Toxicology 282 (2011) 104–111
Contents lists available at ScienceDirect
Toxicology
journal homepage: www.elsevier.com/locate/toxicol
Ferulic acid protects against carbon tetrachloride-induced liver injury in mice
Hyo-Yeon Kim a , Juhyun Park a , Kwan-Hoo Lee a , Dong-Ung Lee b , Jong-Hwan Kwak a ,
Yeong Shik Kim c , Sun-Mee Lee a,∗
a
School of Pharmacy, Sungkyunkwan University, Suwon 440-746, Republic of Korea
Division of Bioscience, Dongguk University, 707 Seokjang-dong, Gyeongju 780-714, Republic of Korea
c
College of Pharmacy, Seoul National University, Republic of Korea
b
a r t i c l e
i n f o
Article history:
Received 10 December 2010
Received in revised form 21 January 2011
Accepted 23 January 2011
Available online 1 February 2011
Keywords:
Carbon tetrachloride
Ferulic acid
Mitogen-activated protein kinase
NF-␬B
Oxidative stress
a b s t r a c t
Ferulic acid (FA), isolated from the root of Scrophularia buergeriana, is a phenolic compound possessing
antioxidant, anticancer, and antiinflammatory activities. Here, we have investigated the hepatoprotective
effect of FA against carbon tetrachloride (CCl4 )-induced acute liver injury. Mice were treated intraperitoneally with vehicle or FA (20, 40, and 80 mg/kg) 1 h before and 2 h after CCl4 (20 ␮l/kg) injection.
The serum activities of aminotransferases and the hepatic level of malondialdehyde were significantly
higher after CCl4 treatment, while the concentration of reduced glutathione was lower. These changes
were attenuated by FA. The serum level and mRNA expression of tumor necrosis factor-␣ significantly
increased after CCl4 treatment, and FA attenuated these increases. The levels of inducible nitric oxide
synthase and cyclooxygenase-2 protein and mRNA expression after CCl4 treatment were significantly
higher and FA reduced these increases. CCl4 -treated mice showed increased nuclear translocation of
nuclear factor-␬B (NF-␬B), and decreased levels of inhibitors of NF-␬B in cytosol. Also, CCl4 significantly
increased the level of phosphorylated JNK and p38 mitogen-activated protein (MAP) kinase, and nuclear
translocation of activated c-Jun. FA significantly attenuated these changes. We also found that acute CCl4
challenge induced TLR4, TLR2, and TLR9 protein and mRNA expression, and FA significantly inhibited
TLR4 expression. These results suggest that FA protects from CCl4 -induced acute liver injury through
reduction of oxidative damage and inflammatory signaling pathways.
© 2011 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
Carbon tetrachloride (CCl4 ) has been used in investigation of
acute and chronic hepatic injury showing lesions similar to those
seen in most cases of human liver disease (Zhu et al., 2010). Hepatic
injury caused by CCl4 is characterized by acute responses coordinated by cross-talk between hepatocytes and nonparenchymal
cells (Fausto et al., 2006).
CCl4 is responsible for oxidative stress and lipid peroxidation
through cytochrome P450-mediated generation of highly reactive
radicals, leading to eventual damage characterized by hepatocellular necrosis (Taieb et al., 2005). Reactive oxygen species (ROS)
generated from CCl4 stimulate hepatocytes to secrete signals for
activation of the innate immune system, and Kupffer cells exacerbate liver inflammation by generating a variety of ROS and
proinflammatory cytokines (Edwards et al., 1993). Tumor necrosis
factor (TNF)-␣ mediates CCl4 -induced hepatotoxicity by regulating
∗ Corresponding author at: School of Pharmacy, Sungkyunkwan University, 300
Cheoncheon-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Republic of Korea.
Tel.: +82 31 290 7712; fax: +82 31 292 8800.
E-mail address: [email protected] (S.-M. Lee).
0300-483X/$ – see front matter © 2011 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.tox.2011.01.017
innate and adaptive immunity and contributing to inflammatory
processes (Aggarwal, 2003). Most inflammatory responses of TNF␣ are initiated by TNF-␣ receptor 1 (TNFR1), and its activation
by CCl4 induces transcriptional factors, activator protein 1 (AP-1),
and nuclear factor kappa B (NF-␬B). A recent study showed that
inhibition of TNFR1 protects against CCl4 -induced hepatotoxicity
(Shibata et al., 2008).
Toll-like receptors (TLRs) are one of the pattern-recognition
receptors (PRRs) that recognize pathogen-associated molecular
patterns (PAMPs) (Takeda et al., 2003). Activation of TLRs plays a
pivotal role in regulation of the innate immune system in infectious and inflammatory disease states (O’Neill, 2003). In the liver,
TLRs are expressed on Kupffer cells, hepatocytes, hepatic stellate
cells, and dendritic cells, maintaining homeostasis of the hepatic
environment (Kuniyasu et al., 2004). Recently, an association of
TLRs signaling with infection, alcoholic liver disease, ischemiareperfusion injury, and liver regeneration has been demonstrated
(Seki and Brenner, 2008). Although the mechanism is unknown,
TLR4 is upregulated by CCl4 and steadily increases during the period
of administration (Hua et al., 2007).
Scrophularia buergeriana has been used as an oriental medicine
for treatment of fever, neuritis, pharyngitis, and laryngitis (Kim and
Kim, 2000; Kim et al., 2002). Phenylpropanoids from the root of
H.-Y. Kim et al. / Toxicology 282 (2011) 104–111
S. buergeriana have significant hepatoprotective activity in vitro
(Lee et al., 2002). Ferulic acid (FA), isolated from the root of S.
buergeriana, is a phenolic compound that is abundant in many
herbal medicines (Graf, 1992). It has potent antioxidative activity
by reduction of ROS and inhibition of lipid peroxidation (Srinivasan
et al., 2005, 2007). Recently, FA was shown to prevent amyloid ␤induced neurotoxicity by regulation of mitogen-activated protein
(MAP) kinases in vivo (Jin et al., 2005; Ma et al., 2010), and also to
exhibit antiinflammatory and antinociceptive activities by inhibition of cyclooxygenase (COX) in chronic animal models (Ronchetti
et al., 2009). It protects CCl4 -induced chronic injury by improving
the antioxidant status in liver (Srinivasan et al., 2005).
This study investigated the hepatoprotective effect and the specific molecular mechanisms of FA, particularly on the extent of
oxidative damage and inflammation.
2. Materials and methods
2.1. Animals and treatment regimens
Male ICR mice weighing 25–30 g were fasted overnight but given tap water
ad libitum. All animals were treated humanely under the Sungkyunkwan University Animal Care Committee Guidelines. The animals were randomly assigned to
7 groups of 8 animals per group. CCl4 was dissolved in olive oil and administered intraperitoneally (20 ␮l/kg). FA was generously provided by Dong-Ung Lee
(Dongguk University, Gyeongju, Korea). The vehicle-treated CCl4 group received 10%
Tween-80 saline (10 ml/kg) and mice in other groups were treated intraperitoneally
with FA (20, 40, and 80 mg/kg) or silymarin (positive control, 800 mg/kg) 1 h before
and 2 h after CCl4 injection. The dose of FA was selected based on previous reports
(Maurya et al., 2005). Mice were randomly divided into seven groups: (a) vehicletreated control; (b) FA (80 mg/kg)-treated control; (c) vehicle + CCl4 ; (d)–(f) FA (20,
40 and 80 mg/kg, respectively) + CCl4 ; (g) silymarin + CCl4 . Because there were no
differences in any of the parameters between vehicle-treated control and FA-treated
control groups, the results of group (a) and (b) were pooled and referred to as the control. Blood was collected 24 h after CCl4 administration. Each liver was isolated and
stored at −75 ◦ C for analysis, except for the left lobe, which was used for histological
studies.
2.2. Serum aminotransferase activities
ChemiLab ALT and AST assay kits (IVDLab Co., Ltd., Uiwang, Korea) were used
for determination of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities, respectively.
2.3. Lipid peroxidation and hepatic glutathione contents
The steady-state level of malondialdehyde (MDA), a lipid peroxidation end
product, was analyzed by spectrophotometric measurement of the level of thiobarbituric acid reactive substances (TBARS) at 535 nm using 1,1,3,3-tetraethoxypropane
(Sigma, St. Louis, MO, USA) as the standard (Buege and Aust, 1978). The level of
total glutathione was measured spectrophotometrically at 412 nm, with yeast glutathione reductase, 5,5 -dithio-bis(2-nitrobenzoic acid), and NADPH (Tietze, 1969).
The oxidized glutathione (GSSG) level was measured using the same method in the
presence of 2-vinylpyridine (Griffith, 1980), and the reduced glutathione (GSH) level
was calculated as the difference between the levels of total glutathione and GSSG,
and the ratio of GSH to GSSH was determined.
105
2.6. Western blot
Freshly isolated liver tissue was homogenized in lysis buffer for preparation of whole protein extracts. NE-PER® (Pierce Biotechnology, Rockford, IL, USA)
was used for extraction of nuclear proteins and cytosolic proteins according to
the manufacturer’s instructions. The BCA Protein Assay kit (Pierce Biotechnology,
USA) was used for determination of protein concentrations. Protein samples were
loaded on 10–15% polyacrylamide gels, and were then separated by sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE) and transferred to PVDF
membranes (Millipore, MA, USA) using the Semi-Dry Trans-Blot Cell (Bio-Rad Laboratories, Hercules, CA, USA). After transfer, the membranes were washed with 0.1%
Tween-20 in 1× Tris Buffered Saline (TBS/T) and blocked for 1 h at room temperature
with 5% (w/v) skim milk powder in TBS/T. The blots were then incubated overnight at
4 ◦ C with primary antibodies. The next day, the blots were incubated in appropriate
secondary antibodies and detected using an ECL detection system (iNtRON Biotechnology Co., Ltd., Korea), according to the manufacturer’s instructions. ImageQuantTM
TL software (Amersham Biosciences/GE Healthcare, Piscataway, NJ, USA) was used
for densitometric evaluation of visualized immuno-reactive bands. Primary antibodies against inducible nitric oxide synthase (iNOS) (Transduction Laboratories,
San Jose, CA, USA; 1:1000 dilution), COX-2 (Cayman, Ann Arbor, MI, USA; 1:1000
dilution), TLR4 (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:1000), TLR2 (Santa
Cruz Biotechnology, USA; 1:1000), p-p38, p-JNK, total p38 and total JNK (Cell Signaling Technology Inc., Beverly, MA, USA; 1:1000), p-ERK and total ERK (Cell Signaling
Technology Inc., USA; 1:2000), I␬B-␣ (Santa Cruz Biotechnology, USA; 1:500), NF␬B/p65 (Santa Cruz Biotechnology, USA; 1:1000) and c-Jun p39 phosphorylated
on serine-63 (Santa Cruz Biotechnology, USA; 1:500) were used and signals were
normalized to that of ␤-actin (Sigma, USA; 1:2500 dilution) or lamin B1 (Abcam,
Cambridge, UK; 1:2500).
2.7. Total RNA extraction and reverse transcription polymerase chain reaction
(RT-PCR)
Total RNA was extracted (Chomczynski and Sacchi, 1987) and first strand cDNA
was synthesized by reverse transcription of the total RNA using the oligo(dT)12–18
primer and SuperScriptTM II RNase H− Reverse Transcriptase (Invitrogen TechLineTM , Carlsbad, CA, USA). The PCR reaction was carried out in a 20-␮l reaction
volume with a diluted cDNA sample. Final reaction concentrations were as follows:
sense and antisense primers (Table 1), 10 pmol; dNTP mix, 250 ␮M; ×10 PCR buffer;
and Ex Taq DNA polymerase, 0.5 U/reaction. PCR was carried out with an initial
denaturation step at 94 ◦ C for 5 min and a final extension step at 72 ◦ C for 7 min in
the GeneAmp 2700 thermocycler (Applied Biosystems, Foster City, CA, USA). Amplification cycling conditions were as follows: for TNF-␣, 28 cycles at 94 ◦ C for 30 s,
65 ◦ C for 30 s, and 72 ◦ C for 60 s; for iNOS, 35 cycles at 94 ◦ C for 30 s, 65 ◦ C for 30 s,
and 72 ◦ C for 30 s; for TLR4, 30 cycles at 94 ◦ C for 30 s, 56 ◦ C for 30 s, and 72 ◦ C for
60 s; for TLR2, 25 cycles at 94 ◦ C for 30 s, 64 ◦ C for 30 s, and 72 ◦ C for 30 s; for TLR9,
40 cycles at 94 ◦ C for 30 s, 58 ◦ C for 30 s, and 72 ◦ C for 30 s; for COX-2 and ␤-actin, 35
cycles and 25 cycles at 94 ◦ C for 30 s, 56 ◦ C for 30 s, and 72 ◦ C for 30 s, respectively.
After PCR, 10 ␮l samples of the PCR products were electrophoresed through 1.5%
agarose gel, stained with ethidium bromide, and visualized by ultraviolet illumination. Semiquantitative analysis of the intensity of each PCR product was performed
using SLB Mylmager (UVP Inc., Upland, CA, USA) and ImageQuantTM TL (Amersham
Biosciences/GE Healthcare, USA).
2.8. Statistical analysis
The overall significance of the results was examined using one-way analysis
of variance (ANOVA). Differences between the groups were considered statistically
significant at P < 0.05 with the appropriate Bonferroni correction made for multiple
comparisons. Results are presented as mean ± S.E.M.
3. Results
2.4. Histological analysis
Twenty-four hours after CCl4 injection, the anterior portion of the left lateral
lobe of the liver was sectioned and used for histological analysis. The tissue was fixed
by immersion in 10% neutral-buffered formalin. The sample was then embedded in
paraffin, sliced into 5-␮m sections, stained with hematoxylin-eosin (H&E), followed
by blinded histological assessment. The extent of hepatic damage was evaluated on
H&E slides. The histological changes were scored according to the following criteria:
0, absent; 1, mild; 2, moderate; and 3, severe (Camargo et al., 1997). Histological
changes were evaluated in non-consecutive, randomly chosen ×400 histological
fields.
2.5. Serum cytokine levels
Circulating levels of TNF-␣ were quantified at 24 h after CCl4 injection with a
commercial mouse ELISA kit (BD Biosciences, San Jose, CA, USA) according to the
manufacturer’s instructions.
3.1. Effect of FA on CCl4 -induced liver injury
As shown in Table 2, serum ALT activity averaged 29.6 ± 3.9 U/l
in the control group. The vehicle-treated CCl4 group showed significant increase in serum ALT activity at 24 h after CCl4 injection
(8349 ± 141 U/l, P < 0.01). Treatment with FA, at doses of 40 mg/kg
and 80 mg/kg, attenuated the increase in ALT activity to approximately 78.2% and 66.5% of that in the vehicle-treated CCl4 group,
respectively. Consistent with the ALT data, the serum level of AST
was significantly increased from 36.8 ± 5.1 U/l to 7309 ± 253 U/l,
and this increase was reduced by 40 mg/kg and 80 mg/kg of FA. Liver
histopathology analysis was performed for examination of CCl4 induced hepatocellular damage. The histological features shown
in Fig. 1A demonstrate the normal liver lobular architecture and
106
H.-Y. Kim et al. / Toxicology 282 (2011) 104–111
Table 1
PCR primers used in this study and the amplified product.
Gene
Accession no.
Primer sequences (5 –3 )
Product length (bp)
TNF-␣
NM 013693
Sense: AGCCCACGTCGTAGCAAACCACCAA
Antisense: AACACCCATTCCCTTCACAGAGCAAT
447
iNOS
NM 010927
Sense: AAGCTGCATGTGACATCGACCCGT
Antisense: GCATCTGGTAGCCAGCGTACCGG
598
COX-2
NM 011198
Sense: ACTCACTCAGTTTGTTGAGTCATTC
Antisense: TTTGATTAGTACTGTAGGGTTAATG
583
TLR4
NM 021297
Sense: AGTGGGTCAAGGAACAGAAGCA
Antisense: CTTTACCAGCTCATTTCTCACC
311
TLR2
NM 011905
Sense: TGGAGACGCCAGCTCTGGCTCA
Antisense: CAGCTTAAAGGGCGGGTCAGAG
380
TLR9
NM 031178
Sense: CCAGACGCTCTTCGAGAAC
Antisense: GTTATAGAAGTGGCGGTTGT
319
␤-Actin
X03672
Antisense: TGTCATCTCCAGAGTGTTC
Sense: TGGAATCCTGTGGCATCCATGAAA
348
Table 2
Effect of FA on the serum level of aminotransferases in mice after CCl4 treatment.
Group
Dose (mg/kg)
Control
CCl4
Vehicle
FA
AST (U/l)
36.8 ± 5.1
8349
7599
6532
5551
5407
20
40
80
800
Silymarin
ALT (U/l)
29.6 ± 3.9
±
±
±
±
±
141**
225**
370** , ##
496** , ##
207** , ##
7309
6748
6146
2384
4581
±
±
±
±
±
253**
374**
374** , #
197** , ##
367** , ##
The results are presented as mean ± S.E.M. of 8–10 animals per group.
**
Denotes significant differences compared with the control group (P < 0.01).
#
Denotes significant differences compared with the vehicle-treated CCl4 group
(P < 0.05).
##
Denotes significant differences compared with the vehicle-treated CCl4 group
(P < 0.01).
cell structure in the control group. In contrast, hepatocyte ballooning and necrosis were observed in the vehicle-treated CCl4 group
with multiple areas of portal inflammation as well as moderate
increase in inflammatory cell infiltration (Fig. 1B). These pathological changes were attenuated by 80 mg/kg of FA (Fig. 1C).
3.2. Effect of FA on hepatic MDA and GSH/GSSG ratio after CCl4
exposure
The lipid peroxidation status and GSH contents in liver are
shown in Table 3. A significant increase in the level of MDA
was observed in the vehicle-treated CCl4 group (P < 0.01) compared with the control group. Treatment with FA at 40 mg/kg and
80 mg/kg significantly decreased the level of lipid peroxidation
products in the liver compared with the vehicle-treated CCl4 group
(76.3% and 75.1%, respectively). CCl4 -induced oxidative stress led
to a significant decrease in hepatic GSH and the ratio of GSH to
GSSG. The decrease in the ratio of GSH to GSSG was attenuated by
40 mg/kg and 80 mg/kg of FA (P < 0.01, respectively).
3.3. Effect of FA on serum TNF-˛
The serum level of TNF-␣ was about 18.3 ± 7.0 pg/ml in the
control group (Fig. 2A). In contrast, CCl4 -treated mice showed a significantly increased level of serum TNF-␣; however, this increase
was markedly decreased by administration of FA (P < 0.01).
3.4. Effect of FA on inflammation in liver
Levels of COX-2 and iNOS protein expression in the liver were
markedly increased at 24 h after CCl4 administration (Fig. 2B).
Increases in COX-2 and iNOS protein levels were significantly attenuated by FA (P < 0.05 and <0.01, respectively). Accordingly, the
levels of TNF-␣, COX-2, and iNOS mRNA in the vehicle-treated CCl4
group were 3.4-, 3.4-, and 2.4-fold higher than that of the control
level, respectively (Fig. 3). Increases in TNF-␣, COX-2, and iNOS
mRNA expression were significantly suppressed by FA (P < 0.01).
Table 3
Effect of FA on CCl4 -induced oxidative stress.
Group
Control
CCl4
Vehicle
FA
Silymarin
Dose (mg/kg)
MDA (nmol/mg protein)
0.378 ± 0.016
20
40
80
800
0.518
0.477
0.395
0.389
0.400
±
±
±
±
±
0.036**
0.046
0.031##
0.019##
0.018##
GSH/GSSG ratio
6.33 ± 0.45
2.38
3.12
4.03
5.65
6.60
±
±
±
±
±
0.30**
0.42**
0.31** , #
0.55##
0.48##
The results are presented as mean ± S.E.M. of 8–10 animals per group.
**
Denotes significant differences (P < 0.01) compared with the control group.
#
Denotes significant differences (P < 0.05) compared with the vehicle-treated
CCl4 group.
##
Denotes significant differences (P < 0.01) compared with the vehicle-treated
CCl4 group.
3.5. Effect of FA on MAP Kinases
We attempted to determine whether FA affects JNK phosphorylation. CCl4 significantly increased the levels of JNK
phosphorylation (JNK1 and JNK2, respectively). As shown in Fig. 4,
the level of phospho-JNK1 (p-JNK1) was significantly decreased by
FA, while phopsho-JNK2 (p-JNK2) was not affected. Also, the levels
of JNK protein were similar in all groups. Activated-p38 was not
detected in the control liver; however, the level of p-p38 protein
was significantly increased in the vehicle-treated CCl4 group. Treatment with FA markedly decreased the level of p-p38. The levels of
p38 protein were similar in all groups, showing that the decrease
in activated p38 was not due to degradation of existing protein.
H.-Y. Kim et al. / Toxicology 282 (2011) 104–111
107
Fig. 1. Histological features (A)–(D) and histopathologic grading (E) of liver sections stained with H&E 24 h after CCl4 treatment. Typical images were chosen from each
experimental group (original magnification ×400). (A) The control group, showing normal hepatic architecture; (B) the vehicle-treated CCl4 group, showing hepatocellular
necrosis with extensive fat droplets and inflammatory infiltration; (C) FA 80 mg/kg + CCl4 group and (D) silymarin 800 mg/kg + CCl4 group, showing mild hepatocellular
necrosis and inflammatory infiltration. Scale bar = 25 ␮m (arrow, hepatocellular necrosis; arrowhead, infiltration of inflammatory cells). The histological changes were scored
according to the following criteria: 0, absent; 1, mild; 2, moderate; and 3, severe hepatocellular necrosis and inflammatory infiltration. * and ** denote significant differences
(P < 0.05 and <0.01) compared with the control group; # and ## denote significant differences (P < 0.05 and <0.01) compared with the vehicle-treated CCl4 group.
3.6. Effect of FA on AP-1 and NF-B
3.7. Effect of FA on protein and mRNA expression of TLRs
To determine the role of FA in transcriptional regulation, nuclear
translocation of AP-1/c-Jun and NF-␬B/p65 were measured. As
shown in Fig. 5, the nuclear levels of activated AP-1/c-Jun (p-cJun) and NF-␬B/p65 were increased at 24 h after CCl4 treatment,
and these increases were attenuated by FA (P < 0.01, respectively).
The amount of TLR4 and TLR2 protein in the liver was significantly increased at 24 h after CCl4 administration, and the increase
in TLR4 protein was attenuated by FA (Fig. 6A). After administration of CCl4 , the levels of TLR4 and TLR2 mRNA expression were
markedly increased (Fig. 6B). Increases in TLR4 and TLR2 mRNA
expression were markedly attenuated by FA.
108
H.-Y. Kim et al. / Toxicology 282 (2011) 104–111
Fig. 3. Effects of FA on mRNA expression of inflammatory mediators. The results
are presented as mean ± S.E.M. of 8–10 animals per group. TNF-␣, COX-2, and iNOS
mRNA expression in the liver were measured by RT-PCR analysis at 24 h after CCl4
injection. * and ** denote significant differences (P < 0.05 and <0.01) compared with
the control group; ## denotes significant differences (P < 0.01) compared with the
vehicle-treated CCl4 group.
4. Discussion
Fig. 2. Effects of FA on serum level of TNF-␣ (A), and protein expression of COX-2
and iNOS (B). The results are presented as mean ± S.E.M. of 8–10 animals per group.
The serum concentration of TNF-␣ was determined by ELISA, and COX-2 and iNOS
protein expression were measured by western blot at 24 h after CCl4 injection. **
denotes significant differences (P < 0.01) compared with the control group; # and
##
denote significant differences (P < 0.05 and <0.01) compared with the vehicletreated CCl4 group.
Acute liver diseases constitute a global concern, and medical
treatments for these diseases are often difficult to manage and have
limited efficacy. Therefore, there has been considerable interest in
the role of complementary and alternative medicines for treatment
of liver diseases (Seeff et al., 2001). Development of therapeutically effective agents from natural products may reduce the risk of
toxicity when the drug is used clinically.
CCl4 is used as an experimental model of severe hepatic damage
by generation of oxidative stress and activation of immune cells,
which can lead to architectural and functional alteration (Hayden
and Ghosh, 2008). As a result of hepatic injury, serum ALT and AST
levels showed a marked increase after CCl4 injection; however,
Fig. 4. Effects of FA on MAP kinase activation. The results are presented as mean ± S.E.M. of 8–10 animals per group. P38, ERK and JNK activation in the liver were measured
by western blot analysis at 24 h after CCl4 injection. * and ** denote significant differences (P < 0.05 and <0.01) compared with the control group; # and ## denote significant
differences (P < 0.05 and <0.01) compared with the vehicle-treated CCl4 group.
H.-Y. Kim et al. / Toxicology 282 (2011) 104–111
109
Fig. 5. Effects of FA on NF-␬B and p-c-Jun nuclear translocation. The results are presented as mean ± S.E.M. of 8–10 animals per group. Western blot analysis for NF-␬B
and p-c-Jun was performed on the nuclear extracts from liver at 24 h after CCl4 injection. ** denotes significant differences (P < 0.01) compared with the control group;
##
denotes significant differences (P < 0.01) compared with the vehicle-treated CCl4
group.
these increases were attenuated by FA. Histological observations
of the livers strongly support the hepatoprotective effect of FA.
CCl4 caused various histological changes to the liver, including cell
necrosis, fatty metamorphosis in adjacent hepatocytes, ballooning degeneration, and infiltration of lymphocytes and Kupffer cells.
These changes were significantly attenuated by FA. These results
indicate that FA may have potential clinical application for treatment of liver diseases.
It is generally accepted that CCl4 -induced hepatotoxicity is the
result of reductive dehalogenation. The trichloromethyl radical is
capable of binding to lipids, which subtracts a hydrogen atom from
fatty acid to form a radical leading to chain lipid peroxidation
(Sipes et al., 1977). Previous studies of the mechanism of CCl4 induced liver injury have reported that GSH plays a key role in
detoxifying the toxic metabolites of CCl4 and that hepatocellular
necrosis begins when the GSH reservoir is depleted (Williams and
Burk, 1990). In the present study, FA exhibited protective effects
by reducing CCl4 -mediated oxidative stress through decreased production of free radical derivatives, as evidenced by the decreased
MDA level. Furthermore, FA attenuated hepatic glutathione depletion after CCl4 injection. These results suggest that the antioxidant
properties may be one mechanism through which FA protects
against liver damage mediated by CCl4 .
CCl4 produces ROS that not only directly cause damage to tissues, but also initiate inflammation. Redox change activates Kupffer
cell by the NADPH oxidase pathway or intracellular ROS-dependent
kinase activation under pathological conditions (McMullan and
Brown, 2009). Kupffer cells produce subsequently proinflammatory cytokines, and activate other nonparenchymal cells involved
in liver inflammation. TNF-␣ is produced by resident macrophages
after CCl4 administration and subsequently stimulates the release
of cytokines from macrophages and induces phagocyte oxidative metabolism and NO production (Morio et al., 2001). NO is
a highly reactive oxidant that is produced through iNOS, and it
Fig. 6. Effects of FA on protein and mRNA expression of TLRs. The results are presented as mean ± S.E.M. of 8–10 animals per group. TLR4 and TLR2 protein in the liver
were measured by western blot analysis and TLR4, TLR2 and TLR9 mRNA expression
was determined by RT-PCR at 24 h after CCl4 injection. * and ** denote significant
differences (P < 0.05 and <0.01) compared with the control group; # and ## denote
significant differences (P < 0.05 and <0.01) compared with the vehicle-treated CCl4
group.
can augment oxidative stress by reacting with ROS and forming
peroxynitrite (Rodenas et al., 1995). Another mediator of CCl4 induced hepatic inflammation is COX-2, which is induced by
proinflammatory cytokines, leading to formation of proinflammatory substrates from arachidonic acid (Planaguma et al., 2005;
Vila-del Sol and Fresno, 2005). We observed increases in the
serum level of TNF-␣ and its mRNA expression, which were attenuated by FA. CCl4 also increased iNOS and COX-2 protein and
110
H.-Y. Kim et al. / Toxicology 282 (2011) 104–111
mRNA expression in the liver and these increases were significantly attenuated by FA. Our results suggest that FA suppresses
CCl4 -induced production of inflammatory mediators at the transcriptional level.
TNF-␣ mediates CCl4 -induced hepatotoxicity by inflammatory
signaling pathways (Aggarwal, 2003). Under normal conditions,
TNF-␣ exists as a type II transmembrane protein; however, it
is released in soluble form by metalloprotease TNF-␣ converting
enzyme after cellular stress (Wajant et al., 2003). TNF-␣ interacts
with two different receptors, TNFR1 and TNFR2, to exert its biological activities, causing activation of MAP kinases and NF-␬B (Hayden
and Ghosh, 2008). NF-␬B, a transcription factor, regulates expression of several genes related to infection and inflammation. NF-␬B
signaling increases response to CCl4 , and a number of NF-␬B targets
mediate CCl4 -induced liver injury (Shan et al., 2008). In a normal
state, NF-␬B is located in cytosol, and bound to I␬B. In response
to stimuli, I␬B kinase (IKK) complex is activated and phosphorylates I␬B, leading to nuclear translocation of NF-␬B (Sun and Karin,
2008). We observed the decrease in cytosolic I␬B (data not shown)
and increased nuclear translocation of the p65 subunit, and these
alterations were attenuated by FA.
The MAP kinase family plays important roles in regulation of cell
proliferation and cell death in response to various cellular stresses.
During CCl4 challenge, oxidative stress and inflammatory cytokines
activate MAP kinase kinases, leading to phosphorylation of JNK
and p38 (Iida et al., 2007). The major target of JNK and p38 is
the AP-1, which is composed of complexes of JUN, FOS, and ATF
proteins, and activation of AP-1 mediates ROS-induced hepatocellular death (Czaja, 2003; Karin, 1995). On the other hand, ERK1/2
is involved in survival signals by regulating cell proliferation after
partial hepatectomy or CCl4 intoxication (Taniguchi et al., 2004).
We observed increased levels of activated ERK1/2, JNK, and p38
MAP kinases after CCl4 administration. FA attenuated increases in
activated JNK and p38 MAP kinase, while it did not affect p-ERK1/2.
We observed that CCl4 causes nuclear translocation of activated cJun, and FA treatment decreased the nuclear level of p-c-Jun. Taken
together, our results provide evidence that FA inhibits activation
of JNK and p38 MAP kinases and transactivation of AP-1 and NF␬B.
TLRs, a member of the pattern recognition receptor family,
sense PAMPs for host defense; however, endogenous components
from necrotic cells referred to damage to associated molecular
patterns (DAMPs), were recently shown to activate TLR-mediated
signals associated with hepatic ischemia/reperfusion, regeneration, and alcoholic liver disease (Akira and Takeda, 2004). In the
liver, parenchymal and nonparenchymal cells express TLR family
for mediating inflammation under pathological conditions (Thobe
et al., 2007). TLR4 mutant mice showed similar injury after CCl4
challenge compared to the wild type, indicating that TLR4 is not
involved in the initial phase of liver injury after CCl4 (Su et al., 2004).
Recent study has demonstrated that TLRs are upregulated during
the “first hit”, and this may induce the “second hit” on the liver with
augmentation of inflammation by TLR–ligand interaction (Kanno
et al., 2009; Kreeft et al., 2009). In the present study, we observed
that CCl4 significantly increases TLR4 protein and mRNA expression
in liver, and this increase was attenuated by FA. Our study demonstrated for the first time that acute CCl4 injection increased levels of
TLR2 and TLR9 protein and mRNA expression in the liver. Of particular interest, FA reduced TLR2 mRNA expression, but did not affect
TLR2, TLR9 proteins, and TLR9 mRNA expression. Therefore, the
protective effects of FA against CCl4 -induced hepatotoxicity may
be due to inhibition of TLR4 expression.
This study provides evidence that FA may offer an alternative
for prevention of acute liver diseases. Overall, it appears that FA
prevents CCl4 -induced hepatotoxicity by suppression of oxidative
stress and inflammatory signaling pathways.
Acknowledgement
This work was supported by a grant from the Korea Food and
Drug Administration (Studies on the Identification of Efficacy of
Biologically Active Components from Oriental Herbal Medicines).
References
Aggarwal, B.B., 2003. Signalling pathways of the TNF superfamily: a double-edged
sword. Nat. Rev. Immunol. 3, 745–756.
Akira, S., Takeda, K., 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4,
499–511.
Buege, J.A., Aust, S.D., 1978. Microsomal lipid peroxidation. Methods. Enzymol. 52,
302–310.
Camargo Jr., C.A., Madden, J.F., Gao, W., Selvan, R.S., Clavien, P.A., 1997. Interleukin-6
protects liver against warm ischemia/reperfusion injury and promotes hepatocyte proliferation in the rodent. Hepatology 26, 1513–1520.
Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,
156–159.
Czaja, M.J., 2003. The future of GI and liver research: editorial perspectives. III.
JNK/AP-1 regulation of hepatocyte death. Am. J. Physiol. Gastrointest. Liver Physiol. 284, G875–879.
Edwards, M.J., Keller, B.J., Kauffman, F.C., Thurman, R.G., 1993. The involvement
of Kupffer cells in carbon tetrachloride toxicity. Toxicol. Appl. Pharmacol. 119,
275–279.
Fausto, N., Campbell, J.S., Riehle, K.J., 2006. Liver regeneration. Hepatology 43,
S45–53.
Graf, E., 1992. Antioxidant potential of ferulic acid. Free Radic. Biol. Med. 13, 435–448.
Griffith, O.W., 1980. Determination of glutathione and glutathione disulfide using
glutathione reductase and 2-vinylpyridine. Anal. Biochem. 106, 207–212.
Hayden, M.S., Ghosh, S., 2008. Shared principles in NF-kappaB signaling. Cell 132,
344–362.
Hua, J., Qiu de, K., Li, J.Q., Li, E.L., Chen, X.Y., Peng, Y.S., 2007. Expression of Toll-like
receptor 4 in rat liver during the course of carbon tetrachloride-induced liver
injury. J. Gastroenterol. Hepatol. 22, 862–869.
Iida, C., Fujii, K., Kishioka, T., Nagae, R., Onishi, Y., Ichi, I., Kojo, S., 2007. Activation of mitogen activated protein kinase (MAPK) during carbon tetrachloride
intoxication in the rat liver. Arch. Toxicol. 81, 489–493.
Jin, Y., Yan, E.Z., Fan, Y., Zong, Z.H., Qi, Z.M., Li, Z., 2005. Sodium ferulate prevents amyloid-beta-induced neurotoxicity through suppression of p38 MAPK
and upregulation of ERK-1/2 and Akt/protein kinase B in rat hippocampus. Acta
Pharmacol. Sin. 26, 943–951.
Kanno, N., Nakamura, T., Yamanaka, M., Kouda, K., Tajima, F., 2009. Low-echoic
lesions underneath the skin in subjects with spinal-cord injury. Spinal Cord 47,
225–229.
Karin, M., 1995. The regulation of AP-1 activity by mitogen-activated protein kinases.
J. Biol. Chem. 270, 16483–16486.
Kim, S.R., Kim, Y.C., 2000. Neuroprotective phenylpropanoid esters of rhamnose
isolated from roots of Scrophularia buergeriana. Phytochemistry 54, 503–509.
Kim, S.R., Sung, S.H., Jang, Y.P., Markelonis, G.J., Oh, T.H., Kim, Y.C., 2002. E-pmethoxycinnamic acid protects cultured neuronal cells against neurotoxicity
induced by glutamate. Br. J. Pharmacol. 135, 1281–1291.
Kreeft, A., Lohuis, P.J., Smeele, L.E., 2009. Stent repair of an anastomotic pseudoaneurysm of the carotid artery after free fibula transplantation. Br. J. Oral.
Maxillofac. Surg. 47, 225–227.
Kuniyasu, Y., Marfani, S.M., Inayat, I.B., Sheikh, S.Z., Mehal, W.Z., 2004. Kupffer cells
required for high affinity peptide-induced deletion, not retention, of activated
CD8+ T cells by mouse liver. Hepatology 39, 1017–1027.
Lee, E.J., Kim, S.R., Kim, J., Kim, Y.C., 2002. Hepatoprotective phenylpropanoids from
Scrophularia buergeriana roots against CCl(4)-induced toxicity: action mechanism and structure–activity relationship. Planta Med. 68, 407–411.
Ma, Z.C., Hong, Q., Wang, Y.G., Tan, H.L., Xiao, C.R., Liang, Q.D., Cai, S.H., Gao, Y.,
2010. Ferulic acid attenuates adhesion molecule expression in gamma-radiated
human umbilical vascular endothelial cells. Biol. Pharm. Bull. 33, 752–758.
Maurya, D.K., Salvi, V.P., Nair, C.K., 2005. Radiation protection of DNA by ferulic acid
under in vitro and in vivo conditions. Mol. Cell. Biochem. 280, 209–217.
McMullan, J.B., Brown, M.J., 2009. A qualitative model of mortality in honey bee
(Apis mellifera) colonies infested with tracheal mites (Acarapis woodi). Exp.
Appl. Acarol. 47, 225–234.
Morio, L.A., Chiu, H., Sprowles, K.A., Zhou, P., Heck, D.E., Gordon, M.K., Laskin, D.L.,
2001. Distinct roles of tumor necrosis factor-alpha and nitric oxide in acute liver
injury induced by carbon tetrachloride in mice. Toxicol. Appl. Pharmacol. 172,
44–51.
O’Neill, L.A., 2003. Therapeutic targeting of Toll-like receptors for inflammatory and
infectious diseases. Curr. Opin. Pharmacol. 3, 396–403.
Planaguma, A., Claria, J., Miquel, R., Lopez-Parra, M., Titos, E., Masferrer, J.L., Arroyo,
V., Rodes, J., 2005. The selective cyclooxygenase-2 inhibitor SC-236 reduces
liver fibrosis by mechanisms involving non-parenchymal cell apoptosis and
PPARgamma activation. FASEB J. 19, 1120–1122.
Rodenas, J., Mitjavila, M.T., Carbonell, T., 1995. Simultaneous generation of nitric
oxide and superoxide by inflammatory cells in rats. Free Radic. Biol. Med. 18,
869–875.
H.-Y. Kim et al. / Toxicology 282 (2011) 104–111
Ronchetti, D., Borghi, V., Gaitan, G., Herrero, J.F., Impagnatiello, F., 2009. NCX 2057,
a novel NO-releasing derivative of ferulic acid, suppresses inflammatory and
nociceptive responses in in vitro and in vivo models. Br. J. Pharmacol. 158,
569–579.
Seeff, L.B., Lindsay, K.L., Bacon, B.R., Kresina, T.F., Hoofnagle, J.H., 2001. Complementary and alternative medicine in chronic liver disease. Hepatology 34, 595–603.
Seki, E., Brenner, D.A., 2008. Toll-like receptors and adaptor molecules in liver disease: update. Hepatology 48, 322–335.
Shan, W., Nicol, C.J., Ito, S., Bility, M.T., Kennett, M.J., Ward, J.M., Gonzalez,
F.J., Peters, J.M., 2008. Peroxisome proliferator-activated receptor-beta/delta
protects against chemically induced liver toxicity in mice. Hepatology 47,
225–235.
Shibata, H., Yoshioka, Y., Ohkawa, A., Abe, Y., Nomura, T., Mukai, Y., Nakagawa, S.,
Taniai, M., Ohta, T., Mayumi, T., Kamada, H., Tsunoda, S., Tsutsumi, Y., 2008. The
therapeutic effect of TNFR1-selective antagonistic mutant TNF-alpha in murine
hepatitis models. Cytokine 44, 229–233.
Sipes, I.G., Krishna, G., Gillette, J.R., 1977. Bioactivation of carbon tetrachloride, chloroform and bromotrichloromethane: role of cytochrome P-450. Life Sci. 20,
1541–1548.
Srinivasan, M., Rukkumani, R., Ram Sudheer, A., Menon, V.P., 2005. Ferulic acid, a
natural protector against carbon tetrachloride-induced toxicity. Fundam. Clin.
Pharmacol. 19, 491–496.
Srinivasan, M., Sudheer, A.R., Menon, V.P., 2007. Ferulic acid: therapeutic potential
through its antioxidant property. J. Clin. Biochem. Nutr. 40, 92–100.
Su, G.L., Wang, S.C., Aminlari, A., Tipoe, G.L., Steinstraesser, L., Nanji, A., 2004.
Impaired hepatocyte regeneration in toll-like receptor 4 mutant mice. Dig. Dis.
Sci. 49, 843–849.
111
Sun, B., Karin, M., 2008. NF-kappaB signaling, liver disease and hepatoprotective
agents. Oncogene 27, 6228–6244.
Taieb, D., Malicet, C., Garcia, S., Rocchi, P., Arnaud, C., Dagorn, J.C., Iovanna, J.L.,
Vasseur, S., 2005. Inactivation of stress protein p8 increases murine carbon tetrachloride hepatotoxicity via preserved CYP2E1 activity. Hepatology 42, 176–182.
Takeda, K., Kaisho, T., Akira, S., 2003. Toll-like receptors. Annu. Rev. Immunol. 21,
335–376.
Taniguchi, M., Takeuchi, T., Nakatsuka, R., Watanabe, T., Sato, K., 2004. Molecular
process in acute liver injury and regeneration induced by carbon tetrachloride.
Life Sci. 75, 1539–1549.
Thobe, B.M., Frink, M., Hildebrand, F., Schwacha, M.G., Hubbard, W.J., Choudhry,
M.A., Chaudry, I.H., 2007. The role of MAPK in Kupffer cell toll-like receptor
(TLR) 2-, TLR4-, and TLR9-mediated signaling following trauma-hemorrhage. J.
Cell. Physiol. 210, 667–675.
Tietze, F., 1969. Enzymic method for quantitative determination of nanogram
amounts of total and oxidized glutathione: applications to mammalian blood
and other tissues. Anal. Biochem. 27, 502–522.
Vila-del Sol, V., Fresno, M., 2005. Involvement of TNF and NF-kappa B in the transcriptional control of cyclooxygenase-2 expression by IFN-gamma in macrophages.
J. Immunol. 174, 2825–2833.
Wajant, H., Pfizenmaier, K., Scheurich, P., 2003. Tumor necrosis factor signaling. Cell
Death Differ. 10, 45–65.
Williams, A.T., Burk, R.F., 1990. Carbon tetrachloride hepatotoxicity: an example of
free radical-mediated injury. Semin. Liver Dis. 10, 279–284.
Zhu, R.Z., Xiang, D., Xie, C., Li, J.J., Hu, J.J., He, H.L., Yuan, Y.S., Gao, J., Han, W., Yu,
Y., 2010. Protective effect of recombinant human IL-1Ra on CCl4-induced acute
liver injury in mice. World. J. Gastroenterol. 16, 2771–2779.