its target mRNA accumulation upon
Pi starvation (Fujii et al., 2005). These data suggest that miRNAs have functional roles
for plants to cope with various environmental stresses.
There are also several research groups performing high-throughput profiling of
the expression of the known miRNAs under different environmental stresses (JonesRhoades and Bartel, 2004; Sunkar and Zhu, 2004; Zhao et al., 2007; Yang et al., 2008;
Ding et al., 2009). Sequencing of a library of small RNAs isolated from Arabidopsis
seedlings exposed to various stresses identified several stress-related miRNAs. MiR393,
miR397b and miR402 that were up-regulated in response to cold, dehydration, salinity
and ABA (Sunkar and Zhu, 2004). Later, 14 stress-inducible miRNAs were identified in
Arabidopsis by microarray analysis and confirmed by RT-PCR. Of the 14 miRNAs
identified, 10, 4 and 10 microRNAs are regulated by high-salinity, drought and cold
respectively. This showed that some of these 14 miRNAs were prone to being induced by
not only one treatment, indicating a cross talk between miRNAs and different stressors
(Yang et al., 2008). In other eudicots, genome-wide high-throughput sequencing was also
performed to identify stress-responsive miRNAs. For instance, in Medicago truncatula
31
32 known miRNAs and 8 new miRNAs were identified to be responsive to drought stress
(Wang et al., 2011).
Early studies in monocots have also demonstrated that miRNAs contribute to
plant adaptation to stresses. For example, microarray analysis examining miRNA
expression during drought stress in rice showed that miR169g was up-regulated upon
drought (Zhao et al., 2007). Later miR169g and miR169n were found to be induced by
high salinity in rice (Zhao et al., 2009). In maize, microarray hybridization revealed that
the expression of 98 miRNAs from 27 families were significantly affected after salt
treatment (Ding et al., 2009). MiR474 which targets proline dehydrogenase (PDH) was
shown to be up-regulated during drought stress in maize (Wei et al., 2009).
In addition, microRNAs are also reported to be responsive to cold stress,
oxidative stress, hypoxia stress, UV-B radiation and nutrient stress (Martin et al., 2010;
Sunkar, 2010). Furthermore, a comparative analysis using an array-based approach
between a salt tolerant and salt sensitive maize variety indicated differential responses of
miRNAs during salt stress (Ding et al., 2009). Stem-loop RT-PCR analysis in sugarcane
also indicated differential responses of miRNAs between cold-tolerant and cold-sensitive
cultivars upon cold stress (Thiebaut et al., 2011). Identification of relevant traits in stresstolerant relatives could provide insights into strategies that can be used for future
improvement of crops for their responses to stress.
In general, miRNAs play an important role in plant stress response regulatory
networks. The discovery of stress responsive miRNAs is just a start, it would be more
32
challenging to unravel the detailed regulatory role each miRNA plays and how they
coordinate together to form a network. In the future, miRNA networks and their targets
represent an important genetic reservoir that can be exploited to better understand the
molecular mechanisms of plant stress response and further applied in genetic engineering
for developing new cultivars with greater stress tolerance (Sunkar, 2010).
1.3.4 Current understanding of miR319-mediated plant morphogenesis
and abiotic stress response
1.3.4.1. miR319 family is highly conserved among different species
Although the majority of the plant miRNAs are family- or species-specific, a
minority of the miRNA families is conserved among different plant families. In particular,
miR319 family is extremely conserved not only in angiosperms but also in gymnosperms,
lycopods and bryophytes as shown in Figure 1.6 (Axtell and Bowman, 2008; Cuperus et
al., 2011). This high conservation among different land plant species indicates that it has
important biological functions.
33
Figure 1.6 MiR 319 family presented in various land species. In each species, the study
of miR319 was scored depending on the accumulation of experimental support.
Abbreviations: ath, Arabidopsis thaliana; bna, Brassica napus; mtr, Medicago truncatula;
osa, Oryza sativa; ppt, Physcomitrella patens; pta, Pinus taeda; ptc, Populus trichocarpa;
smo, Selaginella moellendorffii; tae, Triticum aestivum; vti, Vitis vinifera; zma, Zea mays.
Aadapted from Axtell and Bowman (2008).
1.3.4.2. miR319- mediated plant morphology change
Although a vast majority of microRNAs were discovered by sequencing, the first
plant miRNA mutant jawD which overexpresses Ath-miR319a was discovered through
experimentation instead of deep sequencing (Palatnik et al., 2003). In addition, the target
genes of miR319 were first identified and confirmed by experimental analysis (Palatnik
et al., 2003; Schommer et al., 2008). The TCP gene family is a group of plant-specific
transcription factors which were known to be largely involved in plant leaf development.
All the members in the TCP gene family share a conserved TCP domain region which
adopts a basic helix-loop-helix structure (bHLH). TB from maize, CYC from antirhium
34
and PNCA from rice are the founding members of the TCP family. It is suggested that
they negatively regulate plant development by observing their mutant phenotypes. In
Arabidopsis, 5 target genes of miRNA319 are TCP2, TCP3, TCP4, TCP10, and TCP24,
which belong to class 2 of the TCP family. This group of TCP genes is represented by
CIN in Antirrhinum (Nath et al., 2003; Schommer et al., 2008; Nag et al., 2009).
Leaves are emerged from shoot apical meristem (SAM) where a pool of
undifferentiated cells is. With the regulation of auxin, the leaf primordia are formed. Leaf
complexity is determined by cell proliferation at the leaf margin, which can decide the
margins being dissected, entire or formation of compound leaves. The boundary between
undifferentiated cells and the cells for differentiation is established by the miR164
targeting CUC1 (CUP-SHAPED COTYLEDON1) and CUC2 (CUP-SHAPED
COTYLEDON2) (Palauqui et al., 1997; Rubio-Somoza and Weigel, 2011). Fused
cotyledons occur when miR164-CUC activity is compromised in agreement with
phenotypes when miR319-TCP regulation is compromised (Palauqui et al., 1997).
Furthermore, TCPs can directly bind to the regulatory sequences of miR164a and
modulate its expression level, suggesting miR164 node is ultimately impacted by miR319
node (Rubio-Somoza and Weigel, 2011) (Figure 1.7).
35
Figure 1.7 Coordinated action of miRNA nodes in regulating cell proliferations in plant
leaves. Modified from Rubio-Somoza and Weigel (2011).
In Arabidopsis, the absence of miR319-TCPs or miR164a-CUC2 causes leaf
margins to be excessively proliferated leading to crinkled and more serrated leaves
(Figure 1.8a, b). Overexpression of a miR319-resistant form of TCP2 fully restores Jaw
mutants (Figure 1.8c) (Palatnik et al., 2003; Koyama et al., 2007). Cin (CINCINNATA)
mutants have crinkly leaves too. The snapdragon CIN gene, which belongs to TCP family,
is required for forming a flat leaf by differential regulation of cell division on different
stages of leaf morphogenesis (Nath et al., 2003). For compound leaf formation, the
escape of TCP protein LA (LANCEOLATE) by miR319 also had a significant impact on
leaf morphology. In la homozygous individuals, only simple leaves would be produced
36
because of too strong TCP activity leads to cell proliferation arrest (Figure 1.8d) (Ori et
al., 2007; Rubio-Somoza and Weigel, 2011).
Figure 1.8 MiR319 mediated plant leaf morphology change. (a) The phenotypic change
of miR-JAW Arabidopsis mutant. (b) The morphology change of tomato leaves by
overexpressing miR319. (c) The phenotype in Arabidopsis caused by overexpression of
miR319 resistant version of TCP2. (d) MiR319 regulated La gene in dose-dependent
manner, leading to reduced leaf complexity and transformation from compound leaf to
simple leaflet. Adapted from Palatnik et al. (2003), Ori et al. (2007). Adapted by
permission from Macmillan Publishers Ltd: [Nature] (Palatnik et al.), copyright (2003)
and permission from Macmillan Publishers Ltd: [Nature Genetics] (Ori et al.), copyright
(2007).
Although miR319 regulated TCP activity has been well studied in dicot species,
there have been no published data on this in monocot species. Our study in turfgrass
would fill this blank.
37
1.3.4.3. MiR319-mediated plant abiotic stress response
In Arabidopsis miR319 was up-regulated in response to cold stress (Sunkar &
Zhu 2004, Liu 2008). Theibaut et al. conducted research studying in more detail about
how miR319 was involved in the regulation of cold stress. Their data showed a
complicated behavior of miR319 in response to cold stress. MiR319 was up-regulated
first after 24 hours of treatment in a cold stress environment and then down-regulated
after a 48-hour treatment. When they compared the miR319 expression in two sugarcane
cultivars - cold sensitive and cold tolerant, they found the induction of miR319 was
delayed and weaker in a cold-tolerant cultivar compared with a cold-sensitive cultivar.
The change in expression level of their putative targets PCF6 and GAMyB upon cold
stress is complicated. Although they decreased after a 48-hour treatment of cold stress,
PCF6 was up-regulated after 24h. When using other cultivars, PCF6 was still upregulated after 48h, but GAMyb was down-regulated. These genes are regulated not only
by miR319, but also by some other signals, for example ABA. ABA can be triggered by
cold stress, and some Myb genes such as GAMyb can be induced by ABA. So the
expression level would be a balance of ABA induction and miR319 cleavage. In fact, the
expression level of target genes did not decrease even when the miRNA cleavage of
target mRNA occurred (Thiebaut et al., 2011).
It has also been reported that a single miRNA has the potential to regulate multistress related target genes (Yang et al., 2008). MiR319 was up-regulated 1.81 fold upon
300 mM of NaCl treatment and 1.54 fold upon cold stress (Yang et al., 2008). Moreover
analysis of the stress-relevant cis-elements in the promoter regions of miRNA genes
38
provides additional evidence that the miRNAs are very likely to be involved in plant
response to abiotic stress. In the upstream regions of miRNA 319 genes in Aradidopsis,
there are two TC-rich repeats (defense and stress), two AREs (stress), MBS (drought),
HSE (heat stress), TGA element (auxin), AuxRR core (auxin), Box W1 (fungal elicitor)
(Yang et al., 2008).
Although the current microarray data and promoter analysis all suggest that
miR319 may be correlated with plant stress response, in vivo experimental evidence
demonstrating how miR319 regulates this process is still lacking. My present study will
provide information allowing more understanding on how miR319 impacts plant
adaptation to salt and drought stress in monocot perennial grasses.
References
Addo-Quaye, C., Snyder, J.A., Park, Y.B., Li, Y.F., Sunkar, R., and Axtell, M.J.
(2009). Sliced microRNA targets and precise loop-first processing of MIR319
hairpins revealed by analysis of the Physcomitrella patens degradome. RNA 15,
2112-2121.
Axtell, M.J., and Bowman, J.L. (2008). Evolution of plant microRNAs and their targets.
Trends in plant science 13, 343-349.
39
Bachère, E., Destoumieux, D., and Bulet, P. (2000). Penaeidins, antimicrobial peptides
of shrimp: a comparison with other effectors of innate immunity. Aquaculture 191,
71-88.
Barrett-Lennard, E., and Setter, T. (2010). Developing saline agriculture: moving from
traits and genes to systems. Functional Plant Biology 37, iii-iv.
Bologna, N.G., Mateos, J.L., Bresso, E.G., and Palatnik, J.F. (2009). A loop-to-base
processing mechanism underlies the biogenesis of plant microRNAs miR319 and
miR159. The EMBO journal 28, 3646-3656.
Brodersen, P., Sakvarelidze-Achard, L., Bruun-Rasmussen, M., Dunoyer, P.,
Yamamoto, Y.Y., Sieburth, L., and Voinnet, O. (2008). Widespread
translational inhibition by plant miRNAs and siRNAs. Science 320, 1185-1190.
Carthew, R.W., and Sontheimer, E.J. (2009). Origins and Mechanisms of miRNAs and
siRNAs. Cell 136, 642-655.
Castiglioni, P., Warner, D., Bensen, R.J., Anstrom, D.C., Harrison, J., Stoecker, M.,
Abad, M., Kumar, G., Salvador, S., and D'Ordine, R. (2008). Bacterial RNA
chaperones confer abiotic stress tolerance in plants and improved grain yield in
maize under water-limited conditions. Plant Physiology 147, 446-455.
Castle, L.A., Wu, G., and McElroy, D. (2006). Agricultural input traits: past, present
and future. Current opinion in biotechnology 17, 105-112.
Century, K., Reuber, T.L., and Ratcliffe, O.J. (2008). Regulating the regulators: the
future prospects for transcription-factor-based agricultural biotechnology products.
Plant Physiology 147, 20-29.
40
Chen, J.-Y., Pan, C.-Y., and Kuo, C.-M. (2004). Molecular cloning and sequencing of
shrimp (Penaeus monodon) penaeidin-5 cDNA. Fish Shellfish Immunology 16,
665-670.
Chen, X. (2004). A microRNA as a translational repressor of APETALA2 in Arabidopsis
flower development. Science 303, 2022-2025.
Chen, Y.N., Slabaugh, E., and Brandizzi, F. (2008). Membrane-tethered transcription
factors in Arabidopsis thaliana: novel regulators in stress response and
development. Current Opinion in Plant Biology 11, 695-701.
Cherry, J.H., Locy, R.D., and Rychter, A. (2000). In: Cherry et al. editors. Plant
tolerance to abiotic stresses in agriculture: role of genetic engineering.
Netherlands: Kluer Academic publishers. pp. 95-104
Christou, P., and Twyman, R.M. (2004). The potential of genetically enhanced plants
to address food insecurity. Nutrition research reviews 17, 23-42.
Ciais, P., Reichstein, M., Viovy, N., Granier, A., Ogee, J., Allard, V., Aubinet, M.,
Buchmann, N., Bernhofer, C., Carrara, A., Chevallier, F., De Noblet, N.,
Friend, A.D., Friedlingstein, P., Grunwald, T., Heinesch, B., Keronen, P.,
Knohl, A., Krinner, G., Loustau, D., Manca, G., Matteucci, G., Miglietta, F.,
Ourcival, J.M., Papale, D., Pilegaard, K., Rambal, S., Seufert, G., Soussana,
J.F., Sanz, M.J., Schulze, E.D., Vesala, T., and Valentini, R. (2005). Europewide reduction in primary productivity caused by the heat and drought in 2003.
Nature 437, 529-533.
41
Cuperus, J.T., Fahlgren, N., and Carrington, J.C. (2011). Evolution and functional
diversification of MIRNA genes. The Plant Cell Online 23, 431-442.
Cuthbertson, B., Büllesbach, E., and Gross, P. (2006). Discovery of synthetic
penaeidin activity against antibiotic-resistant fungi. Chemistry Biology and Drug
Design 68, 120-127.
Cuthbertson, B., BüLLESBACH, E., Fievet, J., BACHèRE, E., and Gross, P. (2004).
A new class (penaeidin class 4) of antimicrobial peptides from the Atlantic white
shrimp (Litopenaeus setiferus) exhibits target specificity and an independent
proline-rich-domain function. Biochemistry Journal 381, 79-86.
Cuthbertson, B., Yang, Y., Bachère, E., Büllesbach, E., Gross, P., and Aumelas, A.
(2005). Solution structure of synthetic penaeidin-4 with structural and functional
comparisons with penaeidin-3. Journal of Biological Chemistry. 280, 1600916018.
Destoumieux, D., Munoz, M., Bulet, P., and Bachère*, E. (2000a). Penaeidins, a
family of antimicrobial peptides from penaeid shrimp (Crustacea, Decapoda).
Cellular and Molecular Life Sciences. 57, 1260-1271.
Destoumieux, D., Bulet, P., Strub, J., Van Dorsselaer, A., and Bachère, E. (1999).
Recombinant expression and range of activity of penaeidins, antimicrobial
peptides from penaeid shrimp. European Journal of Biochemistry. 266, 335-346.
Destoumieux, D., Muñoz, M., Cosseau, C., Rodriguez, J., Bulet, P., Comps, M., and
Bachère, E. (2000b). Penaeidins, antimicrobial peptides with chitin-binding
42
activity, are produced and stored in shrimp granulocytes and released after
microbial challenge. Jounal of Cell Science 113, 461-469.
Ding, D., Zhang, L., Wang, H., Liu, Z., Zhang, Z., and Zheng, Y. (2009). Differential
expression of miRNAs in response to salt stress in maize roots. Annals of Botany
103, 29-38.
Dong, S., Tredway, L., Shew, H., Wang, G., Sivamani, E., and Qu, R. (2007).
Resistance of transgenic tall fescue to two major fungal diseases. Plant Science
173, 501-509.
Donner, T.J., Sherr, I., and Scarpella, E. (2009). Regulation of preprocambial cell state
acquisition by auxin signaling in Arabidopsis leaves. Development 136, 32353246.
FAO. (2008). FAO Land and Plant Nutrition Management Service. http://www.fao.org/.
Farre, G., Ramessar, K., Twyman, R.M., Capell, T., and Christou, P. (2010). The
humanitarian impact of plant biotechnology: recent breakthroughs vs bottlenecks
for adoption. Current Opinion in Plant Biology 13, 219-225.
Ferreira, S., Pitz, K., Manshardt, R., Zee, F., Fitch, M., and Gonsalves, D. (2002).
Virus coat protein transgenic papaya provides practical control of papaya ringspot
virus in Hawaii. Plant Disease 86, 101-105.
Fujii, H., Chiou, T.-J., Lin, S.-I., Aung, K., and Zhu, J.-K. (2005). A miRNA Involved
in Phosphate-Starvation Response in Arabidopsis. Current Biology 15, 2038-2043.
Gandikota, M., Birkenbihl, R.P., Höhmann, S., Cardon, G.H., Saedler, H., and
Huijser, P. (2007). The miRNA156/157 recognition element in the 3′ UTR of the
43
Arabidopsis SBP box gene SPL3 prevents early flowering by translational
inhibition in seedlings. The Plant Journal 49, 683-693.
Gao, A., Hakimi, S., Mittanck, C., Wu, Y., Woerner, B., Stark, D., Shah, D., Liang,
J., and Rommens, C. (2000). Fungal pathogen protection in potato by expression
of a plant defensin peptide. Nature Biotechnology. 18, 1307-1310.
Gao, P., Bai, X., Yang, L., Lv, D., Pan, X., Li, Y., Cai, H., Ji, W., Chen, Q., and Zhu,
Y. (2011a). Osa-MIR393: a salinity- and alkaline stress-related microRNA gene
Molecular Biology Reports 38, 237-242.
Gao, T., Wu, Y., Zhang, Y., Liu, L., Ning, Y., Wang, D., Tong, H., Chen, S., Chu, C.,
and Xie, Q. (2011b). OsSDIR1 overexpression greatly improves drought
tolerance in transgenic rice. Plant Molecular Biology 76, 145-156.
Godfray, H.C.J., Beddington, J.R., Crute, I.R., Haddad, L., Lawrence, D., Muir,
J.F., Pretty, J., Robinson, S., Thomas, S.M., and Toulmin, C. (2010). Food
security: the challenge of feeding 9 billion people. Science 327, 812-818.
Han, J., Lee, Y., Yeom, K.H., Nam, J.W., Heo, I., Rhee, J.K., Sohn, S.Y., Cho, Y.,
Zhang, B.T., and Kim, V.N. (2006). Molecular basis for the recognition of
primary microRNAs by the Drosha-DGCR8 complex. Cell 125, 887-901.
Hancock, R.E.W., and Sahl, H.G. (2006). Antimicrobial and host-defense peptides as
new anti-infective therapeutic strategies. Nature Biotechnology 24, 1551-1557.
Haydu, J., Hodges, A., and Hall, C. (2006). Economic impacts of the turfgrass and
lawncare industry in the United States. Available: http://edis.ifas.ufl.edu/FE632.
44
Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q., and Xiong, L. (2006).
Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances
drought resistance and salt tolerance in rice. Proceedings of the National
Academy of Sciences 103, 12987-12992.
Hutvágner, G., and Zamore, P.D. (2002). A microRNA in a multiple-turnover RNAi
enzyme complex. Science 297, 2056-2060.
IPCC. (2007). Forth Assessment Report: Synthesis, published online 17 November.
http://www.ipcc.ch/publications_and_data/ar4/syr/en/main.html.
Jayawickreme, D., Santoni, C., Nosetto, M., Kim, J., Ballesteros, S., Jobbagy, E.,
and Jackson, R. (2010). Current agriculture expansions and the risk of dryland
salinization in central Argentina. American Geophysical Union, Fall meeting,
Abstract # H53A- 0989.
Jones-Rhoades, M.W. (2011). Conservation and divergence in plant microRNAs. Plant
Molecular Biology, 1-14.
Jones-Rhoades, M.W., and Bartel, D.P. (2004). Computational identification of plant
microRNAs and their targets, including a stress-induced miRNA. Molecular Cell
14, 787-799.
Jones-Rhoades, M.W., Bartel, D.P., and Bartel, B. (2006). MicroRNAs and their
regulatory roles in plants. Annual Review of Plant Biololgy 57, 19-53.
Kawashima, C.G., Yoshimoto, N., Maruyama‐Nakashita, A., Tsuchiya, Y.N., Saito,
K., Takahashi, H., and Dalmay, T. (2009). Sulphur starvation induces the
45
expression of microRNA‐395 and one of its target genes but in different cell types.
The Plant Journal 57, 313-321.
Keymanesh, K., Soltani, S., and Sardari, S. (2009). Application of antimicrobial
peptides in agriculture and food industry. World Journal of Microbiology and
Biotechnology 25, 933-944.
Kim, J.H., Woo, H.R., Kim, J., Lim, P.O., Lee, I.C., Choi, S.H., Hwang, D., and Nam,
H.G. (2009). Trifurcate feed-forward regulation of age-dependent cell death
involving miR164 in Arabidopsis. Science 323, 1053-1057.
Koyama, T., Furutani, M., Tasaka, M., and Ohme-Takagi, M. (2007). TCP
transcription factors control the morphology of shoot lateral organs via negative
regulation of the expression of boundary-specific genes in Arabidopsis. The Plant
Cell Online 19, 473-484.
Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene
lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843854.
Li, Q., Lawrence, C., Xing, H., Babbitt, R., Bass, W., Maiti, I., and Everett, N.
(2001). Enhanced disease resistance conferred by expression of an antimicrobial
magainin analog in transgenic tobacco. Planta 212, 635-639.
Lim, P.O., Lee, I.C., Kim, J., Kim, H.J., Ryu, J.S., Woo, H.R., and Nam, H.G. (2010).
Auxin response factor 2 (ARF2) plays a major role in regulating auxin-mediated
leaf longevity. Journal of Experimental Botany 61, 1419-1431.
46
Liu, H.H., Tian, X., Li, Y.J., Wu, C.A., and Zheng, C.C. (2008). Microarray-based
analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA 14, 836843.
Lu, C., Tej, S.S., Luo, S., Haudenschild, C.D., Meyers, B.C., and Green, P.J. (2005).
Elucidation of the small RNA component of the transcriptome. Science 309, 1567.
Lu, X.-Y., and Huang, X.-L. (2008). Plant miRNAs and abiotic stress responses.
Biochemical and Biophysical Research Communications 368, 458-462.
Marcum, K.B. (2006). Use of saline and non-potable water in the turfgrass industry:
Constraints and developments. Agricultural Water Management 80, 132-146.
Martin, R.C., Liu, P.P., Goloviznina, N.A., and Nonogaki, H. (2010). microRNA,
seeds, and Darwin?: diverse function of miRNA in seed biology and plant
responses to stress. Journal of Experimental Botany 61, 2229-2234.
Mateos, J.L., Bologna, N.G., and Palatnik, J.F. (2011). Biogenesis of Plant
MicroRNAs. Non Coding RNAs in Plants, 251-268.
Meng, S., Xu, H., and Wang, F. (2010). Research advances of antimicrobial peptides
and applications in food industry and agriculture. Current Protein and Peptide
Science 11, 264-273.
Meyers, B.C., Axtell, M.J., Bartel, B., Bartel, D.P., Baulcombe, D., Bowman, J.L.,
Cao, X., Carrington, J.C., Chen, X., Green, P.J., Griffiths-Jones, S., Jacobsen,
S.E., Mallory, A.C., Martienssen, R.A., Poethig, R.S., Qi, Y., Vaucheret, H.,
Voinnet, O., Watanabe, Y., Weigel, D., and Zhu, J.-K. (2008). Criteria for
Annotation of Plant MicroRNAs. The Plant Cell Online 20, 3186-3190.
47
miRBase. http://www.mirbase.org/.
Mittler, R. (2006). Abiotic stress, the field environment and stress combination. Trends
in Plant Science 11, 15-19.
Mittler, R., and Blumwald, E. (2010). Genetic engineering for modern agriculture:
challenges and perspectives. Annual Review of Plant Biology 61, 443-462.
Montesinos, E. (2007). Antimicrobial peptides and plant disease control. FEMS
Microbiology Letters 270, 1-11.
Muñoz, M., Vandenbulcke, F., Saulnier, D., and Bachère, E. (2002). Expression and
distribution of penaeidin antimicrobial peptides are regulated by haemocyte
reactions in microbial challenged shrimp. European Journal of Biochemistry 269,
2678-2689.
Nag, A., King, S., and Jack, T. (2009). miR319a targeting of TCP4 is critical for petal
growth and development in Arabidopsis. Proceedings of the National Academy of
Sciences 106, 22534-22539.
Nakashima, K., Ito, Y., and Yamaguchi-Shinozaki, K. (2009). Transcriptional
regulatory networks in response to abiotic stresses in Arabidopsis and grasses.
Plant Physiology 149, 88-95.
Nath, U., Crawford, B.C.W., Carpenter, R., and Coen, E. (2003). Genetic control of
surface curvature. Science 299, 1404-1407.
Nelson, D.E., Repetti, P.P., Adams, T.R., Creelman, R.A., Wu, J., Warner, D.C.,
Anstrom, D.C., Bensen, R.J., Castiglioni, P.P., and Donnarummo, M.G.
(2007). Plant nuclear factor Y (NF-Y) B subunits confer drought tolerance and
48
lead to improved corn yields on water-limited acres. Proceedings of the National
Academy of Sciences 104, 16450-16455.
Oh, S.J., Kim, Y.S., Kwon, C.W., Park, H.K., Jeong, J.S., and Kim, J.K. (2009).
Overexpression of the transcription factor AP37 in rice improves grain yield
under drought conditions. Plant Physiology 150, 1368-1379.
Oh, S.J., Song, S.I., Kim, Y.S., Jang, H.J., Kim, S.Y., Kim, M., Kim, Y.K., Nahm,
B.H., and Kim, J.K. (2005). Arabidopsis CBF3/DREB1A and ABF3 in
transgenic rice increased tolerance to abiotic stress without stunting growth. Plant
Physiology 138, 341-351.
Ori, N., Cohen, A.R., Etzioni, A., Brand, A., Yanai, O., Shleizer, S., Menda, N.,
Amsellem, Z., Efroni, I., and Pekker, I. (2007). Regulation of LANCEOLATE
by miR319 is required for compound-leaf development in tomato. Nature
Genetics 39, 787-791.
Osusky, M., Zhou, G., Osuska, L., Hancock, R., Kay, W., and Misra, S. (2000).
Transgenic plants expressing cationic peptide chimeras exhibit broad-spectrum
resistance to phytopathogens. Nature Biotechnology 18, 1162-1166.
Palatnik, J.F., Allen, E., Wu, X., Schommer, C., Schwab, R., Carrington, J.C., and
Weigel, D. (2003). Control of leaf morphogenesis by microRNAs. Nature 425,
257-263.
Palauqui, J.-C., Elmayan, T., Pollien, J.-M., and Vaucheret, H. (1997). Systemic
acquired silencing: transgene-specific post-transcriptional silencing is transmitted
49
by grafting from silenced stocks to non-silenced scions. The EMBO Journal 16,
4738-4745.
Ponti, D., Mangoni, M.L., Mignogna, G., Simmaco, M., and Barra, D. (2003). An
amphibian antimicrobial peptide variant expressed in Nicotiana tabacum confers
resistance to phytopathogens. Biochemical Journal 370, 121-127.
Punja, Z.K. (2001). Genetic engineering of plants to enhance resistance to fungal
pathogens—a review of progress and future prospects. Canadian Journal of Plant
Pathology 23, 216-235.
Qu, R., Luo, H., and Meier, V.D. (2008). Turfgrass. In: Kole, C. and Hall, T.C.,
editors.Compendium of Transgenic Crop Plants: Transgenic Plantation Crops,
Ornamentals and Trufgrasses. Oxford: Blackwell Publishing. pp. 177-218.
Reinhart, B.J., Weinstein, E.G., Rhoades, M.W., Bartel, B., and Bartel, D.P. (2002).
MicroRNAs in plants. Genes & Development 16, 1616-1626.
Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., Bartel, B., and Bartel, D.P.
(2002). Prediction of plant microRNA targets. Cell 110, 513-520.
Rubio-Somoza, I., and Weigel, D. (2011). MicroRNA networks and developmental
plasticity in plants. Trends in plant science 16, 258-264
Rubio-Somoza, I., Cuperus, J.T., Weigel, D., and Carrington, J.C. (2009). Regulation
and functional specialization of small RNA-target nodes during plant
development. Current Opinion in Plant Biology 12, 622-627.
Sade, N., Gebretsadik, M., Seligmann, R., Schwartz, A., Wallach, R., and Moshelion,
M. (2010). The role of tobacco Aquaporin1 in improving water use efficiency,
50
hydraulic conductivity, and yield production under salt stress. Plant Physiology
152, 245-254.
Schaefer, S.C., Gasic, K., Cammue, B., Broekaert, W., van Damme, E.J.M.,
Peumans, W.J., and Korban, S.S. (2005). Enhanced resistance to early blight in
transgenic tomato lines expressing heterologous plant defense genes. Planta 222,
858-866.
Schommer, C., Palatnik, J.F., Aggarwal, P., Chételat, A., Cubas, P., Farmer, E.E.,
Nath, U., and Weigel, D. (2008). Control of jasmonate biosynthesis and
senescence by miR319 targets. PLoS Biology 6, e230.
Sharma, A., Sharma, R., Imamura, M., Yamakawa, M., and Machii, H. (2000).
Transgenic expression of cecropin B, an antibacterial peptide from Bombyx mori,
confers enhanced resistance to bacterial leaf blight in rice. FEBS Letters. 484, 711.
Slack, F.J., Basson, M., Liu, Z., Ambros, V., Horvitz, H.R., and Ruvkun, G. (2000).
The lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the
let-7 regulatory RNA and the LIN-29 transcription factor. Molecular cell 5, 659669.
Song, J.J., Smith, S.K., Hannon, G.J., and Joshua-Tor, L. (2004). Crystal structure of
Argonaute and its implications for RISC slicer activity. Science 305, 1434.
Sunkar, R. (2010). MicroRNAs with macro-effects on plant stress responses. Seminars
in Cell & Developmental Biology 21: 805-811.
51
Sunkar, R., and Zhu, J.K. (2004). Novel and stress-regulated microRNAs and other
small RNAs from Arabidopsis. The Plant Cell Online 16, 2001-2019.
Sunkar, R., Kapoor, A., and Zhu, J.K. (2006). Posttranscriptional induction of two
Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation
of miR398 and important for oxidative stress tolerance. The Plant Cell Online 18,
2051-2065.
Tester, M., and Langridge, P. (2010). Breeding Technologies to Increase Crop
Production in a Changing World. Science 327, 818-822.
Thiebaut, F., Rojas, C.A., Almeida, K.L., Grativol, C., Domiciano, G.C., Lamb,
C.R.C., De Almeida Engler, J., Hemerly, A.S., and Ferreira, P.C.G. (2011).
Regulation of miR319 during cold stress in sugarcane. Plant, Cell & Environment
35, 502-512.
Todesco, M., Rubio-Somoza, I., Paz-Ares, J., and Weigel, D. (2010). A Collection of
Target Mimics for Comprehensive Analysis of MicroRNA Function in
Arabidopsis thaliana. PLoS Genet 6, e1001031.
Tricoli, D.M., Carney, K.J., Russell, P.F., McMaster, J.R., Groff, D.W., Hadden,
K.C., Himmel, P.T., Hubbard, J.P., Boeshore, M.L., and Quemada, H.D.
(1995). Field evaluation of transgenic squash containing single or multiple virus
coat protein gene constructs for resistance to cucumber mosaic virus, watermelon
mosaic virus 2, and zucchini yellow mosaic virus. Biotechnology 13, 1458-1465.
Vanderauwera, S., De Block, M., Van de Steene, N., Van De Cotte, B., Metzlaff, M.,
and Van Breusegem, F. (2007). Silencing of poly (ADP-ribose) polymerase in
52
plants alters abiotic stress signal transduction. Proceedings of the National
Academy of Sciences 104, 15150-15155.
Varshney, R.K., Bansal, K.C., Aggarwal, P.K., Datta, S.K., and Craufurd, P.Q.
(2011). Agricultural biotechnology for crop improvement in a variable climate:
hope or hype? Trends in plant science 16, 363-371.
Vizioli, J., and Salzet, M. (2002). Antimicrobial peptides from animals: focus on
invertebrates. Trends in Pharmacological Sciences 23, 494-496.
Voinnet, O. (2009). Origin, biogenesis, and activity of plant microRNAs. Cell 136, 669687.
Wang, T., Chen, L., Zhao, M., Tian, Q., and Zhang, W.H. (2011). Identification of
drought-responsive microRNAs in Medicago truncatula by genome-wide highthroughput sequencing. BMC genomics 12, 367.
Wang, Y., Ying, J., Kuzma, M., Chalifoux, M., Sample, A., McArthur, C., Uchacz,
T., Sarvas, C., Wan, J., and Dennis, D.T. (2005). Molecular tailoring of
farnesylation for plant drought tolerance and yield protection. The Plant Journal
43, 413-424.
Wang, Y., Beaith, M., Chalifoux, M., Ying, J., Uchacz, T., Sarvas, C., Griffiths, R.,
Kuzma, M., Wan, J., and Huang, Y. (2009). Shoot-specific down-regulation of
protein farnesyltransferase (α-subunit) for yield protection against drought in
canola. Molecular Plant 2, 191-200.
53
Wei, L., Zhang, D., Xiang, F., and Zhang, Z. (2009). Differentially Expressed miRNAs
Potentially Involved in the Regulation of Defense Mechanism to Drought Stress
in Maize Seedlings. International Journal of Plant Sciences 170, 979-989.
Werner, S., Wollmann, H., Schneeberger, K., and Weigel, D. (2010). Structure
determinants for accurate processing of miR172a in Arabidopsis thaliana. Current
Biology 20, 42-48.
Xiao, B.-Z., Chen, X., Xiang, C.-B., Tang, N., Zhang, Q.-F., and Xiong, L.-Z. (2009).
Evaluation of Seven Function-Known Candidate Genes for their Effects on
Improving Drought Resistance of Transgenic Rice under Field Conditions.
Molecular Plant 2, 73-83.
Xuemei, C. (2005). microRNA biogenesis and function in plants. FEBS letters 579,
5923-5931.
Yamaguchi, T., and Blumwald, E. (2005). Developing salt-tolerant crop plants:
challenges and opportunities. Trends in plant science 10, 615-620.
Yang, L., Tang, R., Zhu, J., Liu, H., Mueller-Roeber, B., Xia, H., and Zhang, H.
(2008). Enhancement of stress tolerance in transgenic tobacco plants
constitutively expressing AtIpk2 , an inositol polyphosphate 6-/3-kinase from
Arabidopsis thaliana. Plant Molecular Biology. 66, 329-343.
Yang, S., Vanderbeld, B., Wan, J., and Huang, Y. (2010). Narrowing down the targets:
Towards successful genetic engineering of drought-tolerant crops. Molecular
Plant 3, 469-490.
54
Yang, Y., Poncet, J., Garnier, J., Zatylny, C., Bachère, E., and Aumelas, A. (2003).
Solution structure of the recombinant penaeidin-3, a shrimp antimicrobial peptide.
Journal of Biological Chemistry. 278, 36859.
Yount, N., and Yeaman, M. (2005). Immunocontinuum: perspectives in antimicrobial
peptide mechanisms of action and resistance. Protein & Peptide Letters. 12, 49-67.
Zakharchenko, N., Rukavtsova, E., Gudkov, A., and Buryanov, Y.I. (2005).
Enhanced resistance to phytopathogenic bacteria in transgenic tobacco plants with
synthetic gene of antimicrobial peptide cecropin P1. Russian Journal of Genetics
41, 1187-1193.
Zasloff, M. (2002). Antimicrobial peptides of multicellular organisms. Nature 415, 389395.
Zhang, X., Zou, Z., Gong, P., Zhang, J., Ziaf, K., Li, H., Xiao, F., and Ye, Z. (2011).
Over-expression of microRNA169 confers enhanced drought tolerance to tomato.
Biotechnology Letters 33, 403-409.
Zhao, B., Ge, L., Liang, R., Li, W., Ruan, K., Lin, H., and Jin, Y. (2009). Members of
miR-169 family are induced by high salinity and transiently inhibit the NF-YA
transcription factor. BMC Molecular Biology 10, 29.
Zhao, B., Liang, R., Ge, L., Li, W., Xiao, H., Lin, H., Ruan, K., and Jin, Y. (2007).
Identification of drought-induced microRNAs in rice. Biochemical and
Biophysical Research Communications 354, 585-590.
55
Zhou, L., Liu, Y., Liu, Z., Kong, D., Duan, M., and Luo, L. (2010a). Genome-wide
identification and analysis of drought-responsive microRNAs in Oryza sativa.
Journal of Experimental Botany 61, 4157-4168.
Zhou, M., Hu, Q., Li, Z., Li, D., Chen, C.F., and Luo, H. (2011). Expression of a
Novel Antimicrobial Peptide Penaeidin4-1 in Creeping Bentgrass (Agrostis
stolonifera L.) Enhances Plant Fungal Disease Resistance. PloS One 6, e24677.
Zhou, M., Gu, L., Li, P., Song, X., Wei, L., Chen, Z., and Cao, X. (2010b).
Degradome sequencing reveals endogenous small RNA targets in rice (Oryza
sativa L. ssp. indica). Frontiers in Biology 5, 67-90.
Zhu, C., Ding, Y., and Liu, H. (2011). MiR398 and plant stress responses. Physiologia
Plantarum 143, 1-9.
56
CHAPTER 2 - EXPRESSION OF A NOVEL
ANTIMICROBIAL PEPTIDE PENAEIDIN4-1 IN
CREEPING BENTGRASS (AGROSTIS
STOLONIFERA L.) ENHANCES PLANT FUNGAL
DISEASE RESISTANCE
Man Zhou1, Qian Hu1, Zhigang Li1, Dayong Li1, Chin-Fu Chen1,2, Hong Luo1*
Department of Genetics and Biochemistry, Clemson University, 100 Jordan Hall,
Clemson, SC 29634, USA
2
Current address: Center for Molecular Studies, Greenwood Genetic Center, Greenwood,
SC 29646, USA
*For correspondence (fax 864 656 0393; phone 864 656 1746; e-mail [email protected])
Published : PLoS ONE 6(9): e24677
1
Keywords: antimicrobial peptide, Penaedin4-1, perennial turfgrass, plant disease
resistance, Rhizoctonia solani, Sclerotinia homoecarpa.
Abstract
Background: Turfgrass species are agriculturally and economically important perennial
crops. Turfgrass species are highly susceptible to a wide range of fungal pathogens.
Dollar spot and brown patch, two important diseases caused by fungal pathogens
Sclerotinia homoecarpa and Rhizoctonia solani, respectively, are among the most severe
turfgrass diseases. Currently, turf fungal disease control mainly relies on fungicide
treatments, which raises many concerns for human health and environment.
Antimicrobial peptides found in various organisms play an important role in innate
immune response.
Methodology/Principal Findings: The antimicrobial peptide - Penaeidin4-1 (Pen4-1)
57
from the shrimp Litopenaeus setiferus has been reported to possess in vitro antifungal and
antibacterial activities against various economically important fungal and bacterial
pathogens. In this study, we have studied the feasibility of using this novel peptide for
engineering enhanced disease resistance into creeping bentgrass plants (Agrostis
stolonifera L., cv. Penn A-4). Two DNA constructs were prepared containing either the
coding sequence of a single peptide, Pen4-1 or the DNA sequence coding for the transit
signal peptide of the secreted tobacco AP24 protein translationally fused to Pen4-1
coding sequence. A maize ubiquitin promoter was used in both constructs to drive gene
expression. Transgenic turfgrass plants containing different DNA constructs were
generated by Agrobacterium-mediated transformation and analyzed for transgene
insertion and expression. In replicated in vitro and in vivo experiments under controlled
environments, transgenic plants exhibited significantly enhanced resistance to dollar spot
and brown patch, the two major fungal diseases in turfgrass. The targeting of Pen4-1 to
endoplasmic reticulum by the transit peptide of AP24 protein did not significantly impact
disease resistance in transgenic plants.
Conclusion/Significance: Our results demonstrate the effectiveness of Pen4-1 in a
perennial species against fungal pathogens and may suggest a potential strategy for
engineering broad-spectrum fungal disease resistance in crop species.
58
Introduction
Turfgrasses, agriculturally and economically important crop species, are used
worldwide for lawns of buildings, roadsides, athletic and recreational fields providing
numerous benefits including reducing soil erosion, trapping dust and pollutants,
moderating temperature, safer playing grounds and beautifying the environment (The
National Turfgrass Research Initiative, 2003; Haydu et al., 2006). There are more than 50
million acres of turfgrass and 16,000 golf courses in the US alone, and the turfgrass
industry is a business with multibillion dollars annually (2003; Haydu et al., 2006).
Turfgrass species are highly susceptible to a wide spectrum of fungal pathogens. Dollar
spot and brown patch, two important diseases caused by fungal pathogens Sclerotinia
homoecarpa and Rhizoctonia solani respectively, are two of the most severe and common
diseases on turfgrass lawns (Chai et al., 2002; Guo et al., 2003). Currently, fungicides are
commonly applied to control fungal diseases. This raises concerns about the potential
emergence of new pathogen strains as a result of intensive use of chemicals (Damicone
and Smith, 2009; Keymanesh et al., 2009; Young and Patton, 2010). Resistance to some
major classes of fungicides such as benzimidazoles, demethylation inhibitors (DMIs), Qo
respiration inhibitors (QoIs) and dicarboximides (DCFs) has been detected in many
phytopathogenic fungi species (Ma and Michailides, 2005). For example, large scale
agricultural use of DMIs since 1970s has led to the emergence of resistant genotypes of
several phytopathogenic fungi impacting different crop and fruit species including
turfgrass (Brent and Federation, 1995; Schnabel and Jones, 2001; Ma and Michailides,
59
2005; Young and Patton, 2010). Similarly, benzimidazole-resistant genotypes were also
identified
in
Monilinia
fruccticola,
Penicillium
expansum,
Botrytis
cinerea,
Helminthosporium solani and sclerotinia homoeocarpa. (Luck and Gillings, 1995; Mkay
and Cooke, 1997; Bartlett et al., 2002; Ma et al., 2003; Ma and Michailides, 2005; Young
and Patton, 2010). Therefore, the problem of emergent new resistant pathogen strains and
the negative long-term impacts of fungicides on human health and the environment have
both driven the search for new alternatives for the currently used chemicals (Rekha et al.,
2006; Keymanesh et al., 2009). It is desirable that new cultivars be developed that present
sustainable resistance to a broad range of pathogens and are safe for the environment or
human consumption (Zasloff, 2002; Keymanesh et al., 2009).
Antimicrobial peptides (AMPs) found in various organisms play an important role
in innate immune response (Boman, 1995; Rao, 1995; Broekaert et al., 1997; Hancock
and Chapple, 1999; Zasloff, 2002), providing good candidates for use in plants for
enhanced disease resistance. AMPs are short sequence peptides with generally fewer than
50 amino acid residues, most of which have antimicrobial activity against a broad
spectrum of pathogens. They are a first line of defense in plants and animals and
resistance against them is much less observed compared with current antibiotics (Zasloff,
2002). AMPs from various sources have been demonstrated to confer resistance against
fungal and bacterial pathogens in an array of genetically engineered plant species,
including Arabidopsis (Lee et al., 2008), tobacco (Jaynes et al., 1993; Florack et al., 1995;
Terras et al., 1995; Huang et al., 1997; DeGray et al., 2001; Li et al., 2001; Chakrabarti et
al., 2003; Yevtushenko et al., 2005; Yevtushenko and Misra, 2007; Yang et al., 2008), rice
60
(Sharma et al., 2000b; Coca et al., 2004; Coca et al., 2006; Patkar and Chattoo, 2006;
Imamura et al., 2010; Jha and Chattoo, 2010), potato (Allefs et al., 1995; Arce et al., 1999;
Gao et al., 2000; Osusky et al., 2000; Osusky et al., 2004; Yi et al., 2004; Osusky et al.,
2005), tomato (Alan et al., 2004), cotton (Rajasekaran et al., 2005), pear (Reynoird et al.,
1999), banana (Chakrabarti et al., 2003), ornamental crops, geranium (Pelargonium sp.)
(Bi et al., 1999), American elm (Newhouse et al., 2007) and hybrid poplar (Liang et al.,
2002; Mentag et al., 2003).
Penaeidins, a family of AMPs originally isolated from the haemocytes of penaeid
shrimp, is considered to be a source of compounds, which have the potential to be applied
in agriculture to deliver disease resistance to plants. Unlike vertebrates possessing the
adaptive immune system, shrimp only have an innate immune system, among which are
penaeidin antimicrobial peptides (Cuthbertson et al., 2004; Cuthbertson et al., 2006).
Upon pathogen challenge to the host, the peptides are released from granular haemocytes
to the plasma and attached to cuticles fighting microbial infection (Destoumieux et al.,
2000a; Destoumieux et al., 2000b; Muñoz et al., 2002; Cuthbertson et al., 2004).
Penaeidins have a unique two-domain structure including an unconstrained proline-rich
N-terminal domain (PRD) and a cysteine-rich domain (CRD) with a stable α-helical
structure (Yang et al., 2003; Cuthbertson et al., 2004; Cuthbertson et al., 2005). The
complexity inherent in this unique structure might have contributed to its broad range of
microbial targets, including primarily Gram positive bacteria and fungi (Destoumieux et
al., 1999; Destoumieux et al., 2000a; Yang et al., 2003; Cuthbertson et al., 2004).
The penaeidin family is divided into four classes, designated as 2, 3, 4 and 5.
61
Each class displays a remarkable level of primary sequence diversity (Chen et al., 2004;
Cuthbertson et al., 2006). Pen4-1, an isoform within the class number 4 penaeidins
(isoform number 1) is isolated from Atlantic white shrimp (Litopenaeus setiferus). It
contains 6 cysteine residues forming 3 disulfide bridges and is the shortest isoform in
penaeidin family with a length of 47 amino acids. It can inhibit multiple plant pathogenic
fungal species, including the B. cinera, P. crustosum and F. oxysporum (Cuthbertson et al.,
2004). It is also effective against Gram-positive bacteria species including M. luteus and
A. viriduans, and inhibitory against Gram-negative bacteria, E. coli, at relatively high
concentrations (Cuthbertson et al., 2006). Notably, Pen4-1 can inhibit the growth of
multidrug-resistant fungi species: Cryptococcus neoforman (Steroform A, Steroform B,
Steroform C, Steroform D) and Candida spp. (Candida lipolytica, Candida inconspicua,
Candida krusei, Candida lusitaniae and Candida glabrata) (Cuthbertson et al., 2006).
Compared to other classes of penaeidins, penaeidin class 4 has shown a high level of
potency against fungi (Cuthbertson et al., 2006). Additionally, the unusual amino acid
composition of Pen4-1, especially in the proline-rich domain, may confer resistance to
proteases (Cuthbertson et al., 2006). These results suggest that Pen4-1 is a good candidate
for genetic engineering of enhanced disease resistance in plants. The present study
investigates the feasibility of using the plant-optimized nucleotide sequences encoding
Pen4-1 from L. setiferus for engineering fungal pathogen resistance into perennial
turfgrass plants. We report the development of transgenic lines of a commercial creeping
bentgrass (Agrostis stolonifera L.) cultivar, cv. Penn A-4 with enhanced resistance to two
important fungal pathogens, Sclerotinia homoecarpa and Rhizoctonia solani as a result of
62
expression of a synthetic peptide gene, Pen4-1.
Results
Production and molecular characterization of transgenic creeping bentgrass
plants harboring the Pen4-1 gene
To generate transgenic plants expressing Pen4-1 and study the role Pen4-1 plays
in plant disease resistance, two chimeric DNA constructs were prepared containing either
the coding sequence of a single peptide Pen4-1 (Figure 2.1a) or the DNA sequence
coding for the transit signal peptide of the secreted tobacco AP24 protein translationally
fused to Pen4-1 coding sequence (Figure 2.1b). A corn ubiquitin (ubi) promoter was used
in both constructs to drive Pen4-1 expression and an herbicide resistance conferring gene
named bar driven by the CaMV 35S promoter was included as a selectable marker for
plant transformation. The original nucleotide sequences of Pen4-1 were modified for
plant-optimized codon usage, and chemically synthesized for use in chimeric gene
construction (Figure 2.2).
63
Figure 2.1 Generation and molecular analysis of the transgenic lines expressing Pen4-1.
(a) Schematic diagram of the Pen4-1 expression chimeric gene construct, p35S-bar/UbiPen4-1. Pen4-1 gene is under the control of the maize ubiquitin promoter (Ubi) and
linked to the herbicide resistance gene, bar, driven by the CaMV 35S promoter. (b)
Schematic diagram of the AP24::Pen4-1 expression chimeric gene construct, p35Sbar/Ubi-AP24::Pen4-1, in which the AP24::Pen4-1 fusion gene is under the control of
the maize Ubi promoter. The CaMV35S promoter-driven bar gene is included for
herbicide resistance. (c) Example of Southern blot analysis of Pen4-1 expression
transgenics. Twenty micrograms of BamHI-digested genomic DNA was probed by a 440
bp 32P-labelled bar gene fragment. Hybridization bands were indications of copy
numbers of transgene insertion. Lanes 1-6 were DNAs from representative transgenic
creeping bentgrass plants. WT (wild-type) was DNA from non-transformed creeping
bentgrass plants. (d) Example of Northern blot analysis of Pen4-1 expression transgenics.
64
Lanes 1-6 were total RNA from representative transgenic creeping bentgrass plants.
Twenty micrograms of the total RNA extracted from young leaves were probed with a
32
P-labelled Pen4-1 gene fragment. WT (wild-type) was total RNA from non-transformed
creeping bentgrass plants.
Figure 2.2 Nucleotide and deduced amino acid sequences of the Pen4-1 gene. The
original nucleotide sequences of Pen4-1 were modified for plant-optimized codon usage.
The predicted single-letter amino acids are shown above the coding sequence. The added
translation stop codon is also indicated.
Using Agrobacterium-mediated transformation of embryogenic callus derived
from mature seeds and phosphinothricin selection, we separately introduced the two
chimeric gene constructs (Figure 2.1a, 2.1b) into a creeping bentgrass (A. stolonifera L.)
cultivar, Penn A-4, producing a total of 25 independent T0 transgenic lines transformed
with the construct, p35S-bar/Ubi-Pen4-1, and 5 with the construct, p35S-bar/UbiAP24::Pen4-1. PCR amplification of foreign genes using genomic DNA from transgenic
plants confirmed the presence of transgenes (data not shown). Southern hybridization
with a bar-specific probe revealed that all the transgenic events contained one or two
copies of transgene integration, most of which carried single copy insertions (see
65
example in Figure 2.1c). No significant difference in general plant morphology, root and
shoot development as well as overall plant biomass was observed between transgenic and
control plants without Pen4-1 gene.
Pen4-1 expression in transgenic plants of creeping bentgrass
Transgenic plants were further analyzed for Pen4-1 expression by Northern blot
analysis. Hybridization of RNA samples from leaves revealed detectable Pen4-1
transcript, indicating transgene expression in all the transgenic plants (see examples in
Figure 2d). Moreover, all transgenic lines, regardless of Pen4-1 alone or AP24::Pen4-1
fusion gene being expressed in plants, did not appear to show significant differences from
each other for Pen4-1 mRNA accumulation (data not shown). Our efforts in detecting
Pen4-1 protein in plant extracts from turfgrass transgenic lines using a polyclonal
antibody raised against the selected region of Pen4-1 protein was unsuccessful (data not
shown). This difficulty in detecting Pen4-1 protein in turfgrass plants was also
encountered when analyzing Pen4-1 production in Arabidopsis transgenic lines
expressing the Pen4-1 gene (data not shown). Many attempts in improving protein
extraction and immunoblotting using currently available methodology and published
procedures did not result in satisfactory results. This difficulty in Western assay with
Pen4-1 may result from poor retention of the protein by blotting membranes due to its
small size and a highly positive charge. Protease degradation of Pen4-1 during protein
extraction could be another possibility, but is unlikely given the unusual amino acid
composition of PRD Pen4-1 conferring resistance to proteases (Cuthbertson et al., 2006).
66
The same problem had been reported previously for other plant-expressed small AMPs
(Li et al., 2001; Coca et al., 2004; Osusky et al., 2005; Rajasekaran et al., 2005).
Four representative transgenic lines harboring p35S-bar/Ubi-Pen4-1 and 5
containing the construct, p35S-bar/Ubi-AP24::Pen4-1 were used in the subsequent
pathogen test experiments, all of which contained a single copy integration of the
transgene. These transgenic lines were clonally multiplied by vegetative propagation.
Evaluation of these plants under greenhouse conditions showed that they performed very
similarly in growth. Three groups of control plants were used for comparison with the
Pen4-1-expressing transgenic lines in our pathogen test experiments. They were
untransformed plants either derived from seeds or regenerated from tissue culture and
transgenic lines harboring the same expression vector without the Pen4-1, but with a
different foreign gene, which was not associated with plant response to pathogen attack.
All control plants, regardless of their origins, did not show significant differences in
morphology and growth as well as response to pathogen infection.
In planta antifungal assays with R. solani
R. solani is a soil-borne fungus that causes brown patch disease, one of the most
severe diseases on turfgrass lawns. To examine the impact of Pen4-1 on plant response to
infection with R. solani, we conducted experiments investigating plant disease resistance
by both in vitro and in vivo assays using detached leaves and whole plants, respectively.
The detached leaves from T0 transgenic lines expressing Pen4-1 and the control
plants were placed on 1% of agar in Petri dishes, and challenged by the pathogen using
67
agar plugs infested with mycelium of R. solani isolate obtained from infected creeping
bentgrass plants. Disease symptoms measured as lesion size were documented at various
times after inoculation. Compared to control plants, transgenic lines harboring either
p35S-bar/Ubi-Pen4-1 or p35S-bar/Ubi-AP24::Pen4-1 exhibited dramatically enhanced
disease resistance with a reduction in lesion length by 42% to 48% fourteen days after
inoculation (Figure 2.3a, b). Statistical analysis of Tukey’s Hornesly Significant
Difference (Tukey’s HSD) indicated that the lesion size reduction in Pen4-1-expressing
transgenic plants was significant (P<0.01); whereas, no significant difference in lesion
size was observed among Pen4-1-expressing transgenic lines (P>0.05) (Figure 2.3b).
Figure 2.3 Response of transgenic creeping bentgrass plants expressing Pen4-1 to R.
solani infection - in vitro plant leaf inoculation assay. (a) The detached second expanded
leaves from the top of plant stolons were used for pathogen inoculation test. The image
shows example of representative leaves from all tested Pen4-1-expressing transgenic
plants with a single transgene insertion (TG, on the right) and wild-type control plants
(WT, on the left) 14 days post-inoculation (DPI). Transgenic plants exhibited significant
resistance to R. solani in comparison to wild-type controls. (b) The development of
brown patch disease was rated by measuring the lesion length of the infected leaves 2, 8
and 14 DPI. Statistical analysis of R. solani inoculation test was conducted on wild-type
68
control plants (WT) and various transgenic lines harboring either p35S-bar/Ubi-Pen4-1
(TG1 and TG2) or p35S-bar/Ubi-AP24::Pen4-1 (TG3 and TG4). Data are presented as
means ±SE (n=10), and error bars represent standard errors. Asterisks (** or *) indicate
a significant difference between Pen4-1-expressing transgenic and control plants at P
< 0.01 or P < 0.05 by Tukey’s HSD test using JMP 9.0.0.
Plant performance in response to R. solani infection was further evaluated by in
vivo essays using the whole plants grown in pots. Control plants without Pen4-1 and
transgenic lines harboring either p35S-bar/Ubi-Pen4-1 or p35S-bar/Ubi-AP24::Pen4-1
were both challenged by the pathogen in replicated experiments under a controlled
environment. Plants in each pot were inoculated with 3 grams of rye seeds colonized by R.
solani. Pen4-1-expressing transgenic lines all exhibited high resistance against pathogen
infection with a reduced lesion diameter by 30% - 43% compared to control plants 14
days after inoculation (Figure 2.4a, b and c). Statistical analysis of Wilcoxon test
indicated that the disease symptoms among the different Pen4-1-expressing transgenic
lines were not significant (P>0.05) (Figure 2.4c), whereas a significant difference in
disease development between control and Pen4-1-expressing transgenic plants was
observed (P<0.01) (Figure 2.4c).
69
Figure 2.4 Response of transgenic creeping bentgrass plants expressing Pen 4-1 to R.
solani infection - in vivo direct plant inoculation bioassays with lower dose of R. solani.
(a) The fully developed transgenic (independent events TG1 to TG4) and wild-type (WT)
plants clonally propagated from individual tillers were grown and maintained in pots (15
cm x 10.5 cm) and inoculated with 3 g of rye seeds colonized by R. solani. The image on
the upper panel shows plants before pathogen infection. Example of plants from wildtype (WT) and representative transgenic lines harboring either p35S-bar/Ubi-Pen4-1
(TG1, TG2) or p35S-bar/Ubi-AP24::Pen4-1 (TG3 and TG4) two weeks after pathogen
inoculation (14 DPI) are shown on the bottom panel. Transgenic plants exhibited less
sever disease symptom than wild-type controls. (b) A closer look of infected plants
showing the different lesion size of WT and TG. (c) The development of brown patch
disease was rated by measuring the lesion diameters of the infected leaves 14 DPI.
Statistical analysis of R. solani inoculation test was conducted on WT and various TG
lines. Data are presented as means ± SE (n=6), and error bars represent standard errors.
Asterisks (** or *) indicate a significant difference between transgenic plants and
wild-type controls at P < 0.01 or P < 0.05 by Wilcoxon test using JMP 9.0.0.
When exposed to a second dose of pathogen infection, i.e. plants in each pot were
inoculated with additional 3 grams of rye seeds colonized by R. solani 14 days after the
first inoculation, the control plants suffered severe damage with 75% to 95% of them in
70
the pots being affected two weeks after inoculation, whereas Pen4-1-expressing
transgenic lines were much less impacted with only around 25% of plants in the pots
being infected (Figure 2.5a, b). The disease ratings of the Pen4-1-expressing transgenic
lines were reduced by 41% to 44% compared to that of the control plants (Figure 2.5c).
Statistical analysis of Wilcoxon test indicated that the disease development among the
different Pen4-1-expressing transgenic lines was not significant (P>0.05) (Figure 2.5c).
Figure 2.5 Response of transgenic creeping bentgrass plants expressing Pen 4-1 to R.
solani infection - in vivo direct plant inoculation bioassays with higher dose of R. solani.
(a) Transgenic (TG) and wild-type (WT) plants were inoculated with a second dose of R.
solani (3g of rye seeds colonized by the pathogen) 14 days after the first inoculation with
3 g of rye seeds colonized by R. solani. The image shows example of plants from wildtype (WT) and representative transgenic lines harboring either p35S-bar/Ubi-Pen4-1
(TG1) or p35S-bar/Ubi-AP24::Pen4-1 (TG3 and TG4) two weeks after the second
pathogen inoculation. Transgenic plants exhibited much less sever disease symptom than
wild-type controls. (b) A closer look of infected plants showing the different lesion size
of WT and TG. (c) The development of brown patch disease was rated by visual
estimation of the lesion percentage of the infected leaves 14 DPI using the Horsfall
/Barrett scale. Statistical analysis of R. solani inoculation test was conducted on WT and
various TG lines. Data are presented as means ± SE (n=6), and error bars represent
standard errors. Asterisks (** or *) indicate a significant difference between
71
transgenic plants and wild-type controls at P < 0.01 or P < 0.05 by Wilcoxon test JMP
9.0.0.
In planta antifungal assays with S. homoeocarpa
Transgenic plants expressing Pen4-1 were also evaluated for their resistance to
dollar spot, another important turfgrass disease caused by S. homoeocarpa (Couch, 1995;
Walsh et al., 1999). Both in vitro and in vivo assays were conducted to examine the
impact of Pen4-1 on plant response to infection with S. homoeocarpa.
In vitro assays were conducted using leaves from T0 Pen4-1-expressing transgenic
lines and control plants. The detached leaves were placed on 1% of agar in Petri dishes,
and challenged by the pathogen using S. homoeocarpa-infested agar plugs. Disease
symptoms measured as lesion size were documented at various times after inoculation.
Compared to control plants, transgenic lines harboring either p35S-bar/Ubi-Pen4-1 or
p35S-bar/Ubi-AP24::Pen4-1 all exhibited dramatically enhanced disease resistance with
a reduction in lesion length by 40% to 47% seven days after inoculation (Figure 2.6a, b).
Statistical analysis of Tukey’s HSD indicated that the lesion size reduction in Pen4-1expressing transgenic lines was significant (P<0.05), whereas no significant difference in
lesion size was observed among Pen 4-1-expressing transgenic lines (P>0.05) (Figure
2.6b).
72
Figure 2.6 Response of transgenic creeping bentgrass plants expressing Pen 4-1 to S.
homoeocarpa infection - in vitro plant leaf inoculation assay. (a) The detached second
expanded leaves from the top of plant stolons were used for pathogen inoculation test.
The image shows example of representative leaves from all tested Pen 4-1-expressing
transgenic plants with a single transgene insertion (TG, on the right) and wild-type
control plants (WT, on the left) 7 days post-inoculation (DPI). Transgenic plants
exhibited significant resistance to S. homoeocarpa in comparison to wild-type controls.
(b) The development of dollar spot disease was rated by measuring the lesion length of
the infected leaves 2, 4 and 7 DPI. Significant resistance to S. homoeocarpa by transgenic
plants was observed 7 DPI when compared to wild-type controls. Statistical analysis of S.
homoeocarpa inoculation test was conducted on wild-type control plants (WT) and
various transgenic lines harboring either p35S-bar/Ubi-Pen4-1 (TG1 and TG2) or p35Sbar/Ubi-AP24::Pen4-1 (TG3 and TG4). Data are presented as means ± SE (n=10), and
error bars represent standard error. Asterisks (** or *) indicate a significant difference
between transgenic plants and wild-type controls at P < 0.01 or P < 0.05 by Tukey’s
HSD test using JMP 9.0.0.
Plant performance in response to S. homoeocarpa infection was further evaluated
by in vivo assays using the whole plants grown in big pots. Control plants and transgenics
harboring either p35S-bar/Ubi-Pen4-1 or p35S-bar/Ubi-AP24::Pen4-1 were both
challenged by the pathogen in replicated experiments under a controlled environment.
Pen4-1-expressing transgenic lines all exhibited high resistance against pathogen
infection with disease ratings reduced more than 50% compared to various control plants
9 days after inoculation (Figure 2.7a, b). Statistical analysis of the Wilcoxon test
73
indicated that disease development in all the Pen4-1-expressing transgenic lines was
significantly delayed (Figure 2.7b) and in the recovery phase, transgenic lines performed
much better than control plants (P<0.05). However, no significant difference in disease
resistance among Pen4-1-expressing transgenic lines was observed (P>0.05) (Figure
2.7b).
74
Figure 2.7 Response of transgenic creeping bentgrass plants expressing Pen 4-1 to S.
homoeocarpa infection - in vivo direct plant inoculation bioassays with higher dose of S.
homoeocarpa. (a) The fully developed transgenic (TG) and wild-type (WT) plants
clonally propagated from individual stolons were grown and maintained in pots (15 cm x
10.5 cm) and inoculated with 0.5 g of rye seeds colonized by S. homoeocarpa. The image
shows example of plants from wild-type (WT) and representative transgenic lines
harboring either p35S-bar/Ubi-Pen4-1 (TG1) or p35S-bar/Ubi-AP24::Pen4-1 (TG3) 9
days after pathogen inoculation (9 DPI). The plants in the front row are uninfected
75
controls. Transgenic plants exhibited significant disease resistance compared to wild-type
controls. (b) The development of dollar spot disease was rated by visual estimation of the
lesion percentage of the infected leaves 3, 5, 7, 9 DPI, and 21 days post-recovery (DPR)
using the Horsfall /Barrett scale. Statistical analysis of S. homoeocarpa inoculation test
was conducted on WT and various TG lines. Data are presented as means ± SE (n=6), and
error bars represent standard error. Asterisks (** or *) indicate a significant difference
between transgenic plants and wild-type controls at P < 0.01 or P < 0.05 by Wilcoxon
test using JMP 9.0.0.
Discussion
The results reported herein show that Pen4-1, one of the penaeidin proteins
isolated from Atlantic white shrimp (Litopenaeus setiferus), when expressed in transgenic
perennial grass plants, confers antifungal traits. Transgenic creeping bentgrass plants
expressing Pen4-1 exhibited significantly enhanced resistance to dollar spot and brown
patch, the two major fungal diseases in turfgrass caused by S. homoecarpa and R. solani
respectively. To our knowledge, this is the first report of genetically engineering an
economically and environmentally important perennial grass species with a gene
encoding an AMP from the class four isoform of the shrimp penaeidin family for
enhanced resistance against two fungal pathogens. There was only one recent study
reporting the use of penaeidin protein for plant disease resistance (Wei et al., 2011). In
that study, Np3 and Np5, the two AMPs belonging to class 3 and 5 of the penaeidin
family from Chinese shrimp (Fenneropenaeus chinensis) (Kang et al., 2004; Kang et al.,
2007) were engineered into rice and the four transgenic lines generated were reported to
show enhanced resistance to bacterial blight (Xanthomonas oryzae).
In the present study, the Pen4-1 gene with plant-preferred codon usage was
76
chemically synthesized for chimeric gene construction and plant transformation. The 30
transgenic turfgrass lines constitutively expressing either the Pen4-1 gene (25) or the
AP24::Pen4-1 fusion gene (5) all contained one or two copies of the integrated transgene
and were normal in morphology and development. Pen4-1 expression was confirmed at
the transcription level (Figure 2.2d). In planta disease resistance assays to compare
transgenic lines expressing Pen4-1and control plants without Pen4-1 for their response to
two important turfgrass fungal pathogens clearly demonstrated the effectiveness of this
novel AMP in rendering transgenic plants with significantly enhanced resistance to both
brown patch and dollar spot diseases. It is unlikely that the observed results would be
attributed to disrupted genes or regulatory sequences at the transgene integration site(s)
since Pen4-1-expressing transgenic lines from independent transformation events all
show similar phenotypes and confer increased resistance to fungal pathogens, whereas
transgenic control plants that contain the same expression vector, but without Pen4-1, do
not exhibit enhanced performance when subjected to pathogen infection. It also should be
noted that in the current research, T0 transgenic plants were clonally propagated and used
for pathogenicity assays as previously reported in other studies on perennial grasses (Qu
et al.). Our earlier work studying transgene expression and transmission using the
selectable marker, herbicide resistance conferring gene bar in creeping bentgrass had
demonstrated that Agrobacterium-mediated transformation of creeping bentgrass led to a
high frequency of a single-copy transgene insertion that exhibited stable inheritance
patterns. The inheritance and stability of transgene were demonstrated in both greenhouse
and field conditions (Luo et al., 2004a; Luo et al., 2004b; Luo et al., 2005; Li et al. 2010).
77
Currently, we are also conducting experiments studying stable transmission of Pen4-1
into next generations and inheritance of the enhanced disease resistance trait by the
progeny of the primary transgenic plants. Data from this research will provide further
support facilitating large-scale application of Pen4-1 in turf species for plant protection.
Since Pen4-1 originates from shrimp, the successful use of this protein in
agricultural biotechnology requires that it be efficiently produced when Pen4-1 gene is
introduced into the plant host genome, and that its biological activity maintained when
produced in transgenic plants. Although the antifungal activity of Pen4-1 has been
demonstrated by in vitro test of the synthesized protein (Cuthbertson et al., 2004;
Cuthbertson et al., 2005; Cuthbertson et al., 2006), it remains to be determined whether
or not high-level gene expression, efficient protein production, and correct folding or
processing of this protein could be achieved in planta. We therefore modified the coding
sequence of Pen4-1 for monocot plant-preferred codon usage. The same strategy has been
used previously when introducing other non-plant-derived AMP genes in plants (Coca et
al., 2004). In our study, a RNA transcript of the codon-optimized Pen4-1 gene was
detected in all the transgenic lines. Although attempts in detecting protein products of the
Pen4-1 in transgenic lines were unsuccessful, transgenic plants all displayed significantly
enhanced resistance to the two major turfgrass fungal diseases compared to wild-type
controls indicating that Pen4-1 was successfully produced in transformed creeping
bentgrass plants. It should be noted that native AMP genes have also been reported to be
expressed and function in other plant systems. For example, when introducing
Aspergillus giganteus antifungal protein AFP into rice plants, the translational efficiencies
78
of transcripts originating from the native and codon-optimized AFP gene appeared
similar in transgenic plants (Coca et al., 2004). Similarly, the introduction of np3 and np5,
two other AMP genes from Chinese shrimp in their native forms into rice led to enhanced
plant resistance to bacterial blight. This suggested the production of active AMPs in
transgenic plants although the presence of the protein products in transgenic plants was
not demonstrated (Wei et al., 2011). Further transgenic studies to compare the original
and codon-optimized forms of Pen4-1 gene for their protein translation efficiencies
would facilitate its use in other plant systems to achieve enhanced disease resistance.
All penaeidins possess a unique two-domain structure including an unconstrained
proline-rich N-terminal domain, PRD and a disulfide bond-stabilized cysteine-rich
domain, CRD (Cuthbertson et al., 2005). To ensure efficient disulfide bond formation of
the Pen4-1 produced in transgenic creeping bentgrass plants, we prepared a chimeric
gene encoding a fusion protein in which the DNA sequence coding for the transit signal
peptide of the secreted tobacco AP24 protein was translationally fused to the Pen4-1
coding sequence. Transit signal peptides, such as the one from AP24, are known to be
capable of directing proteins into the endoplasmic reticulum, facilitating the formation of
disulfide bonds (Coca et al., 2004). Therefore, the AP24::Pen4-1 fusion protein produced
in plant cells should lead to mature Pen4-1 that is more likely to be correctly folded than
the Pen4-1 protein alone produced in transgenic plants. However, in the present study, we
did not observe dramatic differences in enhanced plant resistance to the two turfgrass
fungal pathogens between transgenic turfgrass lines expressing AP24::Pen4-1 fusion
gene and those expressing Pen4-1 gene alone. One possible explanation could be that a
79
minimal protein activity was enough to inhibit pathogen infection; therefore, the methods
for pathogenicity assays used in the present study could not detect the real difference in
protein activities between the Pen4-1 alone and the AP24::Pen4-1 fusion protein
expressed in transgenic plants. Another possibility would be that although the mechanism
of protein secretion is highly conserved through the living world (von Heijne and
Abrahms n, 1989), signal peptides from one organism do not always function efficiently
when expressed in another organism (Smith et al., 1985; Chang et al., 1987; von Heijne
and Abrahms n, 1989). The correct choice of the signal peptide would have a great effect
on the production of the AMPs.
The multi-domain structure and the feature of protease resistance of this peptide
may also play important role in bestowing more flexibility to protein processing and
determining protein activities (Cuthbertson et al., 2006). In most cases the presence of
both the CRD and the PRD are important to confer the maximal antimicrobial activity.
However, it has been demonstrated that the single Pen4 PRD alone exhibited a similar
level of antimicrobial activity to that of the full-length Pen4 (Cuthbertson et al., 2004;
Cuthbertson et al., 2005). This implies that the disulfide bond formation in Pen4 may not
play a critical role in its antimicrobial ability. Therefore, specific targeting of Pen4-1 to
endoplasmic reticulum by the AP24 signal peptide did not seem to result in enhanced
protein activity. It is also possible that pathogen attack would lead to disruption of the
plant cells, releasing the peptides, which could then be oxidized in the extracellular space
to form the disulfide bond. Further studies comparing Pen4 PRD alone and the full-length
Pen4 in transgenic plants for their antimicrobial activities would help better understand
80
the role disulfide bonds play in determining the overall activity of Pen4 proteins.
The in vitro tests of Pen4-1 have revealed its resistance to a wide range of
phytopathogens, of which many infect plant species including rice, wheat, wine grapes,
strawberry and other crop plants (Cuthbertson et al., 2006). The current study with
creeping bentgrass as a target species provides the very first example of using Pen4-1 for
genetic engineering of enhanced disease resistance in transgenic crop plants, pointing to
the great potential of implementing similar strategies in other plant systems, especially in
food crops for improvement of plant biotic stress resistance.
Materials and Methods
Synthesis of Pen4-1 gene
The full sequence of Pen4-1 gene was obtained from PenBase (Gueguen et al.,
2006). The original nucleotide sequences of Pen4-1 encoding the mature Pen4-1 protein
(47 amino acids) were modified for plant-optimized codon usage. A stop codon (TAG)
was added to the 3’ end of the coding sequence (Figure 2.1). The modified full sequence
of Pen4-1 was chemically synthesized by Integrated DNA Technology (Coralville, IA,
USA), cloned in pZErO-2 (Invitrogen, Carlsbad, CA, USA) and verified by sequencing.
Construction of plant expression vectors
To generate transgenic plants expressing Pen4-1 and study the role Pen4-1 plays
in plant disease resistance, two chimeric DNA constructs were prepared containing either
81
the coding sequence of a single peptide Pen4-1 (Figure 2.2a) or the DNA sequence
coding for the transit signal peptide of the secreted tobacco AP24 protein translationally
fused to Pen4-1 coding sequence (Figure 2.2b). Both constructs were prepared using a
pSB11-based Agrobacterium binary vector that contains a selectable marker gene
conferring antibiotic spectinomycin resistance for bacterial transformation (Komari et al.,
1996).
The two plant expression vectors, p35S-bar/Ubi-Pen4-1, and p35S-bar/UbiAP24::Pen4-1 constructed in this work are presented in Figures 2.2a and b. Plasmid
p35S-bar/Ubi-Pen4-1 (Figure 2.2a) contained only the single peptide sequence of the
codon-optimized Pen4-1 gene, whereas plasmid p35S-bar/Ubi-AP24::Pen4-1 (Figure
2.2b) contained a chimeric Pen4-1 gene with the DNA sequence coding for the transit
signal peptide of the secreted tobacco AP24 protein (Melchers et al., 1993) being
translationally fused to Pen4-1 coding sequence. For their expression in turfgrass, both
Pen4-1 and AP24::Pen4-1 were cloned between the maize ubi promoter and the nos
terminator. An herbicide resistance conferring gene named bar driven by the CaMV 35S
promoter was included in both plasmids as selectable marker for plant transformation.
To prepare p35S-bar/Ubi-Pen4-1, the synthesized Pen4-1 coding sequence (with
added stop codon) was PCR amplified from pZErO-2:Pen4-1 by primers Pen4-ATG: 5’CGCGGATCCATGCACTCCTCCGGCTACACC-3’ (a BamHI restriction site and a start
codon, ATG added in the 5’ end were underlined and in italic respectively) and Pen4R:
5’-CGCGCATGCGAGCTCTAGAGGTGGCAGCAGTCG-3’ (an SphI and an SacI
restriction sites added in the 5’ end were underlined). The amplified fragment was
82
digested with BamHI and SacI enzymes and ligated into the corresponding sites of p35Sbar/Ubi-GUS (Luo, unpublished results) to replace the gusA coding sequence. To prepare
p35S-bar/Ubi-AP24::Pen4-1 construct, the PCR amplified fragment of Pen4-1 using
Pen4F (5’-CACTCCTCCGGCTACACC-3’) and Pen4R primers was treated with DNA
polymerase I, large (Klenow) fragment (New England Biolabs, Beverly, MA, USA) in
the absence of dNTP, then digested with SphI and ligated into the NcoI (blunt-ended with
Klenow in the presence of dNTP)-SphI sites of the plasmid pGEM-T-AP24 (Coca et al.,
2004), resulting in pGEM-T-AP24::Pen4-1 (data not shown). Upon verification of the
correct sequence of the amplified Pen4-1 and its in-frame fusion to the AP24 signal
sequence, the AP24::Pen4-1 chimeric gene was released from pGEM-T-AP24::Pen4-1
by BamHI and SacI digestions and ligated into the corresponding sites of p35S-bar/UbiGUS to replace the gusA coding sequence. The two constructs were transformed into
Agrobacterium tumefaciens strain LBA4404 by electroporation for subsequent plant
transformation.
Production, propagation and maintenance of transgenic turfgrass plants
A commercial genotype of creeping bentgrass (A. stolonifera L.) Penn A-4 was
used for plant transformation. Transgenic creeping bentgrass lines harboring either p35Sbar/Ubi-Pen4-1 or p35S-bar/Ubi-AP24::Pen4-1 were produced by Agrobacteriummediated transformation of embryonic callus initiated from mature seeds essentially as
previously described (Luo et al., 2004a). General procedures of plant propagation and
maintenance were followed by a previous protocol (Li et al. 2010). Transgenic plants
83
were grown in commercial potting mixture soil (Fafard 3-B Mix, Fafard Inc., Anderson,
SC, USA) and maintained in the greenhouse under a 16-hour photoperiod with
supplementary lighting at 27ºC in the light and 25ºC in the dark. Plants from individual
transformation events were clonally propagated from tillers and grown in pots (15 cm x
10.5 cm, Dillen Products, Middlefield, OH, USA) using commercial potting mixture soil.
Propagated plants were maintained in greenhouse for 4 to 6 months with regular
fertilization, mowing and irrigation, and used for further analysis.
Plant DNA isolation and southern blot analysis
Plant genomic DNA was extracted as previously described using the
cetyltrimethyl ammonium bromide (CTAB) method (Luo et al., 2005; Li et al., 2010).
After digestion of the DNA with BamHI according to supplier’s instruction (New
England Biolabs, Beverly, MA, USA), DNAs were electrophoresed on 0.8% agarose gels,
transferred onto nylon membranes (GE Healthcare Bio-Sciences Corp., Piscataway, NJ,
USA), and hybridized to
32
P-labelled DNA probes of bar. Hybridization was carried out
in modified Church and Gilbert buffer at 65°C following the standard protocol
(Sambrook et al., 1989). Hybridizing fragments were detected by exposure of the
membrane on a phosphor screen at room temperature overnight, and scanning on a
Typhoon 9400 phosphorimager.
RNA isolation and northern blot analysis
Total RNA was isolated from the leaves of transgenic and wild-type control plants
84
using Trizol reagent (Invitrogen). RNAs were subjected to formaldehyde-containing
agarose gel electrophoresis, and transferred onto Hybond-N+ filters (GE Healthcare BioSciences Corp.). The DNA fragment coding for the Pen4-1 gene was used as probe.
Hybridization and membrane wash were performed following the standard protocol
(Sambrook et al., 1989; Li et al., 2010).
Western blot Analysis
Total proteins were extracted from leaves following two different procedures. The
first was essentially as described by Fu et al. (Fu et al., 2007b). Two hundred mg of leaf
tissue was ground, then suspended in 500 μl of protein extraction buffer [1× PBS (pH
7.4), 10 mM EDTA, 1 mM PMSF, 6 μl protease inhibitor cocktail for plant cell and tissue
extracts (sigma), 1% (v/v) β-mercaptoethanol, and 0.1% (v/v) Triton X-100]. The second
protocol was as described by Coca et al. (Coca et al., 2004). Four hundred mg of plant
material was ground in liquid nitrogen and homogenized in SDS PAGE loading buffer
without 2-mercaptoethanol and incubated at 95oC for 10 min. After centrifugation, the
supernatant was precipitated with 4 volumes of acetone at -20oC for 30 min. Proteins
were pelleted, dried and dissolved in SDS-PAGE loading buffer containing 5% 2mercaptoethanol. For protein analysis, 30 µg of protein sample was loaded onto a 16%
Tricine SDS-PAGE gel. SDS-PAGE was performed as described previously (Schägger,
2006). For western blot, protein was transferred from the SDS-PAGE gel onto Protran
BA76 Nitrocellulose media (Whatman Inc., Piscataway, NJ, USA) using an
electrophoresis blotting system (Bio-Rad, Hercules, CA, USA). The Protein transfer
85
efficiency was verified by using Poceau S, and incubated with 5% carnation nonfat dry
milk in TBST overnight. The blots were then probed with anti-Pen4-1 antibody
developed by YenZym Antibodies, LLC (Burlingame, CA, USA), using the peptide
HSSGYTRPLRKPSRC, followed by adding the HRP-conjugated goat anti-rabbit IgG
secondary antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA)
and incubation for 1 hour at room temperature with shaking. The signals were detected
by incubation of membrane for 30 minutes at room temperature in the substrate working
solution (4-Chloro-1-naphthol). After stopping the reaction by rinsing the membrane with
water, the membrane was photographed immediately.
In vitro plant leaf inoculation with R. solani and S. homoeocarpa
Transgenic plants were challenged with R. solani and S. homoeocarpa, which
respectively cause brown patch and dollar spot, the two most common fungal diseases in
creeping bentgrass. Following procedures modified from the previous reports (Osusky et
al., 2000; Dong et al., 2007; Dong et al., 2008; Williams et al., 2011), we grew the R.
solani and S. homoeocarpa cultures on potato dextrose agar at 25oC for 3 days prior to
inoculation of detached leaves under aseptic conditions. The second expanded leaves
from the top of plant stolons were used for inoculation. Ten leaves from each of the
transgenic lines and wild-type control plants were randomly chosen for study. The leaves
cut from plants were first washed with 70% ethanol, and then rinsed with sterilized water.
The leaves were put on 1% of agar in Petri dishes (150 x 15 mm). An agar plug (d=3mm)
infested with mycelium of R. solani or S. homoeocarpa was placed on the bottom of the
86
midrib of each detached leaf for inoculation. The Petri dishes were put in a lighted
growth chamber under a 14/10 h (day/night) photoperiod. Temperature and relative
humidity (RH) in the growth chamber were 28oC and 70%. The development of brown
patch disease was rated by measuring the lesion length of the infected leaves 2 days, 8
days and 14 days post-inoculation. The development of dollar spot disease was rated by
measuring the lesion length on the infected leaves 2 days, 4 days and 7 days postinoculation. The experiment was repeated three times.
In vivo direct plant inoculation with S. homoeocarpa and R. solani
The preparation of the S. homoeocarpa and R. solani cultures and the in vivo plant
inoculation with pathogens were conducted based on the previously reported procedures
(Liu et al., 1998; Chai et al., 2002; Wang et al., 2003b). Selected Pen4-1-expressing
transgenic lines based on molecular analysis were evaluated for resistance to the infection
of the two fungal pathogens in comparison to control plants that did not contain Pen4-1.
The grasses were mowed prior to inoculation. The plants in each pot were then inoculated
with pathogens by applying, in the center of the pot, approximately 0.5 g of rye seeds
colonized by S. homoeocarpa or 3 and 6 g of rye seeds colonized by R. solani.
Plants inoculated with S. homoeocarpa (0.5 g of colonized inoculum) were placed
in plastic trays containing 4 cm of distilled water, lightly misted with distilled water at 48
h intervals to maintain relative 100% humidity. The plastic trays were placed inside a
greenhouse set to maintain a diurnal cycle of 14 h light and 10 h dark. Three to four
replicates of each transgenic line or wild type control were used for evaluation. Disease
87
severity was visually estimated at 3, 5, 7 and 9 days post-inoculation using the Horsfall
/Barrett scale (Horsfall and Barratt, 1945). Nine days later, the plants were moved to a
growth room from the greenhouse to recover for three weeks. Temperatures in the growth
room were maintained at 22ºC in the light and 17ºC in the dark. The inoculation
experiment was repeated three times.
Plants inoculated with R. solani (3g rye grass seeds colonized by the pathogen)
were placed in plastic trays containing 4 cm of distilled water, lightly misted with
distilled water at 48 h intervals to maintain humidity. The trays were placed inside a
growth chamber to maintain a diurnal cycle of 14 h light and 10 h dark. The temperature
and RH were 30ºC and 70% during day time, and 24ºC and 95% at night. After 14 days,
disease severity was either rated by measuring the total distance from the point of
inoculation to the farthest point of the lesions extended, or visually estimated using the
Horsfall /Barrett scale (Horsfall and Barratt, 1945). The inoculation experiment was
repeated twice.
Statistical analysis
Both in vitro plant leaf inoculation and in vivo direct plant inoculation tests were
conducted using a randomized complete block design. Data were analyzed using JMP®
9.0.0 (2010 SAS Institute Inc). For the data generated using the Horsfall-Barratt scale, a
nonparametric test, Wilcoxon test at P=0.01 and P=0.05, was used to compare the
medians. In the case of the data generated on a continuous scale such as lesion length,
Tukey’s HSD at P=0.01 and P=0.05 was used to test for differences in mean disease
88
severity.
Acknowledgements
We thank Dr. Blanca San Segundo for the gift of the plasmid pGEM-T-AP24, Dr.
Martin Bruce and Dr. Hanafy Fouly for providing Sclerotinia homoecarpa and Rhizoctoni
solani cultures, and for assistance in pathogenicity assays, Dr. Guido Schnabel and Dr.
William R. Marcotte for helpful discussion.
References
Alan, A., Blowers, A., and Earle, E. (2004). Expression of a magainin-type
antimicrobial peptide gene (MSI-99) in tomato enhances resistance to bacterial
speck disease. Plant Cell Report. 22, 388-396.
Allefs, S., Florack, D., Hoogendoorn, C., and Stiekema, W. (1995). Erwinia soft rot
resistance of potato cultivars transformed with a gene construct coding for
antimicrobial peptide cecropin B is not altered. American Journal of Potato
Research 72, 437-445.
Arce, P., Moreno, M., Gutierrez, M., Gebauer, M., Dell’Orto, P., Torres, H., Acuña,
I., Oliger, P., Venegas, A., and Jordana, X. (1999). Enhanced resistance to
bacterial infection by Erwinia carotovora subsp. atroseptica in transgenic potato
89
plants expressing the attacin or the cecropin SB-37 genes. American Journal of
Potato Research 76, 169-177.
Bartlett, D., Clough, J., Godwin, J., Hall, A., Hamer, M., and Parr-Dobrzanski, B.
(2002). The strobilurin fungicides. Pest Management Science 58, 649-662.
Bi, Y., Cammue, B., Goodwin, P., KrishnaRaj, S., and Saxena, P. (1999). Resistance
to Botrytis cinerea in scented geranium transformed with a gene encoding the
antimicrobial protein Ace-AMP1. Plant Cell Report 18, 835-840.
Boman, H. (1995). Peptide antibiotics and their role in innate immunity. Annual Review
of Immunology 13, 61-92.
Brent, K.J., and Federation, G.C.P. (1995). Fungicide resistance in crop pathogens:
how can it be managed? Brussels: GCPF.
Broekaert, W., Cammue, B., De Bolle, M., Thevissen, K., De Samblanx, G., and
Osborn, R. (1997). Antimicrobial peptides from plants. Critical Reviews in Plant
Sciences 16, 297-323.
Chai, B., Maqbool, S.B., Hajela, R.K., Green, D., Vargas, J.M., Warkentin, D.,
Sabzikar, R., and Sticklen, M.B. (2002). Cloning of a chitinase-like cDNA
(hs2), its transfer to creeping bentgrass (Agrostis palustris Huds.) and
development of brown patch (Rhizoctonia solani) disease resistant transgenic
lines. Plant Science 163, 183-193.
Chakrabarti, A., Ganapathi, T., Mukherjee, P., and Bapat, V. (2003). MSI-99, a
magainin analogue, imparts enhanced disease resistance in transgenic tobacco and
banana. Planta 216, 587-596.
90
Chang, C., Key, M., Bochner, B., Heyneker, H., and Gray, G. (1987). High-level
secretion of human growth hormone by Escherichia coli. Gene 55, 189-196.
Chen, J.-Y., Pan, C.-Y., and Kuo, C.-M. (2004). Molecular cloning and sequencing of
shrimp (Penaeus monodon) penaeidin-5 cDNA. Fish Shellfish Immunology 16,
665-670.
Coca, M., Peñas, G., Gomez, J., Campo, S., Bortolotti, C., Messeguer, J., and
Segundo, B. (2006). Enhanced resistance to the rice blast fungus Magnaporthe
grisea conferred by expression of a cecropin A gene in transgenic rice. Planta
223, 392-406.
Coca, M., Bortolotti, C., Rufat, M., Penas, G., Eritja, R., Tharreau, D., del Pozo, A.,
Messeguer, J., and San Segundo, B. (2004). Transgenic rice plants expressing
the antifungal AFP protein from Aspergillus giganteus show enhanced resistance
to the rice blast fungus Magnaporthe grisea. Plant Molecular Biology 54, 245259.
Couch, H. (1995). Diseases of turfgrasses. Golf Course Management, 125.
Cuthbertson, B., Büllesbach, E., and Gross, P. (2006). Discovery of synthetic
penaeidin activity against antibiotic-resistant fungi. Chemcial Biology & Drug
Design 68, 120-127.
Cuthbertson, B., BüLLESBACH, E., Fievet, J., BACHèRE, E., and Gross, P. (2004).
A new class (penaeidin class 4) of antimicrobial peptides from the Atlantic white
shrimp (Litopenaeus setiferus) exhibits target specificity and an independent
proline-rich-domain function. Biochemistry Journal 381, 79-86.
91
Cuthbertson, B., Yang, Y., Bachère, E., Büllesbach, E., Gross, P., and Aumelas, A.
(2005). Solution structure of synthetic penaeidin-4 with structural and functional
comparisons with penaeidin-3. Journal of Biological Chemistry 280, 1600916018.
Damicone, J.P., and Smith, D.L. (2009). Fungicide resistance management. (Division
of Agricultural Sciences and Natural Resources, Oklahoma State University.
Available: http://pods.dasnr.okstate.edu/docushare/dsweb/Get/Rendition-3508/F7663web.pdf.
DeGray, G., Rajasekaran, K., Smith, F., Sanford, J., and Daniell, H. (2001).
Expression of an antimicrobial peptide via the chloroplast genome to control
phytopathogenic bacteria and fungi. Plant Physiology 127, 852-862.
Destoumieux, D., Munoz, M., Bulet, P., and Bachère*, E. (2000a). Penaeidins, a
family of antimicrobial peptides from penaeid shrimp (Crustacea, Decapoda).
Cellular and Molecular Life Science 57, 1260-1271.
Destoumieux, D., Bulet, P., Strub, J., Van Dorsselaer, A., and Bachère, E. (1999).
Recombinant expression and range of activity of penaeidins, antimicrobial
peptides from penaeid shrimp. European Journal of Biochemistry 266, 335-346.
Destoumieux, D., Muñoz, M., Cosseau, C., Rodriguez, J., Bulet, P., Comps, M., and
Bachère, E. (2000b). Penaeidins, antimicrobial peptides with chitin-binding
activity, are produced and stored in shrimp granulocytes and released after
microbial challenge. Journal of Cell Science 113, 461-469.
92
Dong, S., Tredway, L., Shew, H., Wang, G., Sivamani, E., and Qu, R. (2007).
Resistance of transgenic tall fescue to two major fungal diseases. Plant Science
173, 501-509.
Dong, S., Shew, H., Tredway, L., Lu, J., Sivamani, E., Miller, E., and Qu, R. (2008).
Expression of the bacteriophage T4 lysozyme gene in tall fescue confers
resistance to gray leaf spot and brown patch diseases. Transgenic Research 17,
47-57.
Florack, D., Allefs, S., Bollen, R., Bosch, D., Visser, B., and Stiekema, W. (1995).
Expression of giant silkmoth cecropin B genes in tobacco. Transgenic Research 4,
132-141.
Fu, D., Huang, B., Xiao, Y., Muthukrishnan, S., and Liang, G.H. (2007).
Overexpression of barley hva1 gene in creeping bentgrass for improving drought
tolerance. Plant Cell Report 26, 467-477.
Gao, A., Hakimi, S., Mittanck, C., Wu, Y., Woerner, B., Stark, D., Shah, D., Liang,
J., and Rommens, C. (2000). Fungal pathogen protection in potato by expression
of a plant defensin peptide. Nature Biotechnology 18, 1307-1310.
Gueguen, Y., Garnier, J., Robert, L., Lefranc, M., Mougenot, I., De Lorgeril, J.,
Janech, M., Gross, P., Warr, G., and Cuthbertson, B. (2006). PenBase, the
shrimp antimicrobial peptide penaeidin database: sequence-based classification
and recommended nomenclature. Developmental & Comparative Immunology
30, 283-288.
93
Guo, Z., Bonos, S., Meyer, W.A., Day, P.R., and Belanger, F.C. (2003). Transgenic
creeping bentgrass with delayed dollar spot symptoms. Molecular Breeding 11,
95-101.
Hancock, R., and Chapple, D. (1999). Peptide antibiotics. Antimicrobial Agents
Chemotheropy 43, 1317-1323.
Haydu, J., Hodges, A., and Hall, C. (2006). Economic impacts of the turfgrass and
lawncare industry in the United States. Available: http://edis.ifas.ufl.edu/FE632.
Horsfall, J., and Barratt, R. (1945). An improved grading system for measuring plant
diseases. Phytopathology 35, 7.
Huang, Y., Nordeen, R., Di, M., Owens, L., and McBeath, J. (1997). Expression of an
engineered cecropin gene cassette in transgenic tobacco plants confers disease
resistance to Pseudomonas syringae pv. tabaci. Phytopathology 87, 494-499.
Imamura, T., Yasuda, M., Kusano, H., Nakashita, H., Ohno, Y., Kamakura, T.,
Taguchi, S., and Shimada, H. (2010). Acquired resistance to the rice blast in
transgenic rice accumulating the antimicrobial peptide thanatin. Transgenic
Research 19, 415-424.
Jaynes, J., Nagpala, P., Destéfano-Beltrán, L., Hong Huang, J., Kim, J., Denny, T.,
and Cetiner, S. (1993). Expression of a cecropin B lytic peptide analog in
transgenic tobacco confers enhanced resistance to bacterial wilt caused by
Pseudomonas solanacearum. Plant Science 89, 43-53.
Jha, S., and Chattoo, B. (2010). Expression of a plant defensin in rice confers resistance
to fungal phytopathogens. Transgenic Research 19, 373-384.
94
Kang, C.-J., Xue, J.-F., Liu, N., Zhao, X.-F., and Wang, J.-X. (2007). Characterization
and expression of a new subfamily member of penaeidin antimicrobial peptides
(penaeidin 5) from Fenneropenaeus chinensis. Molecular Immunology 44, 15351543.
Kang, C.J., Wang, J.X., Zhao, X., Yang, X.M., Shao, H.L., and Xiang, J.H. (2004).
Molecular cloning and expression analysis of Ch-penaeidin, an antimicrobial
peptide from Chinese shrimp, Fenneropenaeus chinensis. Fish Shellfish
Immunology 16, 513-525.
Keymanesh, K., Soltani, S., and Sardari, S. (2009). Application of antimicrobial
peptides in agriculture and food industry. World Journal of Microbiology and
Biotechnology 25, 933-944.
Komari, T., Hiei, Y., Saito, Y., Murai, N., and Kumashiro, T. (1996). Vectors
carrying two separate T DNAs for co transformation of higher plants mediated by
Agrobacterium tumefaciens and segregation of transformants free from selection
markers. The Plant Journal 10, 165-174.
Lee, S., Hwang, I., Choi, H., and Hwang, B. (2008). Involvement of the pepper
antimicrobial protein CaAMP1 gene in broad spectrum disease resistance. Plant
Physiology 148, 1004-1020.
Li, Q., Lawrence, C., Xing, H., Babbitt, R., Bass, W., Maiti, I., and Everett, N.
(2001). Enhanced disease resistance conferred by expression of an antimicrobial
magainin analog in transgenic tobacco.Planta 212, 635-639.
95
Li, Z., Baldwin, C., Hu, Q., LIU, H., and Luo, H. (2010). Heterologous expression of
Arabidopsis H+-pyrophosphatase enhances salt tolerance in transgenic creeping
bentgrass (Agrostis stolonifera L.). Plant, Cell & Environment 33, 272-289.
Liang, H., Catranis, C., Maynard, C., and Powell, W. (2002). Enhanced resistance to
the poplar fungal pathogen, Septoria musiva, in hybrid poplar clones transformed
with genes encoding antimicrobial peptides. Biotechnology Letter 24, 383-389.
Liu, C.-A., Zhong, H., Vargas, J., Penner, D., and Sticklen, M. (1998). Prevention of
Fungal Diseases in Transgenic, Bialaphos- and Glufosinate-Resistant Creeping
Bentgrass (Agrostis palustris). Weed Science 46, 139-146.
Luck, J.E., and Gillings, M.R. (1995). Rapid identification of benomyl resistant strains
of Botrytis cinerea using the polymerase chain reaction. Mycologcial Research
99, 1483-1488.
Luo, H., Hu, Q., Nelson, K., Longo, C., Kausch, A., Chandlee, J., Wipff, J., and
Fricker, C. (2004a). Agrobacterium tumefaciens-mediated creeping bentgrass
(Agrostis stolonifera L.) transformation using phosphinothricin selection results in
a high frequency of single-copy transgene integration. Plant Cell Report 22, 645652.
Luo, H., Hu, Q., Nelson, K., Longo, C., and Kausch, A. (2004b). Controlling transgene
escape in genetically modified grasses. Molecular Breeding of Forage and Turf,
245-254.
96
Luo, H., Kausch, A., Hu, Q., Nelson, K., Wipff, J., Fricker, C., Owen, T., Moreno,
M., Lee, J., and Hodges, T. (2005). Controlling transgene escape in GM
creeping bentgrass. Molecular Breeding 16, 185-188.
Ma, Z., and Michailides, T.J. (2005). Advances in understanding molecular
mechanisms of fungicide resistance and molecular detection of resistant
genotypes in phytopathogenic fungi. Crop Protection 24, 853-863.
Ma, Z., Yoshimura, M.A., and Michailides, T.J. (2003). Identification and
characterization of benzimidazole resistance in Monilinia fructicola from stone
fruit orchards in California. Applied Environmental Microbiology 69, 7145-7152.
Melchers, L., Sela-Buurlage, M., Vloemans, S., Woloshuk, C., Roekel, J., Pen, J.,
Elzen, P., and Cornelissen, M. (1993). Extracellular targeting of the vacuolar
tobacco proteins AP24, chitinase and -1, 3-glucanase in transgenic plants. Plant
Molecular Biology 21, 583-593.
Mentag, R., Luckevich, M., Morency, M., and Seguin, A. (2003). Bacterial disease
resistance of transgenic hybrid poplar expressing the synthetic antimicrobial
peptide D4E1. Tree Physiology 23, 405-411.
Mkay, G.J., and Cooke, L.R. (1997). A PCR-based method to characterise and identify
benzimidazole resistance in Helminthosporium solani. FEMS Microbiology
Letters 152, 371-378.
Muñoz, M., Vandenbulcke, F., Saulnier, D., and Bachère, E. (2002). Expression and
distribution of penaeidin antimicrobial peptides are regulated by haemocyte
97
reactions in microbial challenged shrimp. European Journal of Biochemistry 269,
2678-2689.
Newhouse, A., Schrodt, F., Liang, H., Maynard, C., and Powell, W. (2007).
Transgenic American elm shows reduced Dutch elm disease symptoms and
normal mycorrhizal colonization. Plant Cell Report 26, 977-987.
Osusky, M., Osuska, L., Kay, W., and Misra, S. (2005). Genetic modification of potato
against microbial diseases: in vitro and in planta activity of a dermaseptin B1
derivative, MsrA2. Theoretical and Applied Genetics 111, 711-722.
Osusky, M., Osuska, L., Hancock, R., Kay, W., and Misra, S. (2004). Transgenic
potatoes expressing a novel cationic peptide are resistant to late blight and pink
rot. Transgenic Research 13, 181-190.
Osusky, M., Zhou, G., Osuska, L., Hancock, R., Kay, W., and Misra, S. (2000).
Transgenic plants expressing cationic peptide chimeras exhibit broad-spectrum
resistance to phytopathogens. Nature Biotechnology 18, 1162-1166.
Patkar, R., and Chattoo, B. (2006). Transgenic indica rice expressing ns-LTP-like
protein shows enhanced resistance to both fungal and bacterial pathogens.
Molecular Breeding 17, 159-171.
Qu, R., Luo, H., and Meier, V.D. (2008). Turfgrass. Compendium of Transgenic Crop
Plants: Transgenic Plantation Crops, Ornamentals and Trufgrasses Kole, C. and
Hall, T.C., eds, 41.
98
Rajasekaran, K., Cary, J., Jaynes, J., and Cleveland, T. (2005). Disease resistance
conferred by the expression of a gene encoding a synthetic peptide in transgenic
cotton (Gossypium hirsutum L.) plants. Plant Biotechnology Journal 3, 545-554.
Rao, A. (1995). Antimicrobial peptides. Molecular Plant-Microbe Interactions 8, 13.
Rekha, Naik, S.N., and Prasad, R. (2006). Pesticide residue in organic and conventional
food-risk analysis. Journal of Chemical Health and Safety 13, 12-19.
Reynoird, J., Mourgues, F., Norelli, J., Aldwinckle, H., Brisset, M., and Chevreau,
E. (1999). First evidence for improved resistance to fire blight in transgenic pear
expressing the attacin E gene from Hyalophora cecropia. Plant Science 149, 2331.
Sambrook, J., Fritsch, E., and Maniatis, T. (1989). Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 267, 92899293.
Schägger, H. (2006). Tricine–SDS-PAGE. Nature Protocol 1, 16-22.
Schnabel, G., and Jones, A.L. (2001). The 14 -Demethylasse (CYP51A1) gene is
overexpressed in Venturia inaequalis strains resistant to Myclobutanil.
Phytopathology 91, 102-110.
Sharma, A., Sharma, R., Imamura, M., Yamakawa, M., and Machii, H. (2000).
Transgenic expression of cecropin B, an antibacterial peptide from Bombyx mori,
confers enhanced resistance to bacterial leaf blight in rice. FEBS Letters 484, 711.
99
Smith, R., Duncan, M., and Moir, D. (1985). Heterologous protein secretion from
yeast. Science 229, 1219-1224.
Terras, F., Eggermont, K., Kovaleva, V., Raikhel, N., Osborn, R., Kester, A., Rees,
S., Torrekens, S., Leuven, F., and Vanderleyden, J. (1995). Small cysteine-rich
antifungal proteins from radish: their role in host defense. The Plant Cell 7, 573588.
The National Turfgrass Research Initiative (2003) National Turfgrass Evaluation
Program website. 23: Available: http://www.ntep.org/pdf/turfinitiative.pdf.
Accessed 2011 August.
von Heijne, G., and Abrahms n, L. (1989). Species-specific variation in signal peptide
design Implications for protein secretion in foreign hosts. FEBS Letters 244, 439446.
Walsh, B., Ikeda, S., and Boland, G. (1999). Biology and management of dollar spot
(Sclerotinia homoeocarpa); an important disease of turfgrass. Hortscience 34, 1321.
Wang, Y., Browning, M., Ruemmele, B., Chandlee, J., Kausch, A., and Jackson, N.
(2003). Glufosinate reduces fungal diseases in transgenic glufosinate-resistant
bentgrasses (Agrostis spp). Weed Science 51, 130-137.
Wei, W., Chao, W., Mei, L., Xu-ri, L., Guo-cheng, H., Hua-min, S., Zong-xiu, S.,
Wen-zhen, L., and Ya-ping, F. (2010). Resistance of antimicrobial peptide genes
transgenic rice to bacterial blight. China Journal of Rice Science 18, 10-16.
100
Williams, B., Kabbage, M., Kim, H.-J., Britt, R., and Dickman, M.B. (2011). Tipping
the balance: Sclerotinia sclerotiorum secreted oxalic acid suppresses host
defenses by manipulating the host redox environment. PLoS Pathogens 7,
e1002107.
Yang, L., Tang, R., Zhu, J., Liu, H., Mueller-Roeber, B., Xia, H., and Zhang, H.
(2008). Enhancement of stress tolerance in transgenic tobacco plants
constitutively expressing AtIpk2 , an inositol polyphosphate 6-/3-kinase from
Arabidopsis thaliana. Plant Molecular Biology 66, 329-343.
Yang, Y., Poncet, J., Garnier, J., Zatylny, C., Bachère, E., and Aumelas, A. (2003).
Solution structure of the recombinant penaeidin-3, a shrimp antimicrobial peptide.
Journal of Biological Chemistry 278, 36859-36867.
Yevtushenko, D., and Misra, S. (2007). Comparison of pathogen induced expression
and efficacy of two amphibian antimicrobial peptides, MsrA2 and temporin A, for
engineering wide spectrum disease resistance in tobacco. Plant Biotechnology
Journal 5, 720-734.
Yevtushenko, D., Romero, R., Forward, B., Hancock, R., Kay, W., and Misra, S.
(2005). Pathogen-induced expression of a cecropin A-melittin antimicrobial
peptide gene confers antifungal resistance in transgenic tobacco. Journal of
Experimental Botony 56, 1685-1695.
Yi, J., Seo, H., Yang, M., Robb, E., Nazar, R., and Lee, S. (2004). Plant defense gene
promoter enhances the reliability of shiva-1 gene-induced resistance to soft rot
disease in potato. Planta 220, 165-171.
101
Young, J., and Patton, A. (2010). A guide to fungicide resistance in turf systems.
Cooperative Extension Service, University of Arkansas, US Dept. of Agriculture
and county governments cooperating. Available:
www.uaex.edu/Other_Areas/publications/PDF/FSA-6146.pdf.
Zasloff, M. (2002). Antimicrobial peptides of multicellular organisms. Nature 415, 389395.
102
CHAPTER 3 -CONSTITUTIVE EXPRESSION OF A
MIR319 GENE ALTERS PLANT DEVELOPMENT
AND INCREASES SALT AND DROUGHT
TOLERANCE IN TRANSGENIC CREEPING
BENTGRASS (AGROSTIS STOLONIFERA L.)
Keywords: abiotic stress, microRNAs, perennial grasses, transgenic creeping
bentgrass, turfgrass,
Abstract
The miR319 family is one of the first characterized and conserved miRNA families in
plants and it has been demonstrated to target TEOSINTE BRANCHED/CYCLOIDEA/PCF
(TCP) genes encoding plant-specific transcription factors known to be largely involved in
leaf development. We have investigated the role miR319 plays in plant development and
plant response to abiotic stress in perennial grass species. A full length cDNA of the rice
miR319 gene, Osa-miR319a was introduced into creeping bentgrass (Agrostis stolonifera
L.). Transgenic plants overexpressing the Osa-miR319a exhibited morphological changes,
including significantly decreased tiller numbers, wider and thicker leaves, coarser stems,
increasedr weight:area ratio and more total wax coverage. Overexpression of miR319 also
led to enhanced drought and salt tolerance in transgenics, which might be attributed to the
increased weight:area ratio and total wax coverage as well as less sodium uptake. Gene
expression analysis in both wild-type and transgenic plants indicated that at least four
putative miR319 target genes in turfgrass AsPCF5, AsPCF6, AsPCF8 and AsTCP14 were
down-regulated in transgenic plants. And a homologue of rice NAC domain gene
103
AsNAC60 was also shown to be down-regulated in transgenics. Our results reveal the
importance of miR319 in regulating plant resistance to environmental adversities and
indicate that the enhanced abiotic stress tolerance in transgenic plants might be related to
the significant down-regulation of the putative target genes of miR319. This may lead to
development of novel molecular strategies to genetically engineer crop species for
enhanced performance under unfavorable environmental conditions, contributing to
agriculture production.
Introduction
Plant responses to drought and salt stresses have been studied extensivelyin
understanding the physiological and molecular mechanisms underlying plant adaptation
to these drought and salt stress (reviewed by Munns, 2002; Wang et al., 2003a; Chaves et
al., 2009). At the physiological level, plant responses to salinity stress are generally
divided into two phases: a rapid, osmotic phase inhibiting shoot growth and a slower,
ionic phase accelerating senescence of mature leaves (Munns and Tester, 2008). Plant
responses to drought share a lot of similarities, especially in the first phase. Plants
subjected to drought and salinity both experience a physiological water deficit which
alters photosynthesis, cell growth and induces osmotic adjustment to maintain current
water uptake and cell turgor (Chaves et al., 2009). However, under salinity stress, plants
endure salt-specific effects with very high Na+ or Cl- concentrations within cells leading
104
to toxicity. To tolerate salt-specific effects, plants either minimize the uptake of salt or
compartmentalize salt in the vacuoles (Munns, 2005). The current advances is plant
biotechnologies for enhanced plant tolerance to drought (Garg et al., 2002; Capell et al.,
2004; Chandra Babu et al., 2004; Lian et al., 2004; Oh et al., 2005; Wang et al., 2005a;
Hu et al., 2006; Fu et al., 2007a) and salinity (Gaxiola et al., 2001; Rus et al., 2001;
White and Broadley, 2001; Zhang and Blumwald, 2001; Zhang et al., 2001; Laurie et al.,
2002; Shi et al., 2002; Flowers, 2004; Rus et al., 2004; Wu et al., 2004; Møller et al.,
2009; Li et al. 2010) mainly concentrate on manipulating downstream genes which
function in
the physiological responses discussed above (e.g. osmotic or ionic
adjustment).
In recent years, the upstream regulatory networks of plant drought and salt stress
response including transcription factors, hormones, protein kinases, protein phosphatases,
and other signaling molecules such as calmodulin binding proteins have gradually been
uncovered(Zhang et al., 2004; Shinozaki and Yamaguchi-Shinozaki, 2007; Nakashima et
al., 2009). However, the fine details of these regulatory networks are still largely
unknown and questions about how the different regulatory elements function together and
how they are coordinated by master regulators posttranscriptionally or posttranslationally
remain to be addressed. The discovery of plant miRNAs largely involved in abiotic stress
response (Phillips et al., 2007; Sunkar et al., 2007; Lu and Huang, 2008; Mazzucotelli et
al., 2008; Shukla et al., 2008; Lewis et al., 2009; Nakashima et al., 2009) shed light on
these questions. It has been revealed that miRNAs mediate plant abiotic stress response
through regulating their target genes, the majority of which are transcription factors
105
constituting complicated regulatory network (65% of the confirmed or confidently
predicted targets of miRNAs are transcription factors), serving as key players in the gene
regulation networks (Jones-Rhoades et al., 2006).
Plant miRNAs are ~20 to 24 nt non-coding RNAs that specifically base pair to
and induce the slicing of target mRNAs or cause translational repression(Zhang et al.,
2006; Shukla et al., 2008). They have diverse roles in plant development such as phase
transition (e.g. from vegetative growth to reproductive phase), leaf morphogenesis, floral
organ identity, developmental timing and other aspects of plant development (Lu and
Huang, 2008; Rubio-Somoza and Weigel, 2011). In recent years, a large amount of data
have been generated by genome-wide high-throughput sequencing and microarray
profiling to identify stress-responsive miRNAs (Jones-Rhoades and Bartel, 2004; Sunkar
and Zhu, 2004; Zhao et al., 2007; Ding et al., 2009; Yang et al., 2010; Wang et al., 2011),
of which miR319 was identified to respond multiple stresses. For example, they are upregulated by dehydration, salt and cold stress in Arabidopsis (Sunkar and Zhu, 2004; Liu
et al., 2008), and by cold stress in sugar cane (Thiebaut et al., 2011), whereas a
complicated behavior in expression was observed in rice depending on developmental
states (e.g. Osa-miR319 was only identified as up-regulation on tillering stage 12 days
after water withholding) (Zhou et al., 2010a). As one of the first experimentally
characterized and most conserved miRNA families (Axtell and Bowman, 2008), the
miR319 targets, TEOSINTE BRANCHED/CYCLOIDEA/PCF (TCP) genes encode plantspecific transcription factors sharing a conserved TCP domain region with a basic helixloop-helix structure (bHLH). The TCP family is known to be largely involved in plant
106
development such as control of cell proliferation in leaf morphogenesis (Palatnik et al.,
2003; Ori et al., 2007; Nag et al., 2009).
Although miR319-mediated changes in plant morphology have been well studied
in dicots, there have been no published reports studying monocots especiallyperennial
grass species. As is known, the developmental regulation between monocots and dicots is
different (Nelson and Langdale, 1989; Tsiantis et al., 1999; Rudall and Buzgo, 2002;
Scarpella and Meijer, 2004). It would be interesting to know how miR319 functions to
impact plant development in monocot species. Moreover, although the involvement of
miR319 in plant response to drought and salinity stress has been suggested based on
microarray data, experimental proof in support of the possible contribution of the miR319
family and the underlying molecular mechanisms are still lacking. In this study,
transgenic plants of creeping bentgrass (Agrostis stolonifera L.) overexpressing a rice
miR319 gene were generated to investigate the roles miR319 play in controlling plant
development and plant response to environmental stress, i.e., (1) what impact the miR319
gene family may have in plant development in perennial grasses? (2) Is miR319 involved
in plant abiotic stress response in perennial grasses? (3) What is the molecular
mechanism of miR319-mediated plant tolerance to abiotic stress in perennial grasses?
Results
Production and molecular characterization of transgenic creeping bentgrass
plants expressing the rice miR319 gene, Osa-miR319
107
To study the potential of manipulating miR319 expression in perennial species for
enhancing plant resistance to environmental stresses, we prepared a chimeric DNA
construct containing one of the rice miR319 genes, Osa-miR319a under the control of the
35S promoter (Figure 3.1a). Using Agrobacterium-mediated transformation of
embryogenic callus derived from mature seeds, we introduced the chimeric gene
construct, p35S-hyg/p35S-Osa-miR319a into the creeping bentgrass cultivar, Penn A-4 to
produce a total of 15 independent transgenic (TG) lines ectopically expressing OsamiR319a. PCR amplification of foreign genes using genomic DNA from all transformants
confirmed the presence of transgenes (Figure 3.1b). RT-PCR analysis revealed the
presence of the rice primary miR319a transcripts in all transgenic lines (Figure 3.1c).
Under the higher stringency of PCR conditions (30 cycles with the annealing temperature
of 65oC), the high level of mature transcripts of miR319 could only be detected by stemloop RT-PCR analysis in the transgenics which accumulated in high quantities,
suggesting that the rice miR319 was successfully expressed in turfgrass plants and
properly processed into mature microRNAs (Figure 3.1d). However, the detection of
mature miR319 transcripts in wild type control plants under a lower stringency of PCR
conditions suggested that the transcripts of the turf endogenous miR319 was also
amplified and shared conservation of mature sequence with rice miR319 (Figure 3.1d).
108
Figure 3.1 Generation and molecular analysis of the transgenic lines expressing OsamiR319a. (a) Schematic diagram of the Osa-miR319a overexpression gene construct,
p35S-hyg/p35S-Osa-miR319a, in which the Osa-miR319a gene is under the control of
CaMV35S promoter. The CaMV35S promoter-driven hyg gene is included for
hygromycin resistance. (b) Example of PCR analysis of hyg gene in wild-type (WT) and
transgenic (TG) plants to detect transgene insertion into the host genome. (c) Example of
RT-PCR analysis of the primary Osa-miR319a transcripts in transgenics. Primary OsamiR319a transcripts were detected in transgenic plants. (d) Example of stem-loop RT
analysis of the mature Osa-miR319a in WT and TG plants.
Overexpression of miR319 causes pleiotropic phenotypes in transgenic
creeping bentgrass plants
Analysis of transgenic creeping bentgrass plants constitutively expressing OsamiR319a showed that compared to control plants without Osa-miR319a, Osa-miR319a
plants displayed wider leaves and larger stems (Figure 3.2a, b). Microscopic analysis of
109
the plant leaf samples indicated that leaf expansion (blade width and vein number) in
Osa-miR319a plants was significantly greater than that in control plants (Figure 3.2c, d,
e). Moreover, compared to control plants without Osa-miR319a, Osa-miR319a plants
also exhibited thicker leaves (Figure 3.2f, g), which might be associated with increased
mesophyll cell layers (Figure 3.2f). In stems, overexpression of miR319 led to increased
stem diameter in transgenic plants as shown in the Figure 3.2h and 3.2i. Leaf and stem
size is dependent on both the number and the size of cells in the organ. To determine
whether enlargement of Osa-miR319a plant leaves and stems was associated with
increased cell number, cell size or a combination of these two parameters, we compared
control and Osa-miR319a plants when they were fully developed after mowing. The size
of the cells in both leaves and stems was not significantly different between control and
Osa-miR319a plants (data not shown, Figure 3.2c, f, h) indicating that the wide-leaf and
large-stem phenotypes of the Osa-miR319a transgenic plants are most likely due to an
110
111
Figure 3.2 Morphology change in transgenic plants overexpressing Osa-miR319a. (a)
The TG plants exhibited wider leaves than WT controls. (b) A closer look at the OsamiR319a TG plants and WT controls. The image shows that the representative TG plant
leaf is wider (left) and the stem is bigger (right). (c) Leaf sectioning images of WT and
TG plants. (d) Statistic analysis of leaf blade width in WT and TG plants. (e) Statistical
analysis of total vein number in WT and TG plants. (f) Examples of representative
sectioning images of WT and TG plant leaves. (g) Statistical analysis of leaf thickness in
WT and TG plants. (h) Examples of representative sectioning images of WT and TG
plant stems. (i) Statistical analysis of stem diameter in WT and TG plants. Statistical
analysis of leaf blade width, total vein number, leaf thickness and stem diameter was
conducted on WT control plants and various transgenic lines. Data are presented as
means ± SE, and error bars represent standard error. Asterisk * indicates a significant
difference between transgenic and control plants at P < 0.05 by Student’s t-test using
JMP 9.0.0
increase in cell proliferation, but not the expansion of individual cells. This morphology
change in turfgrass quite different from that was observed in dicot species in which
overexpression of miR319 lead to crinkled and more serrated leaves resulting from
excessive cell proliferation in the absence of TCP activity(Palatnik et al., 2003; Ori et al.,
2007).
To elucidate any potential impact of constitutively expressed miR319 on other
aspects of plant development, we grew plants starting from a single tiller and studied
plant growth and development by monitoring changes in plant tiller numbers at different
stages and measuring shoot biomass as represented by dry weight in control and OsamiR319a plants. As shown in Figure 3.3a and 3.3b, Osa-miR319a transgenics exhibited
dramatically reduced tillers compared to control plants. However, no significant
difference in shoot biomass between control and Osa-miR319a plants was observed
(Figure 3.3c) suggesting that increased leaf expansion in Osa-miR319a plants might
compensate for the loss in biomass caused by decreased tillering. In contrast, the root
112
biomass of the Osa-miR319a plants was significantly lower than that of the controls
(Figure 3.3a, d).
Figure 3.3 Tillering and plant development under normal growth conditions. Both WT
and TG plants initiated from a single tiller. (a) Tillering, shoot and root development in
WT and TG plants 90 days after initiation from a single tiller of the same size. The image
shows that TG plants have fewer tillers and less root growth than WT controls. (b)
Comparison of tiller numbers in WT and TG plants 30 days, 60 days and 90 days after
initiation from a single of the same size. (c) Biomassof WT and TG shoots 90 days after
initiation from a single tiller of the same size. (d) Biomass of WT and TG roots 90 days
after initiation from a single of the same size. Statistical analysis of tiller number, shoot
and root biomass was conducted on WT control plants and various transgenic lines. Data
are presented as means ± SE, and error bars represent standard errors. Asterisks *
indicates a significant difference between transgenic and control plants at P < 0.05 by
Student’s t-test using JMP 9.0.0.
113
Overexpression of miR319 results in enhanced salt tolerance in transgenic
creeping bentgrass plants
Involvement of many microRNAs in plant resistance to abiotic stress, such as
drought and salinity has been suggested by their up- or down-regulation in the presence
of various environmental stimuli (Sunkar and Zhu, 2004; Liu et al., 2008; Zhou et al.,
2010a; Thiebaut et al., 2011). However, direct evidence about the role miR319 plays in
plant response to environmental stress is still lacking. To investigate this, we first
examined control and transgenic plants constitutively expressing Osa-miR319a under
salinity stress. We treated both the control and Osa-miR319a plants with NaCl daily by
applying nutrient solution supplemented with 200 mM NaCl. As shown in Figure 3.4a
and 3.4b, the growth of the control plants without Osa-miR319a was severely
hamperedand serious tissue damage was observed 16 days after salt treatment whereas
the Osa-miR319a plants were much less affected and grew better. To revealhow plants
recover from the release of salinity stress, the salt-treated control and Osa-miR319a
plants were both subjected to regular maintenance. The Osa-miR319a plants survived the
treatment and the majority of the tillers recovered from salt-elicited damage, whereas
only a few tillers in control plants stayed alive (Figure3. 4b).
Osa-miR319a transgenics retain more water and exhibited less cell
membrane damage than control plants without Osa-miR319a under salt stress
To further elucidate physiological mechanism of enhanced salt tolerance in OsamiR319a plants, we investigated water status of these transgenic lines in comparison to
114
control plants without Osa-miR319a. As exemplified in Figure 3.4c showing data from
two of the representative transgenic lines, there was no significant difference in leaf
relative water content between control and Osa-miR319a plants under normal growth
conditions. When exposed to various concentrations of NaCl, the leaf relative water
content in both control and Osa-miR319a plants declined. However, this decline was
more significant in control plants than in Osa-miR319a transgenics, especially when high
salinity stress (300 mM of NaCl) was applied. Consequently, the leaf relative water
content in Osa-miR319a transgenics was significantly higher than that in control plants
under salinity stress, indicating greater water retention capacity the Osa-miR319a
transgenics than that in control plants without Osa-miR319a gene.
Next, we examined cell membrane integrity in both the Osa-miR319a transgenic
and control plants. To do this, we measured the leaf cell electrolyte leakage (EL) in
plants grown under normal and salinity conditions. Both control and Osa-miR319a plants
exhibited low levels of cell EL, which were not significantly different from each other
under normal growth conditions (Figure 3.4d). In contrast, the leaf EL significantly
increased in both control and the Osa-miR319a plants upon exposure to various
concentrations of NaCl. The higher the concentration of the salt used for plant treatment
was, the more the leaf cell ELwas (Figure 3.4d). However, the increase of leaf cell EL
was significantly more pronounced in control plants than in the Osa-miR319a transgenics
(Figure 3.4d), indicating that the control plants without Osa-miR319a are more prone to
salt-elicited cell membrane damage than the Osa-miR319a plants.
115
Figure 3.4 Response of WT and TG plants to salt stress. (a) The fully developed WT
and TG plants clonally propagated from individual tillers were grown in sandand
subjected to 200 mM NaCl treatment. The images show differences in damages elicited
by salinity in WT and TG plants16 days after treatment. (b) Performance of WT and TG
plants 12 days after recovering from a 16-day salt treatment. (c) Relative water content
(RWC) of WT and TG plants under salt stress. Fully developed WT and TG plants were
watered daily with 200 ppm 20-10-20 (N-P-K) fertilizer supplemented with 0, 200 and
300 mM NaCl, as indicated. Leaf tissues were carefully excised after 12 days of NaCl
treatment, and used for measuring RWC. (d) Electrolyte leakage (EL) of leaf cells of WT
and TG plants under normal and various salinity conditions. Leaf tissues from WT and
TG plants were carefully excised after 12 days of NaCl treatment, and used for measuring
EL. Data are presented as means ± SE, and error bars represent standard error. Asterisk *
indicates a significant difference between transgenic and control plants at P < 0.05 by
Student’s t-test using JMP 9.0.0.
116
Osa-miR319a transgenics accumulate less Na+ than control plants under
salinity condition
A strong correlation between salt exclusion and salt tolerance has been reported in
many plant species including rice, durum wheat, bread wheat, barley, pearl millet,
Hordeum species, tall wheatgrass and Triticum tauschii (Yeo and Flowers, 1983; Lauchli,
1984; Tardieu et al., 1992; Bolaños and Edmeades, 1993; Bruce et al., 2002; Munns and
James, 2003; Munns et al., 2003; Tester and Davenport, 2003; Campos et al., 2004;
Manschadi et al., 2006; Manschadi et al., 2008; Tardieu, 2011). Salt sensitive cultivars
tend to have higher accumulation of Na+ . Therefore, lower accumulation of Na+ in plants
as a positive trait has been used to select superior genotypes in different breeding
programs (Munns and James, 2003; Munns et al., 2003).
To investigate how Osa-miR319a transgenic plants perform in Na+
uptake
compared to control plants without Osa-miR319a, we measured shoot Na+ content in
plants grown under normal and salt stress conditions. As shown in Figure 3.5a, no
significant difference in shoot Na+ content was observed between Osa-miR319a
transgenics and control plants under normal growth conditions (no NaCl application).
Both Osa-miR319a transgenic and control plants accumulated low levels of Na+ (Figure
3.5a). Sodium accumulations increased drastically in both control and Osa-miR319a
plants when treated with 200 mM of NaCl. However, the increased Na+ accumulation
was significantly more pronounced in control plants than in Osa-miR319a transgenics (P
= 0.01) (Figure 3.5a, c), suggesting that the enhanced salt tolerance of Osa-miR319a
plants might be the result of less Na+ accumulation in the cytoplasm of the cell,
117
Figure 3.5 Mineral contents in WT and TG plants under normal and salinity conditions.
Shoot tissues from WT and TG plants were carefully excised after 12 days of NaCl
treatment, and used for measuring mineral contents. (a) The measurement of shoot
sodium contents in WT and TG plants propagated and grown in sand under normal
conditions and 200 mM NaCl treatment. (b) The K+/Na+ ratio measured from the WT and
TG shoots propagated and grown in sand under normal conditions and 200 mM NaCl
treatment. (c) The measurement of shoot sodium contents in WT and TG plants
propagated and grown in soil under normal conditions and 200 mM NaCl treatment. (d)
The K+/Na+ ratio measured from the WT and TG shoots propagated and grown in soil
under 200 mM NaCl treatment. Statistical analysis of shoot sodium content and the
K+/Na+ ratio was conducted on WT control plants and various transgenic lines. Data are
presented as means ± SE, and error bars represent standard error. Asterisk * indicates a
significant difference between transgenic and control plants at P < 0.05 by Student’s ttest using JMP 9.0.0.
and consequently reduced Na+ toxicity to plant cells. Interestingly, Osa-miR319a plants
appeared to accumulate more K+than wild-typecontrols in both normal and salinity
conditions, especially when plants were grown in soil (presented as K+:Na+ ratio in
118
Figure 3.5b, d). The discrepancy in significance level for K+uptake in plants grown in
sand and soil might be attributed to the characteristics of potting mixture soil used for
plant maintenance. The soil itself might be rich in nutrients, facilitating plant uptake of
ions. Transgenic plants overexpressing Osa-miR319a might have improved ion transport,
therefore accumulating more potassium. It should be noted that the accumulation of
phosphate, calcium and magnesium was also higher in Osa-miR319a plants than in the
controls without Osa-miR319a gene when plants were propagated in the soil and applied
with 200 mM salinity stress (data not shown). The enhanced K+:Na+ discrimination has
been reported to be strongly associated with greater salt tolerance (Asch et al., 2000;
Munns et al., 2000; Colmer et al., 2006; Møller et al., 2009). The higher K+:Na+ ratio
observed in OsmiR319a plants (Figure 3.5d) provides additional evidence supporting
improved salt tolerance in transgenic plants overexpressing OsmiR319a.
Overexpression of miR319 results in enhanced drought tolerance in
transgenic creeping bentgrass plants associated with enhanced water retention, less
cell membrane damage and well-maintained photosynthesis
To study whether overexpression of miR319 impacts plant response to water
stress, we examined both control and Osa-miR319a transgenic plants subjected to
drought stress. As demonstrated in Figure 3.6, after 15 days of water withholding, control
plants without Osa-miR319a started to display obvious dehydration symptoms, such as
loss of turgor and wilting, whereas Osa-miR319a transgenic plants remained largely
turgid without obvious damage. After 20 days of water withholding, control plants had a
large area of yellow and wilted leaves, However, more percentage of leaves in
119
transgenics remained green and turgid (Figure 3.6). Osa-miR319a and control plants were
also examined when subjected to limited water supply treatment. As exemplified in
Figure 3.7a, the Osa-miR319a plants exhibited greatergrowth under stressed condition,
whereas the control plants were completely arrested
displayed severely disturbed
morphology with shortened and deformed leaves and stems (Figure 3.7a, c and Figure
A1). Although the tiller number of control plants was still higher than that of OsamiR319a transgenics (Figure 3.7b), the shoot biomass of control plants was significantly
lower than that of Osa-miR319a transgenics (Figure 3.7d) in contrast with the results
obtained under normal growth conditions (Figure 3.3c). In addition, contrary to the
observation under normal growth conditions that Osa-miR319a plants had less root
growth than controls (Figure 3.3a, d), no significant difference in root biomass was
observed between them under water deficit, indicating that root development in OsamiR319a plants was less impacted by the stress than that in controls (Figure 3.7a, e).
120
Figure 3.6 Response of WT and TG plants to drought stress. The fully developed WT
and TG plants clonally propagated from individual tiller were grown in big pots (33×
44.7 cm) and subjected to complete water withholding. The image showed the
performance of WT and two independent transgenic lines 15 days, 16 days and 20 days
after water stress.
121
Figure 3.7 Tillering and plant development of WT and TG plants under the drought
stress for 60 days after 30 days normal development starting from a single tiller. (a)
Tillering and plant growth in WT and TG plants developed from a single tiller of the
same size for 30 days, then subjected to 60 days of water stress (limited water supply) (b)
The statistical analysis of tiller numbers in WT and TG plants counted 60 days after the
application of limited water supply. (c) Length of the longest stem of WT and TG plants.
(d) Biomass of WT and TG shoots weighed 60 days after the the initiation of drought
stress. (e) Biomass of WT and TG roots weighed 60 days after the initiation of drought
stress. Statistical analysis of tiller number, shoot and root biomass was conducted on WT
control plants and various transgenic lines. Data are presented as means ± SE, and error
bars represent standard errors. Asterisks *** indicates a significant difference between
transgenic and control plants at P < 0.001 by Student’s t-test using JMP 9.0.0.
Further investigation of plant water status and cell membrane integrity revealed
that both control and Osa-miR319a transgenics displayed similar relative water content
under normal growth condition, whereas under dehydration stress, water loss in OsamiR319a plants was significantly less than that in control plants without Osa-miR319a
(Figure 3.8a) and the cell membrane damage elicited by drought stress was significantly
less severe in Osa-miR319a plants than that in controls without Osa-miR319a (Figure
3.8b), suggesting an enhanced water retention capacity and cell membrane integrity in
122
transgenic plants expressing Osa-miR319a.
Figure 3.8 Leaf relative water content (RWC) and leaf electrolyte leakage (EL) of WT
and TG plants under normal and drought stress conditions. (a) Leaf RWC of WT and TG
plants 20 days after water withholding. (b) Leaf EL of WT and TG plants 20 days after
water withholding. Statistical analysis of RWC and EL was conducted on WT control
plants and the two transgenic lines. Data are presented as means ± SE, and error bars
represent standard error. Asterisk * indicates a significant difference between transgenic
and control plants at P < 0.05 by Student’s t-test using JMP 9.0.0.
Photosynthesis is one of the primary processes affected when plants are subjected
to environmental stress (Munns et al., 2006; Chaves et al., 2009). An increase in stomatal
123
conductance and the maintenance of photosynthesis have been demonstrated to be
positively correlated to plant performance under stress (Nelson et al., 2007). Our study on
Osa-miR319a transgenic and control plants revealed that under normal growth conditions,
there were no significant differences between Osa-miR319a and control plants in
photosynthesis rate and stomatal conductance (Figure 3.9a, b). However, when subjected
to drought stress (5 days of water withholding), Osa-miR319a transgenic plants displayed
higher stomatal conductance and higher photosynthesis rate than control plants without
Osa-miR319a gene (Figure 3.9a, b).
Figure 3.9 Photosynthetic characteristics of WT and a representative Osa-miR319a TG
line (TG-1) measured under normal growth conditions and 5 days after dehydration stress.
(a). Net photosynthetic rate (b) Stomatal conductance. Data are presented as means ± SE,
and error bars represent standard errors. Asterisk * indicates a significant difference
between transgenic and control plants at P < 0.05 by Student’s t-test using JMP 9.0.0.
124
Overexpression of miR319 results in increased leaf weight:area ratio and
higher accumulation of total wax coverage in transgenic creeping bentgrass plants
Plants adapted to dry and saline soil possess a common feature, i.e., their leaves
have a higher weight:area ratio (Munns, 2005). Although osa-miR319a plants were not
significantly different from controls without osa-miR319a in shoot biomass (Figure 3.3a,
c, d), they exhibited drastically reduced tillering (Figure 3.3a, b), increased leaf
expansion (Figures 3.2a-d) and leaf thickness (Figure 3.2f, g). This may lead to change in
plant weight to surface area ratio. Indeed, compared to control plants without osamiR319a, osa-miR319a transgenic plants displayed an increased weight:area ratio (Figure
3.10a).
Wax coverage on the leaf cuticle is positively correlated with plant performance
under dehydration condition. When subjected to drought stress, plants may be triggered
for increased wax production as one of the avoidance mechanisms to keep water from
loss (Kosma et al., 2009). To investigate whether miR319 overexpression impacts leaf
epicuticle wax content in transgenic plants, we conducted gas chromatography analysis of
leaf cuticles from both transgenic and control plants grown under normal conditions.
Although wax accumulation per unit weight in the Osa-miR319a transgenic plants (2083
μg/g) was not significantly higher than that in controls (1919 μg/g), the total leaf wax
coverage per unit surface area in Osa-miR319a transgenics was significantly higher than
that in control plants without osa-miR319a (Figure 3.10b). It should be noted that wax
composition is highly species-specific. There has been no report on the composition of
wax in creeping bentgrass so far. The identity of a couple of components detected
125
remains to be determined.
The changes in physical parameters, such as weight:area ratio and leaf wax
content resulting from the overexpression of miR319 in transgenic plants might
contribute to better plant adapdationto physiological water deficit elicited by drought or
salinity (Kosma et al., 2009; Zhou et al., 2009).
Figure 3.10 Measurement of leaf weight/area ratio and total leaf cuticle wax coverage
in WT and a representative Osa-miR319a TG line (TG-1). (a) The leaf weight/area ratio
(mg/cm2) of WT and TG plants grown under normal conditions. (b) The total leaf cuticle
wax coverage of WT and TG plants. Data are presented as means ± SE, and error bars
represent standard error. Asterisk * indicates a significant difference between
transgenic and control plants at P < 0.05 by Student’s t-test using JMP 9.0.0..
Expression of at least four putative miR319 target genes were downregulated in the Osa-miR319a transgenic creeping bentgrass plants
MiRNAs exert their effects through regulating the expression of target genes. To
investigate molecular mechanism of miR319-mediated alterations in plant development
and plant response to environmental stress, we sought to search for putative miR319
126
target genes in plants for further characterization. Bioinformatics analysis of the rice
genome sequence allowed identification of 5 putative miR319 target genes, OsPCF5,
OsPCF6, OsPCF7, OsPCF8 and OsTCP14 (Li et al., unpublished data) all belonging to
TCP gene family of plant-specific transcription factors (Palatnik et al., 2003; Schommer
et al., 2008). Based on sequence information of these five putative miR319 target genes
in rice, we designed primers and partially amplified and cloned the corresponding
creeping bentgrass homologues, AsPCF5, AsPCF6, AsPCF7, AsPCF8 and AsTCP14 and
identified the highly complementary putative target sites (Figure 3.11 and Figure A.2).
Semi-quantitative and real-time RT-PCR analyses demonstrated that the expression of the
four putative miR319 target genes AsPCF5, AsPCF6, AsPCF8 and AsPCF14 were all
down-regulated in both leaves and roots of the Osa-miR319a transgenic creeping
bentgrass plants (Figure 3.12a, b). Although the semi-quantitative might indicate that
AsPCF7 was also down-regulated (Figure 3.12a), we failed to amplify this gene by realtime RT-PCR and further experimental proof is still required for confirmation.
These results indicated negative regulation of the target genes by miR319 and
they suggested the potential direct involvement of these target genes in altering plant
development and plant response to environmental stresses.
127
Figure 3.11 Comparison of target sites in the 5 putative miR319 target genes in rice
and creeping bentgrass with the mature sequence of Osa-miR319. The complementary
sequence of the mature Osa-miR319 was used to facilitate comparison.
128
Figure 3.12 Expression levels of the 5 putative miR319 target genes in WT and TG
plants. (a) Semi-quantitative RT-PCR analysis of the expression levels of the 5 putative
miR319 target genes in WT and TG leaves. (b) Real-time RT-PCR analysis of the
expression levels of the 5 putative miR319 target genes in WT leaves and TG leaves. (c)
Real-time RT-PCR analysis of the expression levels of the 5 putative miR319 target
genes in WT and TG roots. ΔΔCt method was used for real-time RT-PCR analysis. Three
biological replicates and three technical replicates for each biological replicate were used
for data analysis. ACTIN was used as the endogenous control. Error bars indicate ±SE
(n=9)
The impact of miR319 on the expression of other stress-related genes
To examine how other stress-related genes are affected in Osa-miR319a
transgenic plants, we studied the transcription factor gene AsNAC60, a homolog of the
rice NAC-like gene ONAC60 whose expression has been shown to be dramatically
impacted by overexpression of Osa-miR319 (Li et al., unpublished data). Moreover,
ONAC60 is the target gene of miR164 in rice (Wu et al., 2009), and in Aradbidopsis,
TCPs positively regulate miR164 (Rubio-Somoza and Weigel, 2010). Partial sequences of
129
AsNAC60 were cloned from creeping bentgrass and found to be highly homologous to
ONAC60 (Figure A.6). Semi-quantitative and real-time RT-PCR analyses demonstrated
that AsNAC60 expression was down-regulated in Osa-miR319a transgenic creeping
bentgrass plants in both leaves and roots (Figure 3.13a and b).
Figure 3.13 Expression levels of AsNAC60 in WT and TG plant leaves and roots. (a)
Semi-quantitative RT-PCR analysis of AsNAC60 expression in WT and TG leaves. (b)
Real-time RT-PCR analysis of AsNAC60 expression inWT and TG roots. ΔΔCt method
was used for real-time RT-PCR analysis. Three biological replicates and three technical
replicates for each biological replicate were used for data analysis. ACTIN was used as
the endogenous control. Error bars indicate ±SE (n=9).
130
Expression of miR319 target genes alters in response to salt and drought
To investigate whether the five putative miR319 target genes are directly involved
in the miR319-mediated plant response to abiotic stress, we first examined expression
levels of these genes in wild-type creeping bentgrass plants treated with 200 mM NaCl.
Semi-quantitative analyses suggested a significant increase in the accumulation of the AsPCF5 transcript upon salinity stress (Figure 3.14a). Real-time RT-PCR results agreed
with the trend but only had two-fold difference at 0.5 h after exposure to NaCl (Figure
3.14b). At 6h time point, the expression level of As-PCF5 decreased demonstrated by
both semi-quantitative RT-PCR and real-time RT-PCR (Figure 3.14a, b). Although the
expression of other putative target genes was not significantly changed in response to
salinity stress demonstrated by end-point PCR and gel-based assay (Figure 3.14a), realtime RT-PCR analysis suggested a trend of upregulation of three putative target genes
AsPCF6 (1.16 fold), AsPCF8 (1.56 fold) and AsTCP14 (3.79 fold) at 6h after exposure to
salt stress but not statistically significant (Figure 3.14b).
131
Figure 3.14 Expression pattern of putative miR319 target genes in WT plants under 200
mM NaCl treatment. (a) Semi-quantitative RT-PCR analysis of 5 putative miR319 targets
in WT plant leaves 0h, 0.5h and 6h after salt stress. (b) Real-time RT-PCR analysis of
AsPCF5 gene expression after exposure to salt stress. (c) Real-time RT-PCR analysis of
AsPCF6 gene expression after exposure to salt stress. (d) Real-time RT-PCR analysis of
AsPCF8 gene expression level after exposure to salt stress. (e) Real-time RT-PCR
analysis of AsTCP14 gene expression level on three time points after exposure to
dehydration stress. ΔΔCt method was used for real-time RT-PCR analsysis. ACTIN was
used as the endogenous control. Error bars indicate ±SE (n=3 technical replicates).
To further explore the turf TCP gene activities in dehydration stress response, the
wild-type plants were taken out from pots and put on filter paper for desiccation
treatment. Samples were collected 2.5h and 6h later. Semi-quantitative RT-PCR results
suggested that AsPCF6, AsPCF8 and AsTCP14 were all upregulated after 2.5h exposure
to desiccation stress. Real-time RT-PCR results agreed with the trend at 2.5h but not
significantly different from expression level at 0h. However, after 6-hour desiccation, the
expressions of these three genes were all upregulated (Figure 3.15 c-d).
132
Figure 3.15
Time course expression pattern of putative miR319 targets under
dehydration treatment. (a) Semi-quantitative RT-PCR analysis of 5 putative miR319
targets in WT plant leaves on 3 time points 0h, 0.5h and 6h after applying dehydration
stress. (b) Real-time RT-PCR analysis of AsPCF5 gene expression level on three time
points after exposure to dehydration stress (b) Real-time RT-PCR analysis of AsPCF6
gene expression level on three time points after exposure to dehydration stress. (c) Realtime RT-PCR analysis of AsPCF8 gene expression level on three time points after
exposure to dehydration stress. (b) Real-time RT-PCR analysis of AsTCP14 gene
expression level on three time points after exposure to dehydration stress. ΔΔCt method
was used for real-time RT-PCR analsysis. ACTIN was used as the endogenous control.
Error bars indicate ±SE (n=3 technical replicates).
The expression level of AsNAC60 change upon 200 mM NaCl was also analyzed.
Semi-quantitative RT-PCR demonstrated a significant increase of AsNAC60 expression
level at time point 0.5h and also a significant decrease at time point 6h (Figure 3.16a).
Real-time RT-PCR data agreed with the trend and have 2.5 fold change at 0.5h point and
1.67 fold change at 6h point (Figure 3.16b).
133
Figure 3.16 Time course expression pattern of AsNAC60 under 200 mM NaCl treatment.
(a) Semi-quantitative RT-PCR analysis of AsNAC60 in WT plant leaves on three time
points 0h, 0.5h and 6h after treatment of 200 mM NaCl. (b) Real-time RT-PCR analysis
of AsNAC60 in WT plant leaves on three time points 0h, 0.5h and 6h after treatment of
200 mM NaCl. ΔΔCt method was used for real-time RT-PCR analysis. ACTIN was used
as the endogenous control. Error bars indicate ±SE (n=3 technical replicates).
Discussion
Leaf shape and plant abiotic stress tolerance
Leaves are very important plant organs responsible for trapping solar energy
through photosynthesis for plant growth and development (Tsukaya, 2005). The
transgenic turfgrass plants overexpressing Osa-miR319a exhibit wider and thicker leaves,
bigger stems, less tillering, increased weigt:area ratio and increased total leaf cuticle wax
coverage, of which thicker leaves, increased weight:area ratio and increased total wax
coverage are thought to be positively correlated with plant abiotic stress tolerance
(Bondada et al., 1996; Zhang et al., 2005; Zhou et al., 2009), whereas leaf width is
thought to be negatively correlated with plant abiotic stress tolerance (Deák et al., 2011)
134
due to the increased transpiration area. Despite the observation that leaf width frequently
correlates with plant abiotic stress response, the underlying physiological mechanisms
remain largely unknown.
A recent study showed that a rice mutant with a defected zinc finger transcription
factor, DST (Drought and Salt Tolerance), had remarkably wider leaves than wild-type
control plants. However, the dst mutant plants exhibited significantly enhanced tolerance
to drought and salinity stress than the controls. The dst mutant plants also had lower
stomata density and less stomata aperture than controls, thus reducing water loss and
maintaining higher water content. Moreover, sodium uptake of the dst mutants was
significantly less than that in the wild-type control plants when subjected to 100 mM
NaCl treatment. The introduction of a wild-type genomic DNA fragment of DST into the
dst mutant restores the wild-type phenotype, i.e. narrow leaves and sensitivity to drought
and salt stress (Huang et al., 2009).
In the present study, although the transgenic turfgrass plants overexpressing OsamiR319a exhibited wider leaves than wild-type controls, no significant difference in
stomata opening (Figure A3), stomata conductance (Figure 3.9) and stomata density
(Figure A3), was observed between the Osa-miR319a transgenic and wild-type control
plants. However, the Osa-miR319a transgenic plants had thicker leaves, increased
weight:area ratio, increased wax contents, which most likely helped reduce water loss,
thus contributing to the enhanced plant resistance to drought stress. Although wider
leaves are more likely to be beneficial for plant photosynthesis and thinner leaves would
be more efficient in gas exchange (O2, CO2 and H2O) (Tsukaya, 2005), thus desirable for
135
photosynthesis too, these two features are less desirable for plant response to water stress.
However, other characteristics of leaves such as, stomatal density, stomatal aperture,
increased weight:area ratio and increased wax contents may override the cost of increased
leaf width and thickness. Thus, like the dst mutant plants, the better adaption of the OsamiR319a transgenic plants to abiotic stress might be a result of good balance of the costs,
benefits and associated trade-offs for each morphological trait.
As reported in the dst mutant (Huang et al., 2009), sodium uptake of the OsamiR319a transgenic plants was also significantly less than that in the wild-type controls
when subjected to salinity stress, indicating the important role salt exclusion mechanism
may play in plant salinity resistance. Although our data suggest the possible involvement
of some of the putative miR319 target genes in plant response to both drought and salt
stress (see more discuss later), further study investigating molecular mechanisms
underlying miR319-mediated plant resistance to abiotic stress will shed light on how
plants cope with adverse environmental conditions through coordinated function of
various regulatory networks.
It was also observed that the morphology of creeping bentgrass is highly
associated with environmental conditions and has developmental and morphology
plasticity. Thus, normalizing the environmental conditions for control and transgenic
plants are very important. The data we presented (Figure 3.2) were all obtained from
measuring plants propagated in sand and subjected to regular trimming. If plantswere
grown in soil and subjected to less trimming, the leaf width of fully developed control
leaves could achieve an average of 4 mm and that of transgenics could reach an average
136
of 4.7 mm. Although the absolute value could vary, transgenic leaves overexpressing rice
miR319 were wider than control plants as long as their environmental conditions were
same.
The root architecture and plant abiotic stress tolerance
As one of the very first plant organs that sense many environmental changes, root
system plays an important role in plant response to abiotic stress. In many circumstances,
enhancing soil exploitation through more robust root system with increased root length or
root biomass have been considered as a positive feature under drought conditions (de
Dorlodot et al., 2007; Tardieu, 2011). For example, in fields with deep soil, increased root
biomass and length would make plants reach to deeper soil layer and explore wider soil
area thus more water and nutrient uptake (Javaux et al., 2008; Schroder et al., 2008;
Tardieu, 2011). However, new plant cultivars with enhanced drought tolerance generated
in several breeding programs exhibited decreased root biomass (Bolaños and Edmeades,
1993; Bruce et al., 2002; Campos et al., 2004; Tardieu, 2011). When grown in relatively
poor conditions with limited soil depth it makes sense for plants to invest photosynthetic
products to other sinks rather than roots. Under such circumstances, enhanced root
biomass or length may not be the key factors impacting plant water uptake. Data from the
current research show that the Osa-miR319a TG plants display less robust root system,
but normal shoot growth compared to controls under normal conditions (Figure 3.3).
However, when subjected to water stress, TG plants maintain their growth in both shoot
and root, displaying less stress-elicited impact (Figure 3.7). This suggests that under
137
normal conditions, Osa-miR319a TG plants mainly invest photosynthetic products to the
above-ground shoot development, but distribute more for root development while still
keep enough ensuring leaf growth under stress conditions. To some extent, it is an
effective strategy for perennial grasses to keep enough photosynthesizing leaves gaining
opportunity to enter a state akin to dormancy hence surviving the stress (Munns, 2005).
It has also been argued that besides other factors that contribute to plant response
to water stress, plant root capacity in water uptake is determined by root spatial
distribution rather than root biomass or length even when plants are grown in better field
conditions with deep soil layers (Tardieu et al., 1992; Manschadi et al., 2006; Manschadi
et al., 2008; Tardieu, 2011). Thus, it is not surprising to observe that with a less robust
root system than wild-type controls, the Osa-miR319a TG creeping bentgrass plants still
perform better under drought stress. Further study analyzing both the Osa-miR319a TG
and control plants grown in the field under normal and stress conditions for their root
spatial distribution would provide information for a better understanding of the
physiological mechanisms of miR319-mediated morphological change in roots and its
impact on plant response to environmental stress.
Leaf senescence and abiotic stress tolerance
In some cases, early leaf senescence is thought to serve as one of the stress
avoidance mechanisms induced to avoid cellular stresses by decreasing water demand
(Tardieu, 1996, 2011). Younger leaves are conserved under stress by sacrificing older
leaves (Munné-Bosch and Alegre, 2004; Munns, 2005). On the other hand, senescence is
138
also assumed to serve as a type of cell death program that could be induced during
drought and salinity which impose negative effects to plants. Suppression of this kind of
induced leaf senescence would make plants maintain higher water contents and better
photosynthetic activity during the stress (Lutts et al., 1996; Rivero et al., 2007).
In the present study, when WT plants started to display the symptoms elicited by
sodium toxicity 5 days after 200 mM NaCl treatment, TG plants did not show any typical
salinity stress-elicited symptoms (wilting and loss of cell turgor) as observed in WT
controls, but appeared to show slight senescence symptom earlier than WT controls
(Figure A4). However, the progression of leaf senescence in TG plants was much slower
than that in WT plants (Figure 3.4). Considering that miR319 has been reported to
positively regulate plant leaf senescence through jasmonic acid (JA) biosynthesis
pathway (Schommer et al., 2008), it is hypothesized that overexpression of miR319 in
transgenic creeping bentgrass impaired the function of the miR319 target, TCP, leading to
less accumulation of JA and consequently, the delay of leaf senescence in general.
However, this hypothesis cannot explain the earlier leaf senescence that appeared to take
place in the TG plants. As JA is not the only pathway which regulates senescence
(Schommer et al., 2008), it is likely that some other factors triggered by miR319
overexpression may be involved, contributing to this particular response in transgenic
plants. Another possibility would be that better sodium exclusion in the TG plants (Figure
5) may contribute to its delayed leaf senescence in the long and slower ionic phase
minimizing the sodium toxicity.
139
Extreme stress response by WT and TG turfgrass plants
In response to adverse environmental conditions, turfgrass also develops escape
mechanism fighting against drought and salt stress. When subjected to extremely harsh
conditions, turfgrass leaves become desiccated and the whole plant growth is arrested.
The above-ground parts suffer the most and usually all die. However, the crowns, stolons,
or rhizomes are mostly likely to stay alive. When released from the stressed condition,
the “dormant” turfgrass can regenerate new shoots and roots and revive again (McCann,
2008). The difference in plant recovery from this “dormancy” between WT and the OsamiR319a TG creeping bentgrass plants are significant and can be demonstrated by Figure
A5. After exposure to 300 mM NaCl for 12 days, both WT and TG plants exhibited
growth arrest and the shoots were all dead. However, when released from the salt
treatment and maintained by regular irrigation, the Osa-miR319a TG plants recovered
much more quickly than WT controls (Figure A5a). Similarly, when subjected to water
deficiency, both WT and the Osa-miR319a TG plants lost cell turgor and exhibited plant
damages 6 days after total desiccation stress. However, after 9-day recovery, the OsamiR319a TG plants quickly recovered and started growing, whereas the WT controls
barely survived the damages (Figure A5b).
Molecular basis of salt exclusion mechanisms in the Osa-miR319a TG plants
Our results demonstrated that the Osa-miR319a TG plants accumulated less Na+
than the controls (Figure 3.5). The low Na+ accumulation in transgenic plants should lead
to less cell damage and might contribute to the enhanced salt tolerance observed in
140
transgenic plants. However, the salt exclusion mechanism in creeping bentgrass remains
unknown. In wheat, it has been demonstrated that low and high Na+ accumulation is
controlled by two major genes Nax1 and Nax2. Nax1 was located in chromosome 2A
(Lindsay et al., 2004) and was identified as a Na+ transporter of HKT family, HKT7
(orthologue HKT1;4 in Triticum monococcum) (Huang et al., 2006). Nax2 was located in
chromosome 5A and was identified as HKT8 (orthologue HKT1;5 in rice) (Byrt et al.,
2007). It is deduced that Nax1 correlated with the loading of Na+ in the xylem in the roots,
while Nax2 correlates with the relocation of Na+ in the upper parts of plants (Munns and
James, 2003; Munns, 2005). Genetic engineering of salt exclusion mechanism by tissuespecific overexpression of a Na+ transporter HKT1;1 in Arabidopsis reduced 37% to 64%
Na+ accumulation in the shoots (Møller et al., 2009). However, the detailed mechanism of
how HKT transporters mediate the sodium management is still unknown. In transgenic
rice plants overexpression miR319, the Na+ transporter gene OsHKT2 was also found to
be highly up-regulated (Li et al, unpublished). In the current study, we observed that
some of the putative miR319 target genes were up-regulated upon salt stress (Figure
3.14). It is likely that these target genes are involved in plant response to salt stress via
participation in controlling various downstream biological pathways, including Na+
transporter production. This can be further supported by the salt-induced up-regulation of
AsNAC60, a stress-responsive rice homolog gene that is not a miR319 target (Figure
3.13). Modification of miR319 expression interferes this regulatory network, leading to
enhanced salt resistance phenotype in transgenic plants. Further characterization of the
miR319 target genes will provide information for a better understanding of the molecular
141
mechanism underlying miR319-mediated plant resistance to salt stress. Additionally, our
data also demonstrated the possible involvement of the putative miR319 target genes in
plant response to drought stress (Figure 3.15). Studies of the stress-responsive miR319
targets would also elucidate molecular mechanism determining plant response to drought
stress.
142
Experimental Procedures
Cloning of Osa-miR319a gene and construction of the plant expression
vectors
The
pre-miR319a
sequence
obtained
from
miRBase
(version
13.0c,
http://microrna.sanger.ac.uk/sequences/) was used to search against the rice full length
cDNA database (Kome, http://cdna01.dna.affrc.go.jp/cDNA/) and a full-length cDNA
clone AK064418 corresponding to the pri-miR319a sequence was identified. In rice
genome, the AK064418 corresponds to Os01g0659400, which encodes rice miR319a
gene
(Osa-miR319a).
Gene
specific
primers
and
TCTAGAAGAGCCATGGCATTGCT-3’)
Os-miR319aFL_XbaIF
Osa-miR319aFL_SalIR
(5’(5’-
GTCGACGCAAAAGAAAAAATACTACATGATTG-3’) were used to clone the
fragment containing the stem-loop structure from the full length cDNA of Osa-mir319a.
Upon double digestion by XbaI and SalI, the PCR product was cloned to the binary
vector pZH01 (Xiao et al., 2003), producing the chimera construct p35S-OsamiR319aFL/p35S-hyg. The construct contains the CaMV35S promoter driving the OsamiR319aFL and the 35S promoter driving the hyg gene for hygromycin resistance as a
selectable marker. The construct was transferred into Agrobacterium tumefaciens strain
LBA4404 by electroporation for subsequent plant transformation.
Plant materials and transformation
A commercial genotype of creeping bentgrass (A. stoloniferal L.) Penn A-4 was
used for transformation in this study. Transgenic (TG) creeping bentgrass overexpressing
143
Osa-miR319a were produced using Agrobacterium-mediated transformation of
embryogenic callus initiated from mature seeds as previously described (Luo et al., 2004).
The regenerated plants were transferred to commercial potting mixture soil (Fafard 3-B
Mix, Fafard Inc., Anderson, SC, USA) in the greenhouse under a 16h photoperiod with
supplemented lighting at 27oC in the light and 25oC in the dark.
Plant propagation, maintenance, and abiotic stress treatments
General procedures of conducting plant propagation, maintenance, and abiotic
stress treatments were developed based on a previous protocol (Li et al. 2010). The OsamiR319a TG plants as well as control plants (untransformed plants either derived from
seeds or regenerated from tissue culture and transgenic lines harboring other expression
vectors without Os-miR319a) maintained in greenhouse were transferred to a growth
room at a 14h photoperiod for propagation. Both TG and control plants were clonally
propagated from tillers and grown in small cone-tainers (4.0×20.3 cm, Dillen Products,
Middlefield, OH, USA), middle pots (15×10.5 cm, Dillen Products, Middlefield, OH,
USA) and big pots (33 ×44.7 cm Dillen Products, Middlefield, OH, USA ) using pure
silica sand. In order to achieve uniform plant growth, the grass shoots were clipped
weekly. Illumination in growth room was 350-450μmol m-2 s-1 provided by AgroSun
Gold 1000 W sodium/ halide lamps (Maryland Hydroponics, Laurel, MD, USA).
Temperatures and humidity were maintained at 25oC and 30% in the day time and 17 oC
and 60% at night. Plants were irrigated every other day with 200 ppm of water-soluble
fertilizer [20-10-20 (N-P-K), Peat-Lite Special; The Scotts Company, Marysville, OH,
144
USA].
For plants grown in cone-tainers, the salinity treatment was conducted by
injecting 10 ml 200 mM NaCl supplemented with 200 ppm 20-10-20 (N-P-K) fertilizer
twice every day. For plants grown in the middle pots, the salinity treatment were
conducted by immersing the whole pots in 1L of 0mM or 200 mM NaCl supplemented
with 200 ppm 20-10-20 (N-P-K) fertilizer and changing solution every day. The grass
shoots were harvested 12 days later, and used for measuring mineral contents and other
analyses. To investigate plant recovery from salt stress, the plants were watered with 200
ppm fertilizer described above. The progress of recovery was documented by photograph.
For drought treatments, we either completely withheld watering or provided
limited water supply to plants (10ml water for each plant every two days).
For measuring leaf net photosynthesis rate and stomatal conductance, plants were
propagated and maintained in nutrient rich soil Fafard 3-B Mix without trimming to
achieve maximum leaf growth to facilitate measurements.
Plant DNA isolation
Plant genomic DNA was extracted as previously described using the cetyltrimethyl
ammonium bromide (CTAB) method (Luo et al., 2005).
RNA isolation and cDNA synthesis
Total RNA was isolated from the leaves and roots of the TG and control plants
using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s
145
instructions. DNase-treated total RNA was reverse transcribed using Super Script III
Reverse Transcriptase (Invitrogen, Carlsbad, CA) following the manufacturer’s
instructions.
Stem-loop reverse transcription and real-time RT-PCR analysis
Stem-loop reverse transcription was preformed following the protocol of
Varkonyi-Gasic et al. (Varkonyi-Gasic et al., 2007). The sequences of the Osa-miR319a
stem-loop
RT
primer
and
the
Osa-miR319
forward
primer
were
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACGGGAGC and
CGGCGGTTGGACTGAAGGGT. Based on DNA sequences of the PCR products we
cloned, real-time RT-PCR primers were designed using Primer3 software. Each PCR
reaction contained 12.5 μl iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules,
CA). The reaction was performed using the Bio-Rad iQ5 Real-time detection system
(Bio-Rad Laboratories, Hercules, CA). The iQ5 Optical System Software V.2.0 (Bio-Rad
Laboratories, Hercules, CA) was used to collect the fluorescence data. Two reference
genes AsACT1 and AsUBQ5 were used as endogenous controls in analyzing the gene
expression level in WT and TG plants (Figure 3.12 and Figure 3.13). AsACT1 was used
as endogenous control in analyzing the TCP gene expression level change upon stress
(Figure 3.14, Figure 3.15 and Figure 3.16). The ΔΔCt method was used for real-time
PCR analysis. ΔCt values were calculated by first normalizing Ct values to the
endogenous control, and subsequently calculating ΔΔCt values using the ΔCt value of 0
hour as a reference. Relative expression level was calculated using the 2-ΔΔCt formula.
146
Measurement of mineral contents
After salt treatment, plant leaf samples were collected to determine the sodium
content. All the above ground shoots of the creeping bentgrass plants were rinsed in
Millipore (Billerica, MA, USA) water for 30 s. The shoots were dried for 48h at 80oC,
and the dry weights (DWs) were measured. The sodium contents were determined using
Spectro ARCOS ICP (Spectro, Mahwah, NJ, USA) in Clemson University Agricultural
Service Laboratory following protocols by Haynes (1980) and Plank (1992).
Measurement of leaf relative water content (RWC)
The leaves from both the WT and TG plants were harvested and immediately
weighed (Fresh Weight, abbreviated as FW). They were then immersed in Millipore water
at 4oC for 16h, and then weighed (Turgid Weight, abbreviated as TW). After measuring
the TW, the leaves were dried at 80oC for 24h, and weighed (Dry Weight, abbreviated as
DW). Leaf RWC was calculated using the following formula: RWC=[(FW-DW)/(TW-DW)]
×100% (Li et al. 2010).
Measurement of leaf electrolyte leakage (EL)
Leaf EL was measured to evaluate cell membrane integrity followed by a
previous protocol (Li et al. 2010). Fresh leaf samples (0.2-0.5g) were incubated in 20 ml
Millipore water at 4oC for 16h. The initial conductance (Ci) was measured using a
conductance meter (AB30, Fisher Scientific, Suwanee, GA, USA). Then the leaf tissue
147
with the incubation solution was autoclaved for 30 min. After cooling down on a shaker
with 24h incubation, the conductance of the incubation solution was determined again
(Cmax). Relative %EL was calculated as (Ci/Cmax)×100%. This analysis reflects the
percentage ions released from the plant cells, thus measuring the difference of the cell
membrane stability of TG and control plants under different conditions.
Leaf sections and microscopic analysis
Top third fully expanded leaves were collected and fixed in FAA, followed by
dehydration through graded ethanol, and infiltration in catalyzed resin (1.25g of benzoyl
peroxide/100 ml of immunobed monomer A). The samples were then embedded,
polymerized at room temperature and put in desiccator under vacuum till ready to block.
The pictures were taken using microscope (MEIJI EM-5) connected with a 35mm SLR
camera body (Canon).
Measurement of photosynthesis parameters
Single-leaf net photosynthesis rate was measured on at least 2 leaves from 3 pots
of plants respectively using a PLC-6 narrow leaf chamber connected to a CIRAS-2 (PP
Systems, Amesbury, MA, USA). Leaf chamber CO2 concentration was maintained
constantly at 375 μmol mol-1. Light intensity was controlled at 400 μmol m-2s-1 with the
LED light sources installed in the leaf chamber of the CIRAS-2 system. Leaf chamber
temperature was maintained equilibrium to the ambient temperature.
148
Cuticular wax analysis
Leaf wax composition measurement was conducted essentially after Kosma et al.
and Bethea et al. (Kosma et al., 2009; Bethea et al. unpublished). Leaves were submerged
in hexane for 45 s. Wax extracts were evaporated under N2 gas and derivatized by heating
at 100oC for 15 min in N,O-bis(trimethylsily) trifluoroacetamide (BSTFA; Supelco).
Silylated samples were analyzed by gas chromatography (GC). Quantification was based
on flame ionization detector (FID) peak areas relative to the internal standard tetrococine.
The total amount of cuticular wax was expressed as unit weight per unit of leaf
surface
area
(ug
cm-2).
Leaf
areas
were
determined
by ImageJ
software
(http://rsb.info.nih.gov/ij/) using digital images of flattened leaves.
Statistical analysis
Student’s t-test was used to analyze all the data to compare the obtained
parameters from TG and control plants under normal and stressed conditions. A p value
<0.05 was considered to be statistically significant.
Acknowledgements
We thank Dr. Halina Knap and Nancy Korn for help on sectioning, Dr Haibo Liu and
Frank Bethea for help in wax analysis, Dr. Guido Schnabel, Dr Chinfu Chen, Dr. William
R. Marcotte , Dr Julia Frugoli and Elise Schnabel for helpful discussion.
149
References
Asch, F., Dingkuhn, M., Dörffling, K., and Miezan, K. (2000). Leaf K/Na ratio
predicts salinity induced yield loss in irrigated rice. Euphytica 113, 109-118.
Axtell, M.J., and Bowman, J.L. (2008). Evolution of plant microRNAs and their
targets. Trends in plant science 13, 343-349.
Bolaños, J., and Edmeades, G. (1993). Eight cycles of selection for drought tolerance in
lowland tropical maize. II. Responses in reproductive behavior. Field Crops
Research 31, 253-268.
Bondada, B.R., Oosterhuis, D.M., Murphy, J.B., and Kim, K.S. (1996). Effect of
water stress on the epicuticular wax composition and ultrastructure of cotton
(Gossypium hirsutum L.) leaf, bract, and boll. Environmental and Experimental
Botany 36, 61-65, 67-69.
Bruce, W.B., Edmeades, G.O., and Barker, T.C. (2002). Molecular and physiological
approaches to maize improvement for drought tolerance. Journal of Experimental
Botany 53, 13-25.
Byrt, C.S., Platten, J.D., Spielmeyer, W., James, R.A., Lagudah, E.S., Dennis, E.S.,
Tester, M., and Munns, R. (2007). HKT1; 5-like cation transporters linked to
Na+ exclusion loci in wheat, Nax2 and Kna1. Plant Physiology 143, 1918-1928.
Campos, H., Cooper, M., Habben, J., Edmeades, G., and Schussler, J. (2004).
Improving drought tolerance in maize: a view from industry. Field Crops
Research 90, 19-34.
150
Capell, T., Bassie, L., and Christou, P. (2004). Modulation of the polyamine
biosynthetic pathway in transgenic rice confers tolerance to drought stress.
Proceedings of the National Academy of Sciences of the United States of America
101, 9909-9914
Chandra Babu, R., Zhang, J., Blum, A., David Ho, T.H., Wu, R., and Nguyen, H.T.
(2004). HVA1, a LEA gene from barley confers dehydration tolerance in
transgenic rice (Oryza sativa L.) via cell membrane protection. Plant Science 166,
855-862.
Chaves, M., Flexas, J., and Pinheiro, C. (2009). Photosynthesis under drought and salt
stress: regulation mechanisms from whole plant to cell. Annals of Botany 103,
551-560.
Colmer, T.D., Flowers, T.J., and Munns, R. (2006). Use of wild relatives to improve
salt tolerance in wheat. Journal of Experimental Botany 57, 1059-1078.
de Dorlodot, S., Forster, B., Pagčs, L., Price, A., Tuberosa, R., and Draye, X. (2007).
Root system architecture: opportunities and constraints for genetic improvement
of crops. Trends in plant science 12, 474-481.
Deák, C., Jäger, K., Fábián, A., Nagy, V., Albert, Z., Miskó, A., Barnabás, B., and
Papp, I. (2011). Investigation of physiological responses and leaf morphological
traits of wheat genotypes with contrasting drought stress tolerance. Acta
Biologica Szegediensis 55, 69-71.
151
Ding, D., Zhang, L., Wang, H., Liu, Z., Zhang, Z., and Zheng, Y. (2009). Differential
expression of miRNAs in response to salt stress in maize roots. Annals of Botany
103, 29-38.
Flowers, T. (2004). Improving crop salt tolerance. Journal of Experimental Botany 55,
307.
Fu, D., Huang, B., Xiao, Y., Muthukrishnan, S., and Liang, G. (2007).
Overexpression of barley hva1 gene in creeping bentgrass for improving drought
tolerance. Plant Cell Reports 26, 467-477.
Garg, A.K., Kim, J.K., Owens, T.G., Ranwala, A.P., Choi, Y.D., Kochian, L.V., and
Wu, R.J. (2002). Trehalose accumulation in rice plants confers high tolerance
levels to different abiotic stresses. Proceedings of the National Academy of
Sciences 99, 15898-15903.
Gaxiola, R.A., Li, J., Undurraga, S., Dang, L.M., Allen, G.J., Alper, S.L., and Fink,
G.R. (2001). Drought-and salt-tolerant plants result from overexpression of the
AVP1 H+-pump. Proceedings of the National Academy of Sciences 98, 1144411449.
Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q., and Xiong, L. (2006).
Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances
drought resistance and salt tolerance in rice. Proceedings of the National
Academy of Sciences 103, 12987-12992.
152
Huang, S., Spielmeyer, W., Lagudah, E.S., James, R.A., Platten, J.D., Dennis, E.S.,
and Munns, R. (2006). A sodium transporter (HKT7) is a candidate for Nax1, a
gene for salt tolerance in durum wheat. Plant Physiology 142, 1718-1727.
Huang, X.Y., Chao, D.Y., Gao, J.P., Zhu, M.Z., Shi, M., and Lin, H.X. (2009). A
previously unknown zinc finger protein, DST, regulates drought and salt tolerance
in rice via stomatal aperture control. Genes & Development 23, 1805-1817.
Javaux, M., Schroder, T., Vanderborght, J., and Vereecken, H. (2008). Use of a
three-dimensional detailed modeling approach for predicting root water uptake.
Vadose Zone Journal 7, 1079-1088.
Jones-Rhoades, M.W., and Bartel, D.P. (2004). Computational identification of plant
microRNAs and their targets, including a stress-induced miRNA. Molecular Cell
14, 787-799.
Jones-Rhoades, M.W., Bartel, D.P., and Bartel, B. (2006). MicroRNAs and their
regulatory roles in plants. Annual Review of Plant Biology. 57, 19-53.
Kosma, D.K., Bourdenx, B., Bernard, A., Parsons, E.P., Lü, S., Joubès, J., and
Jenks, M.A. (2009). The impact of water deficiency on leaf cuticle lipids of
Arabidopsis. Plant Physiology 151, 1918-1929.
Lauchli, A. (1984). Salt exclusion: an adaptation of legumes for crops and pastures under
saline conditions. In: Staples, R.C., and Toenniessen, G.A., editors. Salinity
Tolerance in Plants: Strategies for Crop Improvement. New York: 171-187.
153
Laurie, S., Feeney, K.A., Maathuis, F.J.M., Heard, P.J., Brown, S.J., and Leigh,
R.A. (2002). A role for HKT1 in sodium uptake by wheat roots. The Plant Journal
32, 139-149.
Lewis, R., Mendu, V., Mcnear, D., and Tang, G. (2009). Roles of MicroRNAs in Plant
Abiotic Stress. Molecular Techniques in Crop Improvement, 357-372.
Li, Z., Baldwin, C.M., Hu, Q., Liu, H., and Luo, H. (2010). Heterologous expression
of Arabidopsis H+-pyrophosphatase enhances salt tolerance in transgenic
creeping bentgrass (Agrostis stolonifera L.). Plant, Cell & Environment 33, 272289.
Lian, H.L., Yu, X., Ye, Q., Ding, X.S., Kitagawa, Y., Kwak, S.S., Su, W.A., and
Tang, Z.C. (2004). The role of aquaporin RWC3 in drought avoidance in rice.
Plant and Cell Physiology 45, 481-489.
Lindsay, M.P., Lagudah, E.S., Hare, R.A., and Munns, R. (2004). A locus for sodium
exclusion (Nax1), a trait for salt tolerance, mapped in durum wheat. Functional
Plant Biology 31, 1105-1114.
Liu, H.H., Tian, X., Li, Y.J., Wu, C.A., and Zheng, C.C. (2008). Microarray-based
analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA 14, 836843.
Lu, X.-Y., and Huang, X.-L. (2008). Plant miRNAs and abiotic stress responses.
Biochemical and Biophysical Research Communications 368, 458-462.
Luo, H., Hu, Q., Nelson, K., Longo, C., Kausch, A., Chandlee, J., Wipff, J., and
Fricker, C. (2004). Agrobacterium tumefaciens-mediated creeping bentgrass
154
(Agrostis stolonifera L.) transformation using phosphinothricin selection results in
a high frequency of single-copy transgene integration. Plant Cell Report. 22, 645652.
Luo, H., Kausch, A., Hu, Q., Nelson, K., Wipff, J., Fricker, C., Owen, T., Moreno,
M., Lee, J., and Hodges, T. (2005). Controlling transgene escape in GM
creeping bentgrass. Molecular Breeding. 16, 185-188.
Lutts, S., Kinet, J., and Bouharmont, J. (1996). NaCl-induced senescence in leaves of
rice (Oryza sativa L.) cultivars differing in salinity resistance. Annals of Botany
78, 389-398.
Manschadi, A.M., Christopher, J., and Hammer, G.L. (2006). The role of root
architectural traits in adaptation of wheat to water-limited environments.
Functional Plant Biology 33, 823-837.
Manschadi, A.M., Hammer, G.L., Christopher, J.T., and DeVoil, P. (2008).
Genotypic variation in seedling root architectural traits and implications for
drought adaptation in wheat (Triticum aestivum L.). Plant and Soil 303, 115-129.
Mazzucotelli, E., Mastrangelo, A.M., Crosatti, C., Guerra, D., Stanca, A.M., and
Cattivelli, L. (2008). Abiotic stress response in plants: When post-transcriptional
and post-translational regulations control transcription. Plant Science 174, 420431.
McCann, S.E. (2008). Water use and summer stress tolerance mechanisms for creeping
bentgrass and Kentucky bluegrass. Ph.D. dissertation, Rutgers University.
155
Møller, I.S., Gilliham, M., Jha, D., Mayo, G.M., Roy, S.J., Coates, J.C., Haseloff, J.,
and Tester, M. (2009). Shoot Na+ exclusion and increased salinity tolerance
engineered by cell type–specific alteration of Na+ transport in Arabidopsis. The
Plant Cell Online 21, 2163-2178.
Munné-Bosch, S., and Alegre, L. (2004). Die and let live: leaf senescence contributes to
plant survival under drought stress. Functional Plant Biology 31, 203-216.
Munns, R. (2002). Comparative physiology of salt and water stress. Plant, Cell &
Environment 25, 239-250.
Munns, R. (2005). Genes and salt tolerance: bringing them together. New Phytologist
167, 645-663.
Munns, R., and James, R.A. (2003). Screening methods for salinity tolerance: a case
study with tetraploid wheat. Plant and Soil 253, 201-218.
Munns, R., and Tester, M. (2008). Mechanisms of salinity tolerance. Annual Review of
Plant Biology 59, 651-681.
Munns, R., James, R.A., and Läuchli, A. (2006). Approaches to increasing the salt
tolerance of wheat and other cereals. Journal of Experimental Botany 57, 10251043.
Munns, R., Hare, R.A., James, R.A., and Rebetzke, G.J. (2000). Genetic variation for
improving the salt tolerance of durum wheat. Australian Journal of Agricultural
research 51, 69-74.
156
Munns, R., Rebetzke, G.J., Husain, S., James, R.A., and Hare, R.A. (2003). Genetic
control of sodium exclusion in durum wheat. Australian Journal of Agricultural
Research 54, 627-635.
Nag, A., King, S., and Jack, T. (2009). MiR319a targeting of TCP4 is critical for petal
growth and development in Arabidopsis. Proceedings of the National Academy of
Sciences 106, 22534-22539.
Nakashima, K., Ito, Y., and Yamaguchi-Shinozaki, K. (2009). Transcriptional
regulatory networks in response to abiotic stresses in Arabidopsis and grasses.
Plant Physiology 149, 88-95.
Nelson, D.E., Repetti, P.P., Adams, T.R., Creelman, R.A., Wu, J., Warner, D.C.,
Anstrom, D.C., Bensen, R.J., Castiglioni, P.P., and Donnarummo, M.G.
(2007). Plant nuclear factor Y (NF-Y) B subunits confer drought tolerance and
lead to improved corn yields on water-limited acres. Proceedings of the National
Academy of Sciences 104, 16450-16455.
Nelson, T., and Langdale, J.A. (1989). Patterns of leaf development in C4 plants. The
Plant Cell 1, 3-13.
Oh, S.J., Song, S.I., Kim, Y.S., Jang, H.J., Kim, S.Y., Kim, M., Kim, Y.K., Nahm,
B.H., and Kim, J.K. (2005). Arabidopsis CBF3/DREB1A and ABF3 in
transgenic rice increased tolerance to abiotic stress without stunting growth. Plant
Physiology 138, 341-351.
Ori, N., Cohen, A.R., Etzioni, A., Brand, A., Yanai, O., Shleizer, S., Menda, N.,
Amsellem, Z., Efroni, I., and Pekker, I. (2007). Regulation of LANCEOLATE
157
by miR319 is required for compound-leaf development in tomato. Nature genetics
39, 787-791.
Palatnik, J.F., Allen, E., Wu, X., Schommer, C., Schwab, R., Carrington, J.C., and
Weigel, D. (2003). Control of leaf morphogenesis by microRNAs. Nature 425,
257-263.
Phillips, J.R., Dalmay, T., and Bartels, D. (2007). The role of small RNAs in abiotic
stress. FEBS letters 581, 3592-3597.
Rivero, R.M., Kojima, M., Gepstein, A., Sakakibara, H., Mittler, R., Gepstein, S.,
and Blumwald, E. (2007). Delayed leaf senescence induces extreme drought
tolerance in a flowering plant. Proceedings of the National Academy of Sciences
104, 19631-19636.
Rubio-Somoza, I., and Weigel, D. (2011). MicroRNA networks and developmental
plasticity in plants. Trends in plant science 16, 258-264.
Rudall, P.J., and Buzgo, M. (2002). Evolutionary history of the monocot leaf.
Systematics Association Special Volume 65, 431-458.
Rus, A., Estan, M., Gisbert, C., Garcia‐Sogo, B., Serrano, R., Caro, M., Moreno, V.,
and Bolarin, M. (2001). Expressing the yeast HAL1 gene in tomato increases
fruit yield and enhances K+/Na+ selectivity under salt stress. Plant, Cell &
Environment 24, 875-880.
Rus, A., Lee, B., Muñoz-Mayor, A., Sharkhuu, A., Miura, K., Zhu, J.K., Bressan,
R.A., and Hasegawa, P.M. (2004). AtHKT1 facilitates Na+ homeostasis and K+
nutrition in planta. Plant Physiology 136, 2500-2511.
158
Scarpella, E., and Meijer, A.H. (2004). Pattern formation in the vascular system of
monocot and dicot plant species. New Phytologist 164, 209-242.
Schommer, C., Palatnik, J.F., Aggarwal, P., Chételat, A., Cubas, P., Farmer, E.E.,
Nath, U., and Weigel, D. (2008). Control of jasmonate biosynthesis and
senescence by miR319 targets. PLoS Biology 6, e230.
Schroder, T., Javaux, M., Vanderborght, J., Korfgen, B., and Vereecken, H. (2008).
Effect of local soil hydraulic conductivity drop using a three-dimensional root
water uptake model. Vadose Zone Journal 7, 1089-1098.
Shi, H., Lee, B., Wu, S.J., and Zhu, J.K. (2002). Overexpression of a plasma membrane
Na+/H+ antiporter gene improves salt tolerance in Arabidopsis thaliana. Nature
Biotechnology 21, 81-85.
Shinozaki, K., and Yamaguchi-Shinozaki, K. (2007). Gene networks involved in
drought stress response and tolerance. Journal of Experimental Botany 58, 221227.
Shukla, L.I., Chinnusamy, V., and Sunkar, R. (2008). The role of microRNAs and
other endogenous small RNAs in plant stress responses. Biochimica et Biophysica
Acta (BBA) - Gene Regulatory Mechanisms 1779, 743-748.
Sunkar, R., and Zhu, J.K. (2004). Novel and stress-regulated microRNAs and other
small RNAs from Arabidopsis. The Plant Cell Online 16, 2001-2019.
Sunkar, R., Chinnusamy, V., Zhu, J., and Zhu, J.K. (2007). Small RNAs as big
players in plant abiotic stress responses and nutrient deprivation. Trends in plant
science 12, 301-309.
159
Tardieu, F. (1996). Drought perception by plants Do cells of droughted plants
experience water stress? Plant growth regulation 20, 93-104.
Tardieu, F. (2011). Any trait or trait-related allele can confer drought tolerance: just
design the right drought scenario. Journal of Experimental Botany 63, 25-31.
Tardieu, F., Bruckler, L., and Lafolie, F. (1992). Root clumping may affect the root
water potential and the resistance to soil-root water transport. Plant and Soil 140,
291-301.
Tester, M., and Davenport, R. (2003). Na+ tolerance and Na+ transport in higher plants.
Annals of Botany 91, 503-527.
Thiebaut, F., Rojas, C.A., Almeida, K.L., Grativol, C., Domiciano, G.C., Lamb,
C.R.C., De Almeida Engler, J., Hemerly, A.S., and Ferreira, P.C.G. (2011).
Regulation of miR319 during cold stress in sugarcane. Plant, Cell & Environment
35: 502-512.
Tsiantis, M., Schneeberger, R., Golz, J.F., Freeling, M., and Langdale, J.A. (1999).
The maize rough sheath2 gene and leaf development programs in monocot and
dicot plants. Science 284, 154-156.
Tsukaya, H. (2005). Leaf shape: genetic controls and environmental factors.
International Journal of Developmental Biology 49, 547-555.
Varkonyi-Gasic, E., Wu, R., Wood, M., Walton, E.F., and Hellens, R.P. (2007).
Protocol: a highly sensitive RT-PCR method for detection and quantification of
microRNAs. Plant Methods 3, 12.
160
Wang, F.Z., Wang, Q.B., Kwon, S.Y., Kwak, S.S., and Su, W.A. (2005). Enhanced
drought tolerance of transgenic rice plants expressing a pea manganese
superoxide dismutase. Journal of Plant Physiology 162, 465-472.
Wang, T., Chen, L., Zhao, M., Tian, Q., and Zhang, W.H. (2011). Identification of
drought-responsive microRNAs in Medicago truncatula by genome-wide highthroughput sequencing. BMC genomics 12, 367.
Wang, W., Vinocur, B., and Altman, A. (2003). Plant responses to drought, salinity and
extreme temperatures: towards genetic engineering for stress tolerance. Planta
218, 1-14.
White, P.J., and Broadley, M.R. (2001). Chloride in soils and its uptake and movement
within the plant: a review. Annals of Botany 88, 967-988.
Wu, C.A., Yang, G.D., Meng, Q.W., and Zheng, C.C. (2004). The cotton GhNHX1
gene encoding a novel putative tonoplast Na+/H+ antiporter plays an important
role in salt stress. Plant and Cell Physiology 45, 600-607.
Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y. (2009). Rice microRNA effector
complexes and targets. Plant Cell 21, 3421-3435.
Xiao, H., Wang, Y., Liu, D., Wang, W., Li, X., Zhao, X., Xu, J., Zhai, W., and Zhu,
L. (2003). Functional analysis of the rice AP3 homologue OsMADS16 by RNA
interference. Plant Molecular Biology 52, 957-966.
Yang, S., Vanderbeld, B., Wan, J., and Huang, Y. (2010). Narrowing down the targets:
Towards successful genetic engineering of drought-tolerant crops. Molecular
Plant 3, 469-490.
161
Yeo, A., and Flowers, T. (1983). Varietal differences in the toxicity of sodium ions in
rice leaves. Physiologia Plantarum 59, 189-195.
Zhang, B., Pan, X., Cobb, G.P., and Anderson, T.A. (2006). Plant microRNA: A small
regulatory molecule with big impact. Developmental Biology 289, 3-16.
Zhang, H.X., and Blumwald, E. (2001). Transgenic salt-tolerant tomato plants
accumulate salt in foliage but not in fruit. Nature Biotechnology 19, 765-768.
Zhang, H.X., Hodson, J.N., Williams, J.P., and Blumwald, E. (2001). Engineering
salt-tolerant Brassica plants: characterization of yield and seed oil quality in
transgenic plants with increased vacuolar sodium accumulation. Proceedings of
the National Academy of Sciences 98, 12832-12836.
Zhang, J.Y., Broeckling, C.D., Blancaflor, E.B., Sledge, M.K., Sumner, L.W., and
Wang, Z.Y. (2005). Overexpression of WXP1, a putative Medicago truncatula
AP2 domain‐containing transcription factor gene, increases cuticular wax
accumulation and enhances drought tolerance in transgenic alfalfa (Medicago
sativa). The Plant Journal 42, 689-707.
Zhang, J.Z., Creelman, R.A., and Zhu, J.K. (2004). From laboratory to field. Using
information from Arabidopsis to engineer salt, cold, and drought tolerance in
crops. Plant Physiology 135, 615-621.
Zhao, B., Liang, R., Ge, L., Li, W., Xiao, H., Lin, H., Ruan, K., and Jin, Y. (2007).
Identification of drought-induced microRNAs in rice. Biochemical and
Biophysical Research Communications 354, 585-590.
162
Zhou, L., Liu, Y., Liu, Z., Kong, D., Duan, M., and Luo, L. (2010). Genome-wide
identification and analysis of drought-responsive microRNAs in Oryza sativa.
Journal of Experimental Botany 61, 4157-4168.
Zhou, X.-j., Zhao, h.-b., MA，Cheng-cang, and Li, Q.-f. (2009). Effects of exogenous
sillion on leaf structure and water-holding capacity of cucumber plants. Chinese
Journal of Ecology 28, 556-559.
163
CHAPTER 4 - CONCLUSIONS AND FUTURE
DIRECTIONS
Plant performance under adverse environmental conditions is one of the key
factors determining crop production. Genetic improvement of crop plants for enhanced
tolerance to biotic and abiotic stresses play a pivotal role in agriculture economy. Using
recombinant DNA and transgenic technologies, I have explored different molecular
strategies to genetically engineer creeping bentgrass, one of the economically and
environmentally important perennial turfgrass species for enhanced resistance to disease,
water stress and salt stress.
In an effort to improve plant biotic resistance in creeping bentgrass, I have
explored the use of a novel antimicrobial peptide Pen4-1 from shrimp to engineer
enhanced fungal disease resistance into creeping bentgrass plants. In order to make it
efficiently expressed in plants, the coding sequence of Pen4-1 was modified for monocot
plant-preferred codon usage. Northern blot analysis demonstrated that Pen4-1 was
successfully expressed at transcriptional level. Transgenic plants overexpressing Pen4-1
exhibited enhanced fungal disease resistance, but did not show any comprised phenotypic
changes. I also found that the addition of a signal peptide to the Pen4-1 did not
significantly impact its antifungal activity.
In another project, I examined what impact of rice miRNA 319 would have on
plant development and response to abiotic stress in transgenic turfgrass. Of particular
significance, we are the first to present what impact of miR319 would have on monocot
164
species and experimentally prove the involvement of miR319 in plant abiotic stress
tolerance. We demonstrated that transgenic plants overexpressing Osa-miR319a had
dramatic morphological changes including wider and thicker leaves, bigger stems, less
tillering, decreased root biomass, increased weight:area ratio and increased total wax
coverage. Some of these morphological changes can in turn contribute to enhanced plant
abiotic stress tolerance. We also found that the Osa-miR319a plants had enhanced salt
and drought tolerance. Further characterization of the underlying physiological
mechanisms showed that when subjected to water deficit, the Osa-miR319a transgenic
plants could maintain higher water content, higher cell membrane integrity and better
photosynthesis. We also found that the Osa-miR319a transgenic plants adopted salt
exclusion mechanism to minimize sodium toxicity to cells. To further explore molecular
mechanisms of miR319-mediated plant abiotic stress tolerance, we investigated gene
expression change of 5 potential miR319 targets in both control and the Osa-miR319a
transgnenic plants. We found that at least four of the targets AsPCF5, AsPCF6, AsPCF8
and AsTCP14 were all significantly down-regulated in transgnics. To examine whether
these four targets were directly involved in plant abiotic stress response, we studied
expression of these target genes in response to salt and drought stress by semiquantitative RT-PCR and real-time PCR analyses. Except AsPCF5, the other three
putative target genes were all up-regulated upon salt and dehydration stress. These results
suggest that the enhanced abiotic stress tolerance in transgenics might be attributed to
significant down-regulation of the miR319 target genes.
165
Our data clearly demonstrate the impact of miR319 in various aspects of plant
development and plant response to environmental stress and the possible involvement of
its target genes in these processes. This provides basic information for further study to
unravel the respective underlying molecular mechanisms of each phenotype change,
contributing to a better understanding of the basic biology of plant development. Our data
also indicate that not all miR319-induced changes in plant characteristics are desirable for
all plant species from agricultural production perspectives, for example, wider leaves and
less tillering displayed in the Osa-miR319a transgenic plants are not necessarily the
desirable traits for turfgrass. Next step would be to functionally characterize miR319
target genes and related gene regulatory network to better understand what specific role
each target gene plays. We expect to engineer specific target genes, which are probably
responsible for plant response to abiotic stress to avoid the pleiotropic effect miR319 has
on plant morphology and development.
Collectively, this current study with creeping bentgrass as a target species
provides the very first example of using Pen4-1 and rice miR319 for genetic engineering
of enhanced environmental stress tolerance in perennial monocot grasses, pointing out the
potential of applying similar strategies in other agriculturally important crop species. In
the future, it would be interesting to utilize gene stacking technology to combine both
Pen4-1 and rice miR319 into one transgenic line to achieve a broader range of tolerance
to environmental stress. Besides, considering the possibility of transgene escape and the
potential ecological impacts of releasing transgenic plants of perennial species for
commercialization, it is also important to incorporate gene containment strategy, such as
166
male sterility or total sterility in the final product. Genetic engineering of
environmentally safe plants with enhanced disease resistance and abiotic stress tolerance
will lead to materials that can be directly used for commercialization, benefiting the
environment and the agriculture production.
167
APPENDIX A - SUPPLEMENTARY FIGURES
Figure A1 A close look of the leaves and stems of WT and TG plants subjected to 60day limited water supply. (a)WT plant leaves and stems were shortened and deformed. (b)
TG plant stems elongated normally and the leaves maintain the normal shape.
168
169
170
171
172
Figure A.2
Alignments between 5 putative miR319 targets in turfgrass and their
corresponding homologues in rice (a) Alignment between AsPCF5 and OsPCF5. (b)
Alignment between AsPCF6 and OsPCF6. (c) Alignment between AsPCF7 and OsPCF7.
(d) Alignment between AsPCF8 and OsPCF8. (e) Alignment between AsTCP14 and
OsTCP14.
173

Figure A.3 Stomata study in WT and TG turfgrass plants. (a) A picture capturing guard
cell shape and stomata opening. (b) The epidermal cell layer of WT and TG plants. (c)
stomata density in WT and TG plants.
174
Figure A.4 The performance of WT and TG plants 5 days after 200 mM NaCl treatment
.
175
176
Figure A.5 The performance of WT and TG plants under the extreme salinity and
drought stress. (a) TG plants revived much better than WT plants 6d (left panel) and 15d
after recovery (right panel). (b) WT plants showed severe wilting after 6-day desiccation
(left panel). TG plants regained the vitality 9 days after the recovery from 6-day
desiccation, but WT plants almost died (right panel).
177
Figure A.6 Alignment between AsNAC60 and ONAC60.
178