Overexpression of C1q/Tumor Necrosis Factor–Related
Protein-3 Promotes Phosphate-Induced Vascular Smooth
Muscle Cell Calcification Both In Vivo and In Vitro
Yun Zhou,* Jin-Yu Wang,* Han Feng,* Cheng Wang, Li Li, Dan Wu, Hong Lei, Hao Li, Li-Ling Wu
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Objective—Vascular calcification is highly correlated with increased cardiovascular morbidity and mortality. C1q/tumor
necrosis factor–related protein-3 (CTRP3) is a newly identified adipokine that plays important roles in cardiovascular
system. Here, we investigated the role of CTRP3 in vascular calcification and its underlying mechanism.
Approach and Results—Adenine-induced chronic renal failure rat model was used to mimic the process of arterial medial
calcification. The level of CTRP3 was elevated in serum and abdominal aorta of chronic renal failure rats. Periadventitial
gene delivery of CTRP3 significantly accelerated the calcification of abdominal aorta and arterial ring. In cultured
vascular smooth muscle cells (VSMCs), CTRP3 increased β-glycerophosphate–induced calcium deposition and alkaline
phosphatase activity. Although CTRP3 alone was not sufficient to induce calcification in VSMCs, it upregulated the
expression of osteogenic marker genes including runt-related transcription factor 2 (Runx2), bone morphogenetic protein
2, and osteopontin. CTRP3 further enhanced β-glycerophosphate–induced downregulation of smooth muscle α-actin
and smooth muscle 22α, while augmenting osteogenic marker expression in VSMCs induced by β-glycerophosphate. In
contrast, knockdown of CTRP3 in VSMCs potently suppressed β-glycerophosphate–induced calcification. Mechanistically,
knockdown of Runx2 inhibited CTRP3-promoted VSMC calcification. CTRP3 increased extracellular signal–regulated
kinase 1/2 phosphorylation and reactive oxygen species production. Preincubation with U0126, an extracellular signal–
regulated kinase 1/2 upstream kinase inhibitor, had no effect on CTRP3-induced reactive oxygen species production.
However, pretreatment with N-acetyl- -cysteine, a reactive oxygen species scavenger, suppressed CTRP3-induced
extracellular signal–regulated kinase 1/2 phosphorylation. Both N-acetyl- -cysteine and U0126 significantly inhibited
CTRP3-induced upregulation of Runx2 and calcified nodule formation.
Conclusions—CTRP3 promotes vascular calcification by enhancing phosphate-induced osteogenic transition of VSMC
through reactive oxygen species–extracellular signal–regulated kinase 1/2–Runx2 pathway. (Arterioscler Thromb Vasc
Biol. 2014;34:1002-1010.)
l
l
Key Words: C1QTNF3 protein ◼ Runx2 protein, rat ◼ vascular calcification
V
ascular calcification is a chronic condition and is associated with high morbidity and mortality of cardiovascular
diseases.1 An imbalance between inducers and inhibitors has
been suggested to play a critical role in the pathological process of vascular calcification.2
Adipokines, predominantly secreted by adipose tissue, are
a series of factors controlling energy metabolism, inflammation, and cardiovascular function.3 Accumulating evidence has
suggested that adipokines are involved in the regulation of vascular calcification. Leptin enhances the osteoblastic differentiation and calcification in cultured cells as well as apolipoprotein
E–deficient mice.4,5 In contrast, several adipokines, including adiponectin, omentin, and apelin, can play a protective role against
vascular calcification by inhibiting osteoblastic differentiation of
vascular smooth muscle cells (VSMCs).6–8 However, the precise
roles of adipokines in vascular calcification regulation and the
underlying mechanisms still require further investigation.
C1q/tumor necrosis factor–related protein-3 (CTRP3) is
a newly identified adipokine with important roles in regulation of inflammation and metabolism.9 CTRP3 is ubiquitously
expressed in adipose, kidney, cartilage, fibroblasts, chondrocytes, monocytes, and VSMCs.10–12 CTRP3 reduces glucose
output in hepatocytes and exerts anti-inflammatory effect
in adipocytes and monocytes.13,14 A recent study shows that
CTRP3 also has antiapoptotic, proangiogenic, and cardioprotective roles.15
Received on: October 7, 2013; final version accepted on: February 15, 2014.
From the Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, People’s Republic of China; Key Laboratory
of Molecular Cardiovascular Sciences, Ministry of Education, Beijing, People’s Republic of China; and Key Laboratory of Cardiovascular Molecular
Biology and Regulatory peptides, Ministry of Health, Beijing, People’s Republic of China.
*These authors contributed equally to this article.
The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.114.303301/-/DC1.
Correspondence to Li-Ling Wu, MS, Department of Physiology and Pathophysiology, Peking University Health Science Center, 38 Xueyuan Rd, Haidian
District, 100191, Beijing, People’s Republic of China. E-mail [email protected]
© 2014 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
1002
DOI: 10.1161/ATVBAHA.114.303301
Zhou et al CTRP3 Promotes Vascular Calcification 1003
Nonstandard Abbreviations and Acronyms
Ad
ALP
CRF
CTRP3
ERK1/2
GFP
MAPK
ROS
Runx2
SMA
VSMCs
βGP
adenovirus
alkaline phosphatase
chronic renal failure
C1q/tumor necrosis factor–related protein-3
extracellular signal–regulated kinase 1/2
green fluorescent protein
mitogen-activated protein kinase
reactive oxygen species
runt-related transcription factor 2
smooth muscle α-actin
vascular smooth muscle cells
β-glycerophosphate
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Because CTRP3 promotes proliferation of endothelial
cells, VSMCs, chondrogenic precursors, and chondrocytes,12,16,17 we hypothesized that CTRP3 might be involved
in the regulation of vascular calcification. In this study, we
investigated the effects of CTRP3 on vascular calcification
in chronic renal failure (CRF) rat, arterial ring, and primary
cultured VSMCs. We also explored the underlying mechanism of CTRP3-mediated osteogenic transition and calcification of VSMCs.
Materials and Methods
Materials and Methods are available in the online-only Supplement.
Results
Changes in Blood Biochemical Parameters
Rat CRF was induced by adenine diet to mimic the process of
arterial medial calcification. The adenine-fed rats had severe
renal failure, with a significant increase in blood urea nitrogen and creatinine at 4 weeks (P<0.01) and even higher at 6
weeks (P<0.01), similar to a previous report.18 Serum calcium
level of CRF rats did not change, whereas serum phosphorus
increased by 41.4% at 4 weeks and 79.6% at 6 weeks (P<0.01)
compared with the age-matched controls. Body weight and
abdominal fat weight were decreased in CRF rats (Table in the
online-only Data Supplement). In addition, blood biochemical parameters were not affected by periadventitial delivery of recombinant adenovirus carrying full-length CTRP3
(Ad-CTRP3) or green fluorescent protein (Ad-GFP) to
abdominal aortas, compared with the age-matched CRF rats.
Increased CTRP3 Is Associated With
Vascular Calcification in CRF Rats
ELISA showed that the level of circulating CTRP3
increased to 783±48 ng/mL in 4-week and 791±41 ng/mL
in 6-week CRF rats compared with 667±35 ng/mL in control (Figure 1A). The expression of CTRP3 mRNA in kidney
and abdominal adipose tissue decreased significantly in CRF
rats, whereas adenoviral delivery of CTRP3 or GFP did not
change the local CTRP3 mRNA levels (Figure 1B and 1C).
The amplified CTRP3 sequence after reverse transcriptionpolymerase chain reaction was detected at the size of 272 bp,
and CTRP3 protein was observed with a molecular mass of ≈
36 kDa in VSMCs (Figure 1D). Adipose tissue obtained from
control rats was used as a positive control. CTRP3 proteins
increased in the abdominal aortas of 4-week (P<0.05) and
further increased in 6-week CRF rats (P<0.01) compared with
controls (Figure 1E). Histological assessment with alizarin
red staining showed extensive linear calcification in the aortic media of 6-week CRF rats. Immunohistochemical staining showed that CTRP3 expression was slightly increased
Figure 1. Expression of C1q/tumor necrosis factor–related protein-3 (CTRP3) in different tissues
of control and chronic renal failure (CRF) rats. A,
Serum CTRP3 level was determined by ELISA
assay. *P<0.05 vs control (n=6–8 per group). B
and C, Expression of CTRP3 mRNA in kidney (B)
and abdominal adipose tissue (C) was detected
by quantitative reverse transcription-polymerase
chain reaction (RT-PCR) and normalized to that
of β-actin. *P<0.05, **P<0.01 vs control (n=6–8
per group). D, Expression of CTRP3 mRNA
(top) and protein (bottom) in cultured vascular
smooth muscle cells (VSMCs) harvested from
control rat aortas was detected by RT-PCR and
Western blot, respectively. E, CTRP3 protein
expression in abdominal aortas was examined
by Western blot and normalized to that of actin.
*P<0.05, **P<0.01 vs control. #P<0.05 vs 4-week
CRF rats (n=6–8 per group). Ad indicates adenovirus; and GFP, green fluorescent protein.
1004 Arterioscler Thromb Vasc Biol May 2014
in the aortic media in 4-week, whereas abundantly accumulated in 6-week CRF rats. Moreover, the CTRP3-positive
cells were mainly localized to the calcified area, which
was defined as the area stained reddish/purple by alizarin
red staining (Figure I in the online-only Data Supplement).
These results suggested that increased CTRP3 expression
might be involved in aortic medial calcification of CRF rats.
Overexpression of CTRP3 Promotes Vascular
Calcification in CRF Rats and in ­High-Phosphate
Cultured Carotid Arterial Rings
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
To further explore the role of CTRP3 in vascular calcification,
we periadventitially delivered Ad-CTRP3 or Ad-GFP to rat
abdominal aortas. Calcification of abdominal aortas was induced
by adenine diet after 6 weeks, as demonstrated by alizarin red
staining and calcium deposition (Figure 2A and 2B). Ad-GFP
transfection did not change calcium deposition in the abdominal aortas as compared with CRF rats. In contrast, Ad-CTRP3
markedly increased calcium deposition and calcified nodule
formation. Quantitative fluorescence analysis showed that the
expression of Ad-CTRP3 in CRF rat transfected aortas was
markedly increased at 1 week and returned to control level after
6 weeks (Figure 2C). We further evaluated the effect of CTRP3
on vascular calcification in a rat carotid ring organ culture
model. Rat common carotid arteries were removed 3 days after
Ad-GFP or Ad-CTRP3 transfection, cut into 2- to 3-mm rings,
and were cultured in regular DMEM with or without high phosphate (3.8 mmol/L PO43−) for 6 days. Ad-CTRP3–transfected
carotid explants showed much more calcification than Ad-GFP–
transfected explants in high-phosphate medium (Figure 2D
and 2E). Although overexpression of CTRP3 increased alkaline phosphatase (ALP) protein expression, it was not sufficient to induce calcium deposition calcified nodule formation
(Figure 2F–2H) when carotid explants were cultured without
high phosphate. Thus, these results indicated that overexpression of CTRP3 enhanced vascular calcification in CRF rats and
in high-phosphate cultured carotid arterial rings.
CTRP3 Promotes β-Glycerophosphate–Induced
VSMC Calcification In Vitro
Figure 2. Overexpression of C1q/tumor necrosis factor–related
protein-3 (CTRP3) promotes phosphate-induced vascular calcification. A and B, Rat abdominal aortas were transfected periadventitially with adenovirus carrying green fluorescent protein (Ad-GFP)
or Ad-CTRP3 and then fed a diet with or without 0.75% adenine.
After 6 weeks, the abdominal arteries were excised for alizarin red
staining and quantitative analysis of calcium content. A, Alizarin
red staining and hematoxylin/eosin (HE) staining of abdominal
aortas. Bar, 25 μm. B, Quantitative analysis of calcium deposition
in abdominal aortas. Values are mean±SEM (n=6–8 per group).
**P<0.01 vs control. ##P<0.01 vs chronic renal failure (CRF).
C, Quantitative fluorescence analysis of Ad-CTRP3 protein in CRF
rat abdominal aortas transfected with 6×108 p
­ laque-forming units
(pfu) Ad-CTRP3 for 1, 4, and 6 weeks (n=3 per group). **P<0.01 vs
week 0. D to H, Rat common carotid arteries were periadventitially
transfected with Ad-GFP or A
­ d-CTRP3. After 3 days, the carotid
arteries were cut into small rings and cultured with (D and E) or
without (F–H) 3.8 mmol/L PO43− for 6 days. D, Alizarin red staining
and HE staining of carotid arteries. Bar, 25 μm. E, Quantitative
We further examined the in vitro effects of CTRP3 on arterial calcification in cultured primary VSMCs induced by
β-glycerophosphate (βGP). Compared with VSMCs treated with
βGP alone, calcium concentration was significantly increased in
the presence of various concentrations of CTRP3 (1, 2, and 4
μg/mL) as early as day 3 and further increased at day 6 and 12
(Figure 3A). Similarly, ALP activity was also elevated in the presence of various concentrations of CTRP3 (Figure 3B). However,
CTRP3 alone did not increase calcium concentration and calcified nodule formation when VSMCs were cultured without βGP,
consistent with in vivo finding that CTRP3 was not sufficient to
Figure 2 (Continued). analysis of calcium deposition in carotid
arteries cultured with high phosphate (n=6 per group). **P<0.01
vs control. ##P<0.01 vs Pi. F, Expression of alkaline phosphatase
(ALP) in carotid arteries cultured without phosphate was examined
by Western blot and normalized to that of actin (n=6 per group).
**P<0.01 vs control. G, Quantitative analysis of calcium deposition
in carotid arteries (n=6 per group). **P<0.01 vs control. H, Alizarin
red staining and HE staining of carotid arteries. Bar, 25 μm.
Zhou et al CTRP3 Promotes Vascular Calcification 1005
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 3. C1q/tumor necrosis factor–related
­protein-3 (CTRP3) promotes phosphate-induced
calcification of vascular smooth muscle cells
(VSMCs) in vitro. A and B, Rat VSMCs were treated
with 1, 2, and 4 μg/mL CTRP3 for 3, 6, and 12 days
in the presence of calcifying medium containing 10
mmol/L β-glycerophosphate (βGP). Calcium concentration (A) and alkaline phosphatase (ALP) activity (B) were measured and normalized to cellular
protein content for quantitative analysis. **P<0.01
vs untreated. #P<0.05, ##P<0.01 vs βGP (n=3).
C, Quantitative analysis of calcium concentration
in rat VSMCs treated with 2 μg/mL CTRP3 for 3, 6,
and 12 days without βGP (n=3). D, Knockdown of
CTRP3 in VSMCs was identified by Western blot
analysis (n=3). E and F, VSMCs were transfected
with scramble small interfering RNA (siRNA) or
CTRP3 siRNA for 48 hours and then incubated with
2 μg/mL CTRP3 with or without 10 mmol/L βGP
for additional 12 days. E, VSMCs were stained for
mineralization with alizarin red. Bar, 100 μm.
F, Quantitative analysis of calcified nodule formation. **P<0.01 vs untreated. #P<0.05 vs βGP.
§P<0.05 vs βGP+siRNA scramble (n=3).
induce calcification. The intensity of alizarin red staining was
significantly higher in βGP+CTRP3 (2 μg/mL) group compared
with βGP group. Knockdown of CTRP3 expression by small
interfering RNA reduced βGP-induced calcified nodule formation, compared with scramble small interfering RNA control
(Figure 3C–3F). The data indicated that CTRP3 promoted βGPinduced VSMCs calcification in vitro.
CTRP3 Promotes Phosphate-Induced
Osteogenic Transition of VSMCs
VSMC phenotypic transition from contractile to osteogenic
phenotype plays a crucial role in vascular calcification.19 We
evaluated the effect of CTRP3 on VSMC transition both in
vivo and in vitro. As shown in Figure 4A and 4B, the expression of contractile markers smooth muscle α-actin (SMA)
and smooth muscle 22α in the abdominal aorta of 6-week
CRF rats was significantly decreased by 31.9% and 27.3%,
respectively, compared with the control group (P<0.01).
On Ad-CTRP3 transfection, the contractile marker expression further decreased by 53.9% and 52.7% (P<0.01) compared with CRF rats. Ad-GFP transfection did not alter the
expression of contractile marker genes. On the contrary,
the osteogenic markers runt-related transcription factor 2
(Runx2) and bone morphogenetic protein 2 were significantly
increased in CRF rats (P<0.01) and were further elevated in
Ad-CTRP3–transfected group (P<0.01; Figure 4C and 4D).
The observation was also verified by immunohistochemical
staining of SMA and Runx2 (Figure II in the online-only
Data Supplement).
Similarly, the expression of SMA and smooth muscle
22α at both mRNA and protein levels was decreased in
VSMCs treated with βGP+CTRP3 (2 μg/mL) for 48 hours
(Figure 5A–5D). In parallel, the levels of Runx2, bone morphogenetic protein 2, and osteopontin mRNA (Figure 5A and
5B) and protein (Figure 5E–5G) were markedly increased
in βGP+CTRP3–treated VSMCs. CTRP3 alone upregulated
the expression of Runx2, bone morphogenetic protein 2,
osteopontin, ­sex-determining region Y-box 9, and collagen
type II α1. However, it did not affect SMA level and even
increased smooth muscle 22α level slightly, when VSMCs
were incubated without βGP for 48 hours (Figure 5H–5N).
These results indicated that CTRP3 promoted phosphateinduced osteogenic transition of VSMCs both in vivo and
in vitro.
Knockdown of Runx2 Inhibits ­CTRP3-Promoted
VSMC Calcification In Vitro
Among various inducers of vascular calcification, Runx2 is an
important transcription factor to accelerate osteogenic transition of VSMCs.20 CTRP3 increased the expression of Runx2
in the abdominal aortas of CRF rats and in cultured VSMCs
as described above. To explore whether Runx2 mediates the
VSMC calcification promoted by CTRP3, VSMCs were transfected with small interfering RNA against Runx2 for 48 hours
and then were incubated with 2 μg/mL CTRP3 in the presence
of βGP for 12 days. Although CTRP3 significantly enhanced
calcified nodule formation in the presence of βGP, Runx2
depletion dramatically abrogated this enhancement by CTRP3
1006 Arterioscler Thromb Vasc Biol May 2014
ROS scavenger, significantly suppressed CTRP3-induced
ERK1/2 phosphorylation (P<0.01; Figure 6D), suggesting that ROS production in turn activated ERK1/2 pathway.
Induction of Runx2 by CTRP3 was significantly inhibited
by N-acetyl-l-cysteine (20 μmol/L), PD98059 (an ERK1/2
upstream kinase inhibitor; 20 nmol/L), or U0126 (10 nmol/L)
pretreatment in the present of βGP (Figure 6E). In addition,
CTRP3-enhanced calcified nodule formation in the presence
of βGP was suppressed by ROS scavenger or ERK1/2 kinase
inhibitors (Figure 6F and 6G). Even in the absence of βGP, the
induction of Runx2 expression by CTRP3 could be inhibited
by N-acetyl-l-cysteine (20 μmol/L), PD98059 (20 nmol/L), or
U0126 (10 nmol/L) pretreatment (Figure 6H and 6I). These
results indicated that CTRP3 promoted ROS production,
which in turn activated ERK1/2–Runx2 signaling pathway to
enhance phosphate-induced osteogenic transition of VSMCs.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Discussion
Figure 4. C1q/tumor necrosis factor–related protein-3 (CTRP3)
induces osteogenic transition of vascular smooth muscle cells
in vivo. Expressions of smooth muscle α-actin (SMA; A), smooth
muscle 22α (SM22α; B), runt-related transcription factor 2
(Runx2; C), and bone morphogenetic protein 2 (BMP2; D) in rat
abdominal aortas were examined by Western blot and normalized to that of actin (n=6). **P<0.01 vs control. ##P<0.01 vs
chronic renal failure (CRF). Ad indicates adenovirus; and GFP,
green fluorescent protein.
(Figure 5O and 5P). These results suggested that Runx2 was
essential for CTRP3-promoted VSMC calcification.
CTRP3 Upregulates Runx2 Expression and
Promotes VSMC Calcification Through a Reactive
Oxygen Species–Extracellular Signal–Regulated
Kinase 1/2–Dependent Pathway
Mitogen-activated protein kinase (MAPK) pathway has been
reported to play an important role in the proliferation of mesenchymal chondroprogenitor cells stimulated by CTRP3.21
To reveal the intracellular signaling molecules mediating the
effect of CTRP3, we measured phosphorylation of MAPK
family in VSMCs. The levels of phospho–extracellular signal–
regulated kinase 1/2 (p-ERK1/2) were significantly increased
after incubation with 2 μg/mL CTRP3 for 5, 15, and 30 minutes
(Figure 6A and 6B). On the contrary, the levels of phosphop38MAPK and phospho–c-Jun N-terminal kinase were not
changed within 60 minutes of CTRP3 treatment (Figure 6A).
Hydrogen peroxide is found to promote osteogenic transition
of VSMCs, suggesting that reactive oxygen species (ROS) production may be involved in vascular calcification.22 CTRP3 (2
μg/mL) increased the production of ROS in VSMCs (Figure 6C).
Angiotensin II (100 nmol/L) was used as a positive control.23
To examine whether the increased ROS was attributable
to ERK1/2 signaling activation, we pretreated VSMCs with
U0126 (10 nmol/L), an ERK1/2 upstream kinase inhibitor.
Interestingly, blocking ERK1/2 signaling had no effect on
CTRP3-induced ROS production (Figure 6C). On the contrary,
pretreatment with N-acetyl-l-cysteine (20 μmol/L), a potent
There are 3 major new findings presented by our study. First, we
demonstrated for the first time that CTRP3 promoted phosphateinduced vascular calcification in vivo, ex vivo, and in vitro.
Second, we revealed that CTRP3 accelerated β
­GP-induced
osteogenic transition of VSMCs by downregulating contractile markers and upregulating osteogenic markers. Third,
although Runx2 was an essential mediator of CTRP3 response,
increased ROS production and ERK1/2 activation also facilitate
the CTRP3-induced Runx2 upregulation and VSMC calcification. Our results provide new insights into the important roles
of CTRP3 in cardiovascular system and characterize a novel
mechanism of adipokine-modulated vascular calcification.
CTRP3 is ubiquitously expressed in adipose and nonadipose
tissues, and circulating levels of CTRP3 vary according to mammalian species and determining methods. Plasma CTRP3 concentration is ≈1000±300 ng/mL in mice by immunoblot analysis.13 A
recent report indicates that plasma CTRP3 levels in normal subjects are 226.2 to 335.5 ng/mL.24 In addition, circulating CTRP3
levels is affected by food intake and disease types. Circulating
CTRP3 in fasted mice increases compared with fasted/refed or
ad libitum fed mice. Although CTRP3 is reduced in diet-induced
obese mice with high leptin levels, it is increased in leptin-deficient obese mice.13 In patients with glucose metabolism disorder,
plasma CTRP3 level elevates significantly.24 A 3-month combined exercise decreases CTRP3 level from 444.3 to 374.4 ng/
mL in obese Korean women.25 These results suggest that circulating CTRP3 level may serve as a novel biomarker candidate
for ­metabolic-related diseases. Vascular calcification is a critical event in the development of vascular disease and frequently
observed in patients with CRF.26 However, circulating levels of
CTRP3 in patients with CRF or CRF animals are unknown. Here,
with a CTRP3-specific ELISA kit, we showed that serum CTRP3
concentration in control rats was 667±35 ng/mL. Although
CTRP3 levels in serum and calcified vasculature increased in
CRF rats, the expression of CTRP3 mRNA decreased in kidney
and abdominal adipose tissue. Because VSMC is not the main
source of CTRP3,11 one possible explanation for elevated serum
CTRP3 was attributable to decreased renal function characterized
by increased blood urea nitrogen and creatinine, which was in
accordance with the finding by Choi et al.24 Moreover, elevation
Zhou et al CTRP3 Promotes Vascular Calcification 1007
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 5. C1q/tumor necrosis factor–related protein-3 (CTRP3) accelerates β-glycerophosphate (βGP)–induced osteogenic transition of
vascular smooth muscle cells (VSMCs) and knockdown of runt-related transcription factor 2 (Runx2) inhibits CTRP3-promoted VSMC
calcification in vitro. A and B, VSMCs were incubated with 2 μg/mL CTRP3 and 10 mmol/L βGP for 3 days and then mRNA expression
of contractile and osteogenic marker genes were determined by reverse transcription-polymerase chain reaction and normalized to that
of β-actin. *P<0.05 vs βGP (n=3–5). C to G, VSMCs were incubated with 2 μg/mL CTRP3 and βGP for 6 to 48 hours, and the protein
expression of smooth muscle α-actin (SMA; C), smooth muscle 22α (SM22α; D), Runx2 (E), bone morphogenetic protein 2 (BMP2; F),
and osteopontin (OPN; G) was examined by Western blot and normalized to that of actin. *P<0.05 vs untreated. #P<0.05 vs βGP alone
(n=5). H to N, VSMCs were incubated in the presence or absence of 2 μg/mL CTRP3 or 10 mmol/L βGP for 48 hours, and the protein
expression of SMA (H), SM22α (I), Runx2 (J), BMP2 (K), osteopontin (L), sex-determining region Y-box 9 (Sox 9; M) and collagen type II
α1 (COL2A1; N) was examined by Western blot and normalized to that of actin. *P<0.05, **P<0.01 vs untreated. #P<0.05 vs βGP (n=3).
O and P, VSMCs were transfected with scramble small interfering RNA (siRNA) or Runx2 siRNA for 48 hours and then incubated with
2 μg/mL CTRP3 in the presence of 10 mmol/L βGP for an additional 12 days. O, VSMCs were stained for mineralization with alizarin red.
Bar=100 μm. P, Quantitative analysis of calcified nodule formation. *P<0.05 vs βGP. #P<0.05 vs βGP+CTRP3 (n=5).
1008 Arterioscler Thromb Vasc Biol May 2014
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 6. C1q/tumor necrosis factor–related protein-3 (CTRP3) upregulates runt-related transcription factor 2 (Runx2) expression and
promotes β-glycerophosphate (βGP)–induced vascular smooth muscle cell (VSMC) calcification through reactive oxygen species (ROS)–
extracellular signal–regulated kinase 1/2 (ERK1/2)–dependent pathway. A and B, VSMCs were incubated with 2 μg/mL CTRP3 for the
indicated times. Mitogen-activated protein kinase (MAPK) phosphorylation was determined by Western blot analysis. *P<0.05, **P<0.01
vs 0 minute (n=3). C, VSMCs were pretreated with U0126 for 30 minutes and then incubated with 2 μg/mL CTRP3 for another 15 minutes.
DCF-DA (dichloro-dihydro-fluorescein diacetate) fluorescence staining was used to examine intracellular ROS production. Angiotensin II
(100 nmol/L) was used as a positive control. Bar, 200 μm. D, VSMCs were incubated with 20 μmol/L N-acetyl-l-cysteine (NAC) for 30 minutes
before treatment with 2 μg/mL CTRP3 for another 15 minutes. Expression of phospho-ERK1/2 (p-ERK1/2) was detected by Western blot
and normalized to total ERK1/2. **P<0.01 vs untreated. ##P<0.01 vs CTRP3 (n=3). E to G, VSMCs were incubated with 20 μmol/L NAC,
20 nmol/L PD98059, or 10 nmol/L U0126 in the presence of βGP for 30 minutes before treatment with 2 μg/mL CTRP3 for another 36
hours (E) or 12 days (F and G). E, Expression of Runx2 was determined by Western blot and normalized to that of actin. *P<0.05 vs βGP.
#P<0.05 vs βGP+CTRP3 (n=3). F, Calcified nodules were stained with alizarin red. Bar, 200 μm. G, Quantitative analysis of calcified nodule formation. **P<0.01 vs untreated. #P<0.05 vs βGP. §P<0.05 vs βGP+CTRP3 (n=3). H and I, VSMCs were incubated with 20 μmol/L
NAC (H), 20 nmol/L PD98059, or 10 nmol/L U0126 (I) without βGP for 30 minutes before treatment with 2 μg/mL CTRP3 for another 36
hours. Expression of Runx2 was determined by Western blot and normalized to that of actin. *P<0.01 vs untreated. #P<0.05 vs CTRP3
(n=3). p-JNK indicates phospho–c-Jun N-terminal kinase.
of CTRP3 in serum and vasculature appeared before calcified
nodule formation, implying that CTRP3 might be involved in the
development of vascular calcification.
CTRP3 is a multifunctional adipokine in regulating cell
metabolism and function, and its biological effect may vary
depending on cell type, physiological, and pathological stimuli. By using periadventitial adenoviral delivery of CTRP3
both in vivo and ex vivo, we showed increased vascular calcification in CTRP3-overexpressed CRF rats. Our results in
cultured VSMCs further confirmed the effects of CTRP3 on
phosphate-induced vascular calcification. Knockdown of
CTRP3 in VSMCs eliminated βGP-induced calcified nodule
formation. We also noticed that, without βGP, CTRP3 alone
was not sufficient to induce calcification in VSMCs. These
results suggested that high phosphate was an independent risk
of vascular calcification, and CTRP3 acted synergistically with
phosphate to promote the progression of VSMC calcification.
Vascular calcification is an active and cell-mediated process.19,27 Many studies have revealed that phenotypic transition
of VSMCs from contractile to osteogenic phenotype contributes
to adipokine-participated vascular calcification. Treatment of calcifying VSMCs with leptin causes a significant increase in ALP
activity, an early marker of osteogenic transition of VSMCs.4
Adiponectin inhibits ALP activity, osteocalcin secretion, and
Zhou et al CTRP3 Promotes Vascular Calcification 1009
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Runx2 expression of calcifying VSMCs.6 Omentin and apelin inhibit ALP activity and osteocalcin production during the
osteoblastic differentiation of calcifying VSMCs.7,8 In the present
study, we found that expressions of SMA and smooth muscle 22α
were significantly decreased in the abdominal aortas of CRF rats,
and overexpression of CTRP3 further reduced the expression of
contractile markers. In contrast, increased osteogenic markers in
CRF rats were further upregulated in CTRP3-overexpressed vasculature. In cultured VSMCs, CTRP3 alone increased the expression of osteogenic markers, but did not decrease the expression of
contractile markers. Moreover, CTRP3 promoted βGP-induced
osteogenic transition. These results further indicated that CTRP3
acted as a promoter instead of an inducer of VSMCs calcification.
Several key transcription factors such as Runx2, osterix, and
Msx2 have been identified in calcified vascular lesions.27 Among
them, Runx2 is thought to be a decisive factor and early marker of
VSMC osteogenic transition and calcification.27,28 Compared with
the trace expression in normal vasculature, Runx2 is significantly
upregulated in the vascular lesions and seems to precede overt calcification.27 More importantly, Runx2 is closely associated with the
effects of various adipokines in osteogenic transition of VSMCs.
Adiponectin and apelin decrease Runx2 expression in cultured calcifying VSMCs,6,8 whereas tumor necrosis factor-α enhances the
mRNA expression and DNA binding of Runx2.29,30 Here, we found
that the expression of Runx2 increased significantly in the abdominal aortas of CRF rats. Overexpression of CTRP3 or treatment
of VSMCs with CTRP3 further upregulated Runx2 expression.
Knockdown of Runx2 reversed the effect of CTRP3 on VSMC
calcification in vitro. These results suggested that Runx2 played a
crucial role in CTRP3-promoted vascular calcification.
To gain further insight into the mechanisms by which CTRP3
promoted vascular calcification, we explored the intracellular
signaling events in VSMCs. MAPK family activation plays a
critical role in mediating the effects of adipokines on vascular calcification. However, the specific roles of major members of MAPK family, including ERK1/2, c-Jun N-terminal
kinase, and p38MAPK, in vascular calcification depend on
the stimuli and cell types. Adiponectin exerts its anticalcific
effect through p38MAPK,6 whereas apelin plays a protective role against vascular calcification via ERK1/2 pathway.8
CTRP3 is reported to promote mouse VSMC proliferation via
ERK1/2 and p38MAPK,12 and it also promotes the proliferation and migration of murine osteosarcoma cells and endothelial cells by activating ERK1/2.16,31 Here, we found that CTRP3
increased phosphorylation of ERK1/2 but not c-Jun N-terminal
kinase and p38MAPK in VSMCs, suggesting that ERK1/2 was
required in CTRP3-promoted vascular calcification.
Oxidative stress plays an important role in the pathogenesis of vascular calcification.2 As a classical oxidative stressor
and key mediator of intracellular signaling, hydrogen peroxide promotes osteogenic transition of VSMCs by upregulating
Runx2.22 We found that CTRP3 significantly increased intracellular ROS production. N-acetyl-l-cysteine pretreatment inhibited CTRP3-induced Runx2 upregulation and calcified nodule
formation, which suggested that ROS production was involved
in CTRP3-mediated Runx2 upregulation and VSMC calcification. Many studies revealed ERK1/2 as a downstream effector
of ROS, whereas a report by Lu and Cederbaum32 suggests a
reciprocal relationship between ROS production and ERK
activation. Here, we showed that ROS scavenger pretreatment
significantly suppressed CTRP3-induced ERK1/2 phosphorylation, whereas inhibition of ERK1/2 did not affect CTRP3induced ROS production, suggesting that ROS acted as an
­ TRP3-treated VSMCs. Both
upstream molecule of ERK1/2 in C
ERK1/2 inhibitor and ROS scavenger reversed CTRP3-induced
Runx2 upregulation and calcified nodule formation. Hence,
CTRP3 promoted osteogenic transition and calcification of
VSMCs through ROS–ERK1/2 signaling pathway.
Although adenine-induced CRF model is demonstrated to be a
useful model for the study of vascular calcification, adenine diet
causes weight loss and faster development of vascular calcification than that in humans.33,34 Whether the extensive medial calcification is attributable to weight loss or the adenine itself remains to
be determined.33 More importantly, the effect of CTRP3 on vascular calcification in patients with CRF needs further investigation.
In summary, we have demonstrated that CTRP3 is a novel
endogenous regulator of vascular calcification. CTRP3 promotes vascular calcification by accelerating p­ hosphate-induced
osteogenic transition of VSMCs through ROS–ERK1/2–Runx2
signaling pathway. These findings provide novel insight on the
physiological and pathophysiological roles of CTRP3.
Sources of Funding
This work was supported by grants from the National Natural Science
Foundation of Beijing (No. 7112084) and National Natural Science
Foundation of China (Nos. 81100192 and 81270158).
Disclosures
None.
References
1.Kahn MR, Robbins MJ, Kim MC, Fuster V. Management of cardiovascular disease in patients with kidney disease. Nat Rev Cardiol.
2013;10:261–273.
2. Sage AP, Tintut Y, Demer LL. Regulatory mechanisms in vascular calcification. Nat Rev Cardiol. 2010;7:528–536.
3. Al-Suhaimi EA, Shehzad A. Leptin, resistin and visfatin: the missing link
between endocrine metabolic disorders and immunity. Eur J Med Res.
2013;18:12.
4. Parhami F, Tintut Y, Ballard A, Fogelman AM, Demer LL. Leptin enhances
the calcification of vascular cells: artery wall as a target of leptin. Circ Res.
2001;88:954–960.
5. Zeadin M, Butcher M, Werstuck G, Khan M, Yee CK, Shaughnessy SG.
Effect of leptin on vascular calcification in apolipoprotein E-deficient
mice. Arterioscler Thromb Vasc Biol. 2009;29:2069–2075.
6. Luo XH, Zhao LL, Yuan LQ, Wang M, Xie H, Liao EY. Development of
arterial calcification in adiponectin-deficient mice: adiponectin regulates
arterial calcification. J Bone Miner Res. 2009;24:1461–1468.
7. Duan XY, Xie PL, Ma YL, Tang SY. Omentin inhibits osteoblastic differentiation of calcifying vascular smooth muscle cells through the PI3K/Akt
pathway. Amino Acids. 2011;41:1223–1231.
8. Shan PF, Lu Y, Cui RR, Jiang Y, Yuan LQ, Liao EY. Apelin attenuates the
osteoblastic differentiation of vascular smooth muscle cells. PLoS One.
2011;6:e17938.
9. Schäffler A, Buechler C. CTRP family: linking immunity to metabolism.
Trends Endocrinol Metab. 2012;23:194–204.
10.Schäffler A, Weigert J, Neumeier M, Schölmerich J, Buechler C.
Regulation and function of collagenous repeat containing sequence of
26-kDa protein gene product “cartonectin”. Obesity (Silver Spring).
2007;15:303–313.
11. Wong GW, Krawczyk SA, Kitidis-Mitrokostas C, Revett T, Gimeno R,
Lodish HF. Molecular, biochemical and functional characterizations of
C1q/TNF family members: adipose-tissue-selective expression patterns,
1010 Arterioscler Thromb Vasc Biol May 2014
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
regulation by PPAR-gamma agonist, cysteine-mediated oligomerizations, combinatorial associations and metabolic functions. Biochem J.
2008;416:161–177.
12.Maeda T, Wakisaka S. CTRP3/cartducin is induced by transforming
growth factor-beta1 and promotes vascular smooth muscle cell proliferation. Cell Biol Int. 2010;34:261–266.
13.Peterson JM, Wei Z, Wong GW. C1q/TNF-related protein-3 (CTRP3),
a novel adipokine that regulates hepatic glucose output. J Biol Chem.
2010;285:39691–39701.
14. Kopp A, Bala M, Buechler C, Falk W, Gross P, Neumeier M, Schölmerich
J, Schäffler A. C1q/TNF-related protein-3 represents a novel and endogenous lipopolysaccharide antagonist of the adipose tissue. Endocrinology.
2010;151:5267–5278.
15. Yi W, Sun Y, Yuan Y, Lau WB, Zheng Q, Wang X, Wang Y, Shang X, Gao E,
Koch WJ, Ma XL. C1q/tumor necrosis factor-related protein-3, a newly identified adipokine, is a novel antiapoptotic, proangiogenic, and cardioprotective
molecule in the ischemic mouse heart. Circulation. 2012;125:3159–3169.
16. Akiyama H, Furukawa S, Wakisaka S, Maeda T. CTRP3/cartducin promotes proliferation and migration of endothelial cells. Mol Cell Biochem.
2007;304:243–248.
17. Maeda T, Jikko A, Abe M, Yokohama-Tamaki T, Akiyama H, Furukawa
S, Takigawa M, Wakisaka S. Cartducin, a paralog of Acrp30/adiponectin, is induced during chondrogenic differentiation and promotes proliferation of chondrogenic precursors and chondrocytes. J Cell Physiol.
2006;206:537–544.
18. Zhao MM, Xu MJ, Cai Y, Zhao G, Guan Y, Kong W, Tang C, Wang X.
Mitochondrial reactive oxygen species promote p65 nuclear translocation
mediating high-phosphate-induced vascular calcification in vitro and in
vivo. Kidney Int. 2011;79:1071–1079.
19. Steitz SA, Speer MY, Curinga G, Yang HY, Haynes P, Aebersold R, Schinke
T, Karsenty G, Giachelli CM. Smooth muscle cell phenotypic transition
associated with calcification: upregulation of Cbfa1 and downregulation
of smooth muscle lineage markers. Circ Res. 2001;89:1147–1154.
20.Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/
Cbfa1: a transcriptional activator of osteoblast differentiation. Cell.
1997;89:747–754.
21.Akiyama H, Furukawa S, Wakisaka S, Maeda T. Cartducin stimulates
mesenchymal chondroprogenitor cell proliferation through both extracellular signal-regulated kinase and phosphatidylinositol 3-kinase/Akt pathways. FEBS J. 2006;273:2257–2263.
22. Byon CH, Javed A, Dai Q, Kappes JC, Clemens TL, Darley-Usmar VM,
McDonald JM, Chen Y. Oxidative stress induces vascular calcification
through modulation of the osteogenic transcription factor Runx2 by AKT
signaling. J Biol Chem. 2008;283:15319–15327.
23. Wildroudt ML, Freeman EJ. Regulation of Akt by arachidonic acid and
phosphoinositide 3-kinase in angiotensin II-stimulated vascular smooth
muscle cells. Biochim Biophys Acta. 2006;1761:11–16.
24. Choi KM, Hwang SY, Hong HC, Yang SJ, Choi HY, Yoo HJ, Lee KW,
Nam MS, Park YS, Woo JT, Kim YS, Choi DS, Youn BS, Baik SH. C
­ 1q/
TNF-related protein-3 (CTRP-3) and pigment epithelium-derived factor
(PEDF) concentrations in patients with type 2 diabetes and metabolic syndrome. Diabetes. 2012;61:2932–2936.
25. Choi HY, Park JW, Lee N, Hwang SY, Cho GJ, Hong HC, Yoo HJ, Hwang
TG, Kim SM, Baik SH, Park KS, Youn BS, Choi KM. Effects of a combined
aerobic and resistance exercise program on C1q/TNF-related ­protein-3
(CTRP-3) and CTRP-5 levels. Diabetes Care. 2013;36:3321–3327.
26. Mendoza FJ, Martinez-Moreno J, Almaden Y, Rodriguez-Ortiz ME, Lopez
I, Estepa JC, Henley C, Rodriguez M, Aguilera-Tejero E. Effect of calcium
and the calcimimetic AMG 641 on matrix-Gla protein in vascular smooth
muscle cells. Calcif Tissue Int. 2011;88:169–178.
27. Speer MY, Li X, Hiremath PG, Giachelli CM. Runx2/Cbfa1, but not loss
of myocardin, is required for smooth muscle cell lineage reprogramming
toward osteochondrogenesis. J Cell Biochem. 2010;110:935–947.
28. Johnson RC, Leopold JA, Loscalzo J. Vascular calcification: pathobiological mechanisms and clinical implications. Circ Res. 2006;99:1044–1059.
29.Lee HL, Woo KM, Ryoo HM, Baek JH. Tumor necrosis factor
alpha increases alkaline phosphatase expression in vascular smooth
muscle cells via MSX2 induction. Biochem Biophys Res Commun.
2010;391:1087–1092.
30.Tintut Y, Patel J, Parhami F, Demer LL. Tumor necrosis factor-alpha
promotes in vitro calcification of vascular cells via the cAMP pathway.
Circulation. 2000;102:2636–2642.
31. Akiyama H, Furukawa S, Wakisaka S, Maeda T. Elevated expression of
CTRP3/cartducin contributes to promotion of osteosarcoma cell proliferation. Oncol Rep. 2009;21:1477–1481.
32.Lu Y, Cederbaum A. The mode of cisplatin-induced cell death in
­CYP2E1-overexpressing HepG2 cells: modulation by ERK, ROS, glutathione, and thioredoxin. Free Radic Biol Med. 2007;43:1061–1075.
33.Shobeiri N, Adams MA, Holden RM. Vascular calcification in animal
models of CKD: a review. Am J Nephrol. 2010;31:471–481.
34.Sutliff RL, Walp ER, El-Ali AM, Elkhatib S, Lomashvili KA, O’Neill
WC. Effect of medial calcification on vascular function in uremia. Am J
Physiol Renal Physiol. 2011;301:F78–F83.
Significance
Vascular calcification is a chronic condition and is associated with high morbidity and mortality of cardiovascular disease. Among various regulators of vascular calcification, adipokines have drawn more attention in recent years. C1q/tumor necrosis factor–related protein-3 (CTRP3),
a newly identified adipokine, has been suggested to play important roles in inflammation and metabolism, but the effect of CTRP3 on vascular
calcification is unknown. The current study provides compelling evidence that CTRP3 promotes phosphate-induced vascular calcification
in vivo, ex vivo, and in vitro. We also demonstrate that CTRP3 promotes vascular calcification by accelerating phosphate-induced osteogenic transition of vascular smooth muscle cells through a reactive oxygen species–extracellular signal–regulated kinase 1/2–­runt-related
transcription factor 2 signaling pathway. Our findings provide new insights into the important roles of CTRP3 in cardiovascular system and
characterize a novel mechanism of adipokine-modulated vascular calcification.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Overexpression of C1q/Tumor Necrosis Factor−Related Protein-3 Promotes
Phosphate-Induced Vascular Smooth Muscle Cell Calcification Both In Vivo and In Vitro
Yun Zhou, Jin-Yu Wang, Han Feng, Cheng Wang, Li Li, Dan Wu, Hong Lei, Hao Li and
Li-Ling Wu
Arterioscler Thromb Vasc Biol. 2014;34:1002-1010; originally published online February 27,
2014;
doi: 10.1161/ATVBAHA.114.303301
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2014 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/34/5/1002
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2014/02/27/ATVBAHA.114.303301.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Supplement Material
Overexpression of CTRP3 Promotes Phosphate-Induced Vascular
Smooth Muscle Cell Calcification Both In Vivo and In Vitro
Yun Zhou*, Jin-Yu Wang*, Han Feng*, Cheng Wang, Li Li, Dan Wu, Hong Lei,
Hao Li, Li-Ling Wu
Department of Physiology and Pathophysiology, Peking University Health
Science Center and Key Laboratory of Molecular Cardiovascular Sciences,
Ministry of Education, Key Laboratory of Cardiovascular Molecular Biology and
Regulatory peptides, Ministry of Health, Beijing, P.R. China.
*These authors contributed equally to this work.
Running title: CTRP3 Promotes Pi-Induced Vascular Calcification
Corresponding author: Li-Ling Wu, Department of Physiology and
Pathophysiology, Peking University Health Science Center, 38 Xueyuan Road,
Haidian District, 100191, Beijing, P.R. China. E-mail: [email protected]
Tel: +86-10-82802403, Fax: +86-10-82802403
Index



Supplemental Table Ⅰ
Supplemental Figure Ⅰ
Supplemental Figure Ⅱ
Supplemental figure legends
Supplemental Figure Ⅰ. Calcified nodule formation and CTRP3
expression in abdominal aortas of control and CRF rats. Representative
alizarin red staining of calcified nodules and immunohistochemistry staining for
CTRP3 in abdominal aortas of control and CRF rats. Bar=25 μm.
Supplemental Figure Ⅱ. Expression of SMA and Runx2 in abdominal
aortas of control and CRF rats. Representative immunohistochemistry
staining for SMA or Runx2 in abdominal aortas of control and CRF rats.
Bar=100 μm.
Material and Methods
Materials and Methods are available in the online-only Data Supplement.
Reagents
Recombinant human globular domain of C1q/tumor necrosis factor-related
protein-3 (CTRP3) was purchased from Aviscera Bioscience (00082-01-100,
Santa Clara, CA). Antibody for CTRP3 was from Abcam (ab36870, Cambridge,
MA). Antibodies for phospho-extracellular signal-regulated kinase 1/2 (sc-7383,
p-ERK1/2), phospho-p38MAPK (sc-166182, p-p38MAPK), phospho-c-Jun
N-terminal kinase (sc-6254, p-JNK), ERK1/2 (sc-292838), p38MAPK (sc-7149),
JNK (sc-7345), and actin (sc-1616) were from Santa Cruz Biotechnology
(Santa Cruz, CA). Antibodies for runt related transcription factor 2 (BS8734,
Runx2), osteopontin (BS1264, OPN), sex determining region Y-box 9 (BS1597,
Sox9）and collagen type II alpha 1(BS1071, COL2A1) were from Bioworld
Technology (Minneapolis, MN). Antibodies for bone morphogenetic protein 2
(18933-1-AP, BMP2), smooth muscle-α-actin (14395-1-AP, SMA), smooth
muscle 22α (10493-1-AP, SM22α) and alkaline phosphatase (11187-1-AP,
ALP) were from ProteinTech Group (Chicago, IL). Adenine (V900471),
PD98059 (P215), U0126 (U120), and N-Acetyl-L-cysteine (A9165, NAC) were
from Sigma-Aldrich (St. Louis, MO). Trypsin, Dulbecco’s Modified Eagle’s
Medium (DMEM), and fetal bovine serum (FBS) were from Invitrogen
(Carlsbad, CA).
Recombinant adenovirus construction
Recombinant adenovirus encoding full-length human CTRP3 (Pubmed No.
NM_030945.2) (Ad-CTRP3) was constructed and amplified according to the
manufacturer’s protocol (BD Biosciences Clontech, CA). Recombinant
adenovirus carrying the gene for green fluorescent protein (Ad-GFP) was used
as a negative control. For in vivo studies, after anesthetization
(ketamine/xylazine, 80/10 mg/kg, intraperitoneal), a single exposure of 6×108
plaque forming units (pfu) of Ad-CTRP3 or Ad-GFP dissolved in 30% pluronic
gel solution was periadventitially delivered to the rat abdominal or common
carotid arteries.
Animal model of chronic renal failure
Eight-week-old male Wistar rats were randomly divided into six groups: control,
chronic renal failure (CRF), CRF+Ad-GFP, and CRF+Ad-CTRP3, n=6-8 per
group. All animals received humane care in compliance with the Institutional
Authority for Laboratory Animal Care of Peking University Health Science
Center. Control rats were fed standard CE-2 chow (containing 1.2% calcium
and 0.6% phosphorus), while CRF rats were fed CE-2 chow containing 0.75%
adenine for 4 or 6 weeks as previously described.1 In adenovirus transfected
groups, Ad-GFP or Ad-CTRP3 were periadventitially delivered to the rat
abdominal arteries before feeding them with adenine diet. After 6 weeks, the
1
rats were euthanized and blood was collected to measure blood urea nitrogen
(BUN), creatinine (Cr), calcium, and phosphate by an autoanalyzer
(Hitachi7180, Hitachi, Tokyo, Japan). Serum level of CTRP3 was determined
with a commercial ELISA kit from Aviscera Bioscience (SK00082-07, Santa
Clara, CA). The abdominal arteries were excised for further analysis.
Arterial ring organ calcification
Arterial ring organ calcification was induced as described previously.2 Briefly, 3
days after adenovirus infection, common carotid arteries were removed from
rats in a sterile manner. After removing the adventitia and endothelium, the
vessels were cut into 2- to 3-mm rings and placed in regular DMEM containing
10% FBS with or without high-Pi (3.8 mmol/L PO43-) at 37°C in 5% CO2 for 6
days, with medium changed every 2 days. After 6 days, the arterial rings were
prepared for quantitative analysis of calcium content by use of a QuantiChrom
Calcium Assay Kit (Biosino Bio-Technology and Science, Beijing) according to
the manufacturers’ instructions. The sections from each common carotid artery
(6 μm) were processed for alizarin red staining and immunohistochemical
analysis.
Cell culture
Rat vascular smooth muscle cells (VSMCs) were obtained by an explant
method as previously described.3 Briefly, medial tissue was separated from
segments of rat aortas. Small pieces of tissue (1 to 2 mm3) were placed in a
10-cm culture dish and cultured for several weeks in DMEM containing 4.5 g/L
of glucose supplemented with 15% FBS, 10 mmol/L sodium pyruvate, 100
U/mL of penicillin, and 100 μg/mL of streptomycin (growing medium) at 37°C in
a humidified atmosphere containing 5% CO2. Cells that had migrated from the
explants were collected and maintained in the growing medium. The cells up to
passage 6 were used for experiments. For drug treatment experiments, 20
μmol/L NAC, 20 nmol/L PD98059, or 10 nmol/L U0126 were added into the
incubation solution respectively for 30 minutes before treatment with 2 μg/mL
CTRP3.
In vitro calcification and quantification of VSMCs
Calcification of VSMCs was induced as previously described.3 Briefly, VSMCs
were grown in 24-well plates and cultured with growing medium in the absence
or presence of 10 mmol/L β-glycerophosphate (βGP calcification medium) for
12 days. The medium and reagents were replenished every 3 days. After
washing with phosphate buffered saline (PBS), VSMCs were treated with 0.6
mol/L HCl overnight at 4°C. After removing the HCl supernatant, the remaining
cell layers were then dissolved in 0.1 mol/L NaOH and 0.1% SDS for protein
concentration analysis. The calcium content in the HCl supernatant was
colorimetrically analyzed by use of a QuantiChrom Calcium Assay Kit and was
normalized to protein content.3
2
Alkaline phosphatase activity assay
VSMCs were seeded in 24-well plates at 1×104/mL. Proteins were extracted
from VSMCs at the required time points by freeze-thawing the cells in 0.1%
Triton X-100 in PBS. Alkaline phosphatase (ALP) activity was measured
colorimetrically as the hydrolysis of ρ-nitrophenyl phosphate with the use of
ALP assay Kit (Wako Pure Chemical Industries, Osaka, Japan) according to
the manufacturers’ instructions. Results were normalized to the levels of total
protein.
Characterization of calcified nodules by alizarin red staining
VSMCs in 24-well plates were washed with PBS 3 times and fixed in 4%
formaldehyde for 10 minutes at room temperature. After washing with PBS,
VSMCs were exposed to 2% alizarin red (aqueous, Sigma) for 5 minutes and
washed with 0.2% acetic acid. Quantification of calcified nodule formation was
analyzed as described previously4.
Immunohistochemical analysis
Vascular specimens were fixed in 4% formaldehyde and embedded in
Tissue-Tek O.C.T. Compound to be frozen in liquid nitrogen. Frozen sections
(6 µm) were stained with the antibodies for CTRP3, SMA, and Runx2 overnight
at 4°C, then with horseradish peroxidase-conjugated secondary antibody for 2
hours at 37°C followed by 3, 3-diaminobenzidine. Nuclei were stained with 4,
6-diamidino-2-phenylindole (Sigma). Negative controls which omitted the
primary antibody were routinely employed. Fluorescence images were
captured by use of the LeicaTCSSP5 confocal system.
Western blot analysis
Rat arteries or cultured VSMCs were homogenized with lysis buffer (containing
50 mM Tris-HCl, 0.1% sodium deoxycholate, 1% Triton X-100, 5 mM EDTA, 5
mM EGTA, 150 mM NaCl, 40 mM NaF, 2.175 mM sodium orthovanadate,
0.1% SDS, 0.1% aprotinin, and 1 mM phenylmethylsulfonyl fluoride, pH 7.2) by
use of a polytron homogenizer. The homogenate was centrifuged at 1000 g for
10 minutes at 4°C, and the protein concentration of the supernatant was
measured by the Bradford method. Equal amounts of proteins (40 μg) were
separated on a 9% SDS-PAGE and transferred to polyvinylidene difluoride
membrane as described previously.5 The membranes were blocked with 5%
non-fat milk for 1 hour at room temperature and then incubated with primary
antibodies and horseradish peroxidase-conjugated secondary antibody. The
immunoreactive bands were visualized by use of an enhanced
chemiluminescence kit (Amersham Biosciences Inc., Piscataway, NJ). The
densities of bands were quantified by use of the LEICA550IW image analysis
system (Leica, Mannheim, Germany).
3
Real-time quantitative RT-PCR (qRT-PCR) and conventional RT-PCR
Total RNA was isolated from VSMCs using Trizol (Invitrogen, Carlsbad, CA)
followed by cDNA synthesis using the First Strand cDNA Synthesis kit
(Fermentas, Burlington, ON, Canada). qRT-PCR was performed using the
forward and reverse primers of sequences (rat): CTRP3 (F)
GGAAAATCAGATACATCCAGCAACC,
(R)
TAGCTCACCTACAAATCGCCCTTAG;
β-actin
(F)
TATCGGCAATGAGCGGTTC,
(R)
AGCACTGTGTTGGCATAGAG.
Amplifications were performed in 35 cycles using an opticon continuous
fluorescence detection system (MJ Research Inc., Waltham, MA, USA) with
SYBR green fluorescence (Molecular Probes, Eugene, OR, USA). Each cycle
consisted of a 45 s at 94°C, a 45 s at 56°C, and a 60 s at 72°C. All data were
quantified by use of the comparative CT method, normalized to β-actin. For
conventional RT-PCR, PCR was performed with Taq DNA polymerase
(Invitrogen, Carlsbad, CA) with thermal cycles of 5 minutes 94°C, 30 cycles of
1 minute 94°C, 1 minute 57°C, 1 minute 72°C, finally followed by 10 minutes
72°C using the forward and reverse primers of sequences (rat): CTRP3 (F)
ATTGCGTTCATGGCTTCTCTA, (R) GCATGGTTGCTGGATGTATCT; BMP2
(F) CAACACCGTGCTCAGCTTCC, (R) ATGTCCTTTACCGTCGTGGC; OPN
(F) GGTTTGCTTTTGCCTGTTCG, (R) GTCCTCATCTGTGGCATCGG; Runx2
(F) GCAAGATGAGCGACGTGAGC, (R) ACGGTAACCACGGTCCCATC; SMA
(F)
AACTGGTATTGTGCTGGACTCTG,
(R)
CTGTTATAGGTGGTTTCGTGGAT;
SM22α
(F)
ATCCAAGCCAGTGAAGGTGC, (R) GACTGTCTGTGAACTCCCTCTTA,
respectively. The PCR products were then resolved by electrophoresis in a
1.5% agarose gel with ethidium bromide staining. Densitometry was
determined in the GeneGenius Gel Imaging System (Syngene, Synoptics, Inc.,
Frederick, MD) and normalized to the internal control of β-actin. All PCR
reactions were performed in triplicate.
Small interfering RNA (siRNA) transfection
VSMCs were cultured to 80% confluence and transfected with small interfering
RNAs (siRNAs) of interest by use of Lipofectamine 2000 (Invitrogen, Carlsbad,
CA) as described previously.6 The potent siRNA for rat CTRP3 (catalog no.
SASI_Rn02_00256341) and Runx2 (catalog no. SASI_Rn02_00297246) were
from Sigma-Aldrich (St. Louis, MO). A scramble siRNA (Sigma-Aldrich) served
as a negative control.
Oxidative stress analysis
Cellular oxidative stress in VSMCs treated with CTRP3 was detected using the
cell permeable fluorogenic probe 2′7′-dichlorodihydrofluorescein diacetate
(GENMED Scientifics, Shanghai, China) that emits green fluorescence upon
oxidation by reactive oxygen species. Cells were examined by Leica TCS SP5
confocal system (Leica, Wetzlar, Germany).
4
Statistical analysis
All Data are presented as mean±standard error of the mean (SEM).
Differences were analyzed by Student’s t test for two groups or one-way
ANOVA for multiple groups, followed by Tukey’s multiple comparison post-hoc
tests by use of GraphPad Prism 5.0 software. A value of P<0.05 was
considered to be significant.
References
1. Yokozawa T, Zheng PD, Oura H, Koizumi F. Animal model of adenine
induced chronic renal failure in rats. Nephron. 1986;44:230-234.
2. Dai XY, Zhao MM, Cai Y, Guan QC, Zhao Y, Guan Y, Kong W, Zhu WG,
Xu MJ, Wang X. Phosphate-induced autophagy counteracts vascular
calcification by reducing matrix vesicle release. Kidney Int.
2013;83:1042-1051.
3. Jono S, Nishizawa Y, Shioi A, Morii H. Parathyroid hormone-related
peptide as a local regulator of vascular calcification. Its inhibitory action on
in vitro calcification by bovine vascular smooth muscle cells. Arterioscler
Thromb Vasc Biol. 1997;17:1135-1142.
4. Ding HT, Wang CG, Zhang TL, Wang K. Fibronectin enhances in vitro
vascular calcification by promoting osteoblastic differentiation of vascular
smooth muscle cells via ERK pathway. J Cell Biochem.
2006;99:1343-1352.
5. Li L, Fan D, Wang C, Wang JY, Cui XB, Wu D, Zhou Y, Wu LL. Angiotensin
II increases periostin expression via Ras/p38 MAPK/CREB and
ERK1/2/TGF-β1 pathways in cardiac fibroblasts. Cardiovasc Res.
2011;91:80-89.
6. Li L, Zhang ZG, Lei H, Wang C, Wu LP, Wang JY, Fu FY, Zhu WG, Wu LL.
Angiotensin II reduces cardiac AdipoR1 expression through AT1
receptor/ROS/ERK1/2/c-Myc pathway. PLoS One. 2013;8:e49915.
5
Supplemental Table Ⅰ. Serum biochemical parameters and body weight of rats
4 week
Control
BUN (mmol/L)
Cr (μmol/L)
6 week
CRF
Control
CRF
CRF+Ad-GFP
CRF+Ad-CTRP3
6.76±0.42
28.26±5.47**
6.38±0.27
44.78±6.07**#
44.86±5.41**#
44.62±2.21**#
51.17±2.69
172.17±28.86**
298.25±37.12**#
297.12±31.73**#
256.29±14.27**#
44.17±2.15
Calcium ( mmol/L)
2.27±0.05
2.31±0.07
2.56±0.06
2.61±0.04
2.58±0.02
2.65±0.04
Phosphorus (mmol/L)
2.27±0.10
3.21±0.28**
2.45±0.06
4.40±0.24**##
4.28±0.31**##
4.42±0.25**##
250 .00±35.99**
225.6±26.17**
228.4±38.36**
1.71±0.36**
1.58±0.29**
1.32±0.49**
Body Weight (g)
Abdominal fat weight (g)
460.40±40.93
5.09±0.36
Rat serum levels of blood urea nitrogen (BUN), creatinine (Cr), calcium, and phosphorus were measured by an autoanalyzer. Values
are mean ± SEM (n=6-8). **P<0.01 vs. the age-marched controls. #P<0.05, ##P<0.01 vs. CRF at 4 weeks.
1