Human Molecular Genetics, 2008, Vol. 17, No. 7
doi:10.1093/hmg/ddm374
Advance Access published on January 7, 2008
1020–1030
DSCR1/RCAN1 regulates vesicle exocytosis and
fusion pore kinetics: implications for Down
syndrome and Alzheimer’s disease
Damien J. Keating1,2, Daphne Dubach3, Mark P. Zanin1, Yong Yu3, Katherine Martin3,
Yu-Feng Zhao2, Chen Chen2, Sı́lvia Porta4,5, Maria L. Arbonés5, Laureane Mittaz3
and Melanie A. Pritchard3,
1
Molecular and Cellular Neuroscience Group, Department of Human Physiology and Centre for Neuroscience,
Flinders University, Adelaide, Australia, 2Endocrine Cell Biology Group, Prince Henry’s Institute of Medical Research,
Clayton, Victoria, Australia, 3Centre for Functional Genomics and Human Disease, Monash Institute of Medical
Research, Monash University, Clayton, Victoria, Australia, 4CIBER Epidemiologı́a y Salud Pública (CIBERESP),
Barcelona, Spain and 5Genes and Disease Program, Center for Genomic Regulation (CRG), UPF, Barcelona, Spain
Received August 20, 2007; Revised and Accepted December 19, 2007
Genes located on chromosome 21, over-expressed in Down syndrome (DS) and Alzheimer’s disease (AD) and
which regulate vesicle trafficking, are strong candidates for involvement in AD neuropathology. Regulator of
calcineurin activity 1 (RCAN1) is one such gene. We have generated mutant mice in which RCAN1 is either
over-expressed (RCAN1 ox) or ablated (Rcan1 2/2 ) and examined whether exocytosis from chromaffin cells,
a classic cellular model of neuronal exocytosis, is altered using carbon fibre amperometry. We find that
Rcan1 regulates the number of vesicles undergoing exocytosis and the speed at which the vesicle fusion
pore opens and closes. Cells from both Rcan1 2/2 and RCAN1 ox mice display reduced levels of exocytosis.
Changes in single-vesicle fusion kinetics are also evident resulting in the less catecholamine released per
vesicle with increasing Rcan1 expression. Acute calcineurin inhibition did not replicate the effect of
RCAN1 overexpression. These changes are not due to alterations in Ca21 entry or the readily releasable vesicle pool size. Thus, we illustrate a novel regulator of vesicle exocytosis, Rcan1, which influences both exocytotic rate and vesicle fusion kinetics. If Rcan1 functions similarly in neurons then overexpression of this
protein, as occurs in DS and AD brains, will reduce both the number of synaptic vesicles undergoing exocytosis and the amount of neurotransmitter released per fusion event. This has direct implications for the
pathogenesis of these diseases as sufficient levels of neurotransmission are required for synaptic maintenance and the prevention of neurodegeneration and vesicle trafficking defects are the earliest hallmark of AD
neuropathology.
INTRODUCTION
Down syndrome (DS) is caused by the trisomy of human
chromosome 21. DS individuals are mentally impaired,
many experience seizures, and most develop Alzheimer’s
disease (AD)-like neuropathology by their mid-40s, characterized by b-amyloid (Ab) peptide-containing plaques, taucontaining neurofibrillary tangles, basal forebrain cholinergic
neuron degeneration and dementia (1). The mechanisms
underlying the etiology of sporadic AD remain undefined
although mechanisms involving dysfunctional processing of
APP, abnormal tau protein handling, mitochondrial dysfunction and abnormal vesicle trafficking are currently being
explored. Abnormal vesicle trafficking precedes neuronal Ab
deposition in DS and sporadic AD. Enlarged early endosomes,
which are associated with abnormal vesicle trafficking (2), are
To whom correspondence should be addressed at: Department of Biochemistry and Molecular Biology and Department of Anatomy and Cell Biology,
Monash University, Clayton, Victoria 3168, Australia. Email: [email protected]
# The Author 2008. Published by Oxford University Press. All rights reserved.
For Permissions, please email: [email protected]
Human Molecular Genetics, 2008, Vol. 17, No. 7
observed in DS neurons from as early as 28 of weeks gestation, at 2 months in the DS mouse model, Ts65Dn, and in
sporadic AD, preceding Ab peptide deposition (3,4). Proteins
related to vesicle endocytosis and exocytosis have been linked
to DS and AD pathology. SNAP-25 expression is decreased in
brains of DS individuals and AD patients (5), synaptojanin
levels are increased in DS brains (6) and the neuronal
dynamin kinase, Cdk5 (7), is implicated in neurodegeneration
in AD brains (8,9).
Genes located on chromosome 21 which are over-expressed
in DS and AD and involved in the regulation of vesicle trafficking are strong candidates for involvement in the neuropathology of DS and AD. Down syndrome candidate region
1 (DSCR1 recently renamed RCAN1, Regulator of calcineurin
1) is one such gene. RCAN1 is highly expressed in brain, heart
and skeletal muscle (10), in endocrine tissues including the
adrenal gland (11) and is over-expressed in the brains of DS
fetuses (12) and in the cerebral cortex and hippocampus of
sporadic AD patients (11). Primary neuronal cultures transfected with a Rcan1 – EGFP construct illustrate that Rcan1
co-localizes with synaptophysin, suggesting Rcan1 may be
expressed on synaptic vesicles (13). This over-expression of
Rcan1 causes aggresome-like inclusion bodies similar to
those observed in DS and AD brains and reduces synaptophysin expression in neural processes (13), implying that Rcan1
upregulation may compromise exocytosis. Loss-of-function
and over-expression mutants of nebula, the Drosophila ortholog of RCAN1, both display severe learning defects in several
basic learning assays (14). Neurons from these mutant flies
have increased numbers of mitochondria which are reduced
in size, increased reactive oxygen species (ROS) levels and
reduced ATP production (15). While this work in Drosophila
illustrated severe learning and memory defects caused by the
altered expression of nebula, no evidence is provided on the
cellular processes underlying such changes.
There are indications that over-expression of RCAN1, as
observed in DS and AD, may adversely affect exocytosis,
endocytosis and vesicle trafficking. As we are interested in
the brain/neuronal phenotypes associated with DS, we
decided to generate transgenic mice overexpressing the brain
predominant isoform of RCAN1, isoform 1.1 (16). In this
study, we use mutant mice in which RCAN1.1 is transgenically
over-expressed (RCAN1 ox) or ablated (Rcan1 2/2 ) and
examine whether exocytosis from chromaffin cells, a classic
cellular model of neuronal exocytosis, is regulated by Rcan1.
RESULTS
RCAN1 transgenic mice are viable, develop normally
and show no overt abnormal phenotype
For the generation of transgenic mice, the isoform 1 splice
variant was placed under control of the endogenous promoter
to mirror as closely as possible the endogenous situation in DS
and AD (Fig. 1A). Rcan1 null (Rcan12\2 ) and RCAN1 transgenic (RCAN1ox) mice were viable, developed normally and
showed no overt abnormal phenotypes.
Expression of the endogenous mouse Rcan1 gene and the
RCAN1 transgene was assessed in adrenal gland tissue by
RT– PCR (Fig. 1C). Using human-specific oligonucleotide
1021
primer pairs, the human transgene mRNA was found to be
expressed in the transgenic mice, with no expression in the
wild type as expected (Fig. 1B). Protein expression was
assessed in adrenal gland using an antibody specific to
RCAN1. This antibody detects both the endogenous mouse
protein and the human transgene. Figure 1C shows a western
blot performed on protein extracts derived from transgenic,
knockout and wild-type (WT) adrenals. When we quantified
these results, the transgenic mice express 4 times more
RCAN1 protein than their WT counterparts (P , 0.001 compared with WT littermates, n ¼ 3) and no Rcan1 protein was
produced in Rcan1 null mouse adrenals (P , 0.01 compared
with WT littermates, n ¼ 3). Similar levels of expression
were seen in both our WT groups.
Rcan1 regulates the rate of exocytosis and fusion
pore dynamics in chromaffin cells
Amperometry is a technique which monitors the release of
oxidizable neurotransmitters at a carbon fibre surface. This
oxidation produces a current spike representing the exocytosis
of a single-secretory vesicle. As only oxidizable transmitters
are able to be measured using this technique, its use is
limited to cells and neurons which release oxidizable transmitters such as dopamine, noradrenaline, adrenaline and serotonin. In order to test whether altered Rcan1 expression had
any effect on vesicle recycling or neurotransmission, we
investigated exocytosis from adrenal chromaffin cells of
Rcan1 2/2 and RCAN1 ox mice using amperometry (17). Chromaffin cells have long been used as a model neuron system
when studying exocytosis. WT control chromaffin cells exhibited strong levels of exocytosis when stimulated with an external solution containing 70 mM Kþ for 1 min (Fig. 2A). Cells
from Rcan1 2/2 mice displayed reduced levels of exocytosis
(Fig. 2B) under these conditions. When the number of exocytotic events during this stimulation period was quantified, it
was clear that initial rates of exocytosis were similar
between these groups only for the first 5 – 10 s, after which
time the number of events occurring in Rcan1 2/2 cells
rapidly fell away (Fig. 2C, n ¼ 21). In control cells, 60.8 +
6.9 exocytotic events occurred during this minute compared
with 30.5 + 2.9 events in Rcan1 2/2 cells (P , 0.0005, n ¼
21, Fig. 2D). To test whether an increase in RCAN1 expression
would also affect exocytosis, we measured secretion from
chromaffin cells obtained from RCAN1 ox mice. Surprisingly,
over-expression of RCAN1 also resulted in a significant
reduction in the number of vesicles undergoing exocytosis
(Fig. 3), similar to that observed in Rcan1 2/2 cells. Over
the stimulation period, the number of events occurring in
RCAN1 ox cells fell away over time (Fig. 3C, n ¼ 23). In
RCAN1 ox cells, the number of exocytotic events in 1 min
was 37.5 + 5.4 compared with 58.9 + 6.5 in cells cultured
from control animals (Fig. 3D, P , 0.001).
Changes in single-vesicle fusion kinetics were observed in
these recordings, indicating that Rcan1 regulates a late stage
of exocytosis at the point of vesicle and plasma membrane
fusion. While the average peak of each exocytotic spike was
not different between control and Rcan1 2/2 cells (Fig. 4A,
n ¼ 16), the amount of catecholamine released per fusion
event was significantly increased in Rcan1 2/2 cells
1022
Human Molecular Genetics, 2008, Vol. 17, No. 7
Figure 1. Generation of RCAN1 transgenic mice. The DNA construct used to generate mice harbouring a RCAN1 transgene is shown (A). RT– PCR showing
Rcan1 expression in mouse chromaffin cells and expression of the human transgene in RCAN1 ox chromaffin cells (B). Western blot showing expression of
RCAN1 due to presence of the transgene in RCAN1 ox adrenals and no expression of Rcan1 in Rcan1 2/2 adrenals, quantification of these blots is also
shown (n ¼ 3) (C).
(P , 0.01) (Fig. 4B). This was caused by significantly slower
rise (P , 0.05) and decay (P , 0.05) phases of current spikes
in Rcan1 2/2 cells (Fig. 4C and D). As well as this, the halfwidth (width of a spike at half its maximal height) was significantly increased in Rcan1 2/2 cells (P , 0.01, Fig. 4E). A
comparison of a representative spike from control and
Rcan1 2/2 mice is shown in Figure 4F illustrating the difference in spike parameters when Rcan1 expression is ablated.
The release of catecholamine during an amperometric event
is often preceded by a so-called ‘foot’ signal which occurs
due to catecholamine release through the formation of an
initial transient fusion pore (17,18). In Rcan1 2/2 cells, the
percentage of events preceded by a foot signal was unchanged
(Fig. 5A). The height of these foot signals was also unchanged
in Rcan1 2/2 cells (Fig. 5B). Foot signals in Rcan1 2/2 cells
lasted longer, however (Fig. 5C, P , 0.05), resulting in
more neurotransmitter being released per foot signal
(Fig. 5D, P , 0.05).
Increased expression of RCAN1 had the opposite effect to
Rcan1 ablation on vesicle fusion kinetics. The average peak
of each exocytotic spike was not different between control
and RCAN1 ox cells (Fig. 6A, n ¼ 16), but the amount of catecholamine released per fusion event was significantly
decreased in RCAN1 ox cells (P , 0.01, Fig. 6B). This was
caused by significantly faster rise (P , 0.05) and decay
(P , 0.05) phases in amperometric spikes from RCAN1 ox
cells (Fig. 6C and D). As well as this, the half-width (width
of a spike at half its maximal height) was significantly
decreased in Rcan1 ox cells (P , 0.01, Fig. 6E). A comparison
of a representative spike from control and Rcan1 ox mice is
shown in Figure 6F illustrating the difference in spike parameters when RCAN1 is over-expressed. In RCAN1 ox cells,
the percentage of events preceded by a foot signal was
unchanged (Fig. 7A). The height of these foot signals was
decreased in Rcan1 ox cells (P , 0.05, Fig. 7B). In RCAN1 ox
cells, the foot duration was reduced (Fig. 7C, P , 0.05) resulting in less neurotransmitter being released per foot signal
(Fig. 7D, P , 0.01). Similar results were found in a separate
transgenic line we created, named M1 (Supplementary
Materials, Fig. S1 and Table 1), ruling out any erroneous
results which may have occurred due to insertional position
effects of the transgene.
Human Molecular Genetics, 2008, Vol. 17, No. 7
Figure 2. Loss of RCAN1 reduces chromaffin cell exocytosis. Typical
responses of chromaffin cells to stimulation with a 70 mM Kþ solution (indicated by dashed line under traces). Spikes indicate release of catecholamines
from a single vesicle in (A) WT and (B) Rcan1 2/2 cells. The frequency of
these events, placed in cumulative bins of 5 s, decreases over the stimulatory
period in (C) Rcan1 2/2 cells and a significant difference over this period
shown in (D) is found between controls and Rcan1 2/2 cells (n ¼ 21, P ,
0.001). P , 0.001. Light grey bars indicate WT and dark grey bars indicate
Rcan1 2/2 cells. Scale bar in (B) represents 10 s and 100 pA for (A) and (B).
1023
Figure 3. Overexpression of RCAN1 reduces chromaffin cell exocytosis.
Typical responses of chromaffin cells to stimulation with a 70 mM Kþ solution
(indicated by dashed line under traces). Spikes indicate release of catecholamines from a single vesicle in (A) WT and (B) RCAN1 ox cells. The frequency
of these events, placed in cumulative bins of 5 s, decreases over the stimulatory period in (C) RCAN1 ox cells and a significant difference over this
period shown in (D) is found between controls and RCAN1 ox cells (n ¼ 23,
P , 0.01). P , 0.01. Light grey bars indicate WT and dark grey bars indicate RCAN1 ox cells. Scale bar in B represents 10 s and 100 pA for A and B.
1024
Human Molecular Genetics, 2008, Vol. 17, No. 7
Figure 4. Ablation of Rcan1 slows fusion pore kinetics. Ablation of Rcan1 expression does not alter spike amplitude (A, n ¼ 16) but does increase quantal size
(charge, B) and slows both the rise time (C) and decay time (D) and increases the half-width (E) of individual spikes. (F) A comparison of a spike from a control
and Rcan1 2/2 cell is also shown to illustrate the changes in spike shape which represent alterations in fusion pore kinetics. P , 0.05, P , 0.01. Light grey
bars indicate WT and dark grey bars indicate Rcan1 2/2 cells.
Figure 5. The initial fusion pore is longer lasting when Rcan1 is ablated. While the frequency of foot signals preceding an amperometric spike (A, n ¼ 16) nor
the amplitude of foot signals (B) are not altered, foot signals last longer in Rcan1 2/2 cells (C) enabling more catecholamine to be released through this initial
fusion pore (D). P , 0.01. Light grey bars indicate WT and dark grey bars indicate Rcan1 2/2 cells.
Human Molecular Genetics, 2008, Vol. 17, No. 7
1025
Figure 6. Overexpression of RCAN1 accelerates fusion pore kinetics. Rcan1 overexpression does not alter spike amplitude (A, n ¼ 17) but does decrease quantal
size (charge, B) and accelerate both the rise time (C) and decay time (D) and decrease the half-width (E) of individual spikes. (F) A comparison of a spike from a
control and RCAN1 ox cell is also shown to illustrate the thinning of spike shape which represent an acceleration of fusion pore kinetics. P , 0.01. Light grey
bars indicate WT and dark grey bars indicate RCAN1 ox cells.
Figure 7. The initial fusion pore is more short-lived when RCAN1 is over-expressed. While the frequency of foot signals preceding an amperometric spike is not
altered (A, n ¼ 17) the amplitude of foot signals is decreased (B) and foot signal duration is shorter in RCAN1 ox cells (C) resulting in less catecholamine being
released through the initial fusion pore (D). P , 0.05, P , 0.01. Light grey bars indicate WT and dark grey bars indicate RCAN1 ox cells.
60.9 + 3.7
63.3 + 5.0
3.3 + 0.4
3.4 + 0.3
3.2 + 0.4
3.2 + 0.3
312.8 + 33.3
334.9 + 36.3
58.8 + 4.3
62.9 + 6.3
61.6 + 7.7 (18)
51.8 + 9.3 (18)
WT
WTþ
FK506þCys
0.56 + 0.05
0.60 + 0.06
61.5 + 4.5
61.2 + 4.1
3.0 + 0.3
2.0 + 0.3
2.9 + 0.3
1.8 + 0.2
274.8 + 25.0
167.5 + 20.7
51.2 + 4.2
52.3 + 3.9
51.3 + 6.1 (18)
28.9 + 4.7 (18)
WT
M1
0.48 + 0.03
0.39 + 0.04
58.7 + 4.2
58.9 + 4.3
3.0 + 0.3
2.1 + 0.3
3.0 + 0.4
2.1 + 0.3
0.50 + 0.04
0.38 + 0.03
275.3 + 25.6
171.6 + 16.2
52.9 + 2.5
50.8 + 2.5
58.9 + 6.5 (23)
37.5 + 5.4 (23)
WT
M9
Data shown as mean + SEM of the cell median for each parameter. Differences between Rcan1 2/2 or Rcan1 ox (two different lines named M9 and M1) and wild-type (WT) controls are indicated
as P , 0.05; P , 0.01; P , 0.001. Cys indicates the calcineurin inhibitor cyclosporine A. Numbers in parentheses in the first column are number of cells used to calculate the number of
exocytotic events (see Materials and Methods for further details).
15
15
25.6 + 1.2
26.9 + 1.2
4.6 + 0.2
4.6 + 0.2
12
12
21.5 + 0.9
17.2 + 0.9
4.7 + 0.2
4.0 + 0.1
16
16
21.2 + 1.1
16.5 + 0.9
4.1 + 0.2
3.5 + 0.2
19.8 + 1.1
18.4 + 1.2
30.4 + 2.0
42.4 +
4.2
35.2 + 3.6
21.3 +
1.4
30.7 + 1.7
19.3 +
1.1
36.2 + 2.0
39.2 + 2.1
221.7 + 22.1
338.2 + 34.1
60.8 + 6.9 (21)
46.0 + 2.5
30.5 + 2.9 (21) 48.0 + 4.1
WT
2/2
0.56 + 0.06
0.83 + 0.08
2.7 + 0.3
4.0 + 0.3
2.9 + 0.3
4.5 + 0.5
53.5 + 5.8
63.4 + 4.7
4.7 + 0.2
5.9 + 0.4
No. of
cells
Foot height
(pA)
Foot duration
(ms)
Foot area
(fC)
Foot frequency
(%)
Half-width
(ms)
Rise time (ms) Decay time
(ms)
Charge (pC)
Amplitude
(pA)
No. of events
Table 1. Effect of RCAN1 and acute calcineurin inhibition on single amperometric events
16
16
Human Molecular Genetics, 2008, Vol. 17, No. 7
1026
Inhibition of calcineurin activity does not regulate
exocytosis
As Rcan1 is an endogenous inhibitor of the phosphatase calcineurin, we first investigated whether changes in calcineurin
activity might underlie the mechanism by which Rcan1 regulates exocytosis in chromaffin cells. We applied two different
inhibitors of calcineurin, FK-506 (5 mM) and cyclosporine A
(5 mM), simultaneously. We first carried out a control experiment similar to previous amperometry experiments in which
cells where stimulated for 60 s with a high Kþ solution. We
then allowed these cells to recover before exposing cells to
the calcineurin inhibitors for 10 min. We then re-stimulated
the same cell in the continued presence of these drugs and
measured the amount of release. We found no difference in
the number of secretory spikes from control cells (61.6 +
7.7) or those acutely exposed to the calcineurin inhibitors
(51.8 + 9.3, n ¼ 18, Fig. 8A). We also observed no alteration
in any of the spike kinetics parameters we had previously
measured Figure 8B– H, Table 1). These data indicate that
the regulation of exocytosis by Rcan1 is not due to its
endogenous role as a regulator of calcineurin activity.
Rcan 1 does not regulate depolarization-induced
Ca21 entry
The major regulator of exocytosis is stimulation-induced Ca2þ
entry. We therefore carried out Ca2þ imaging experiments to
verify whether the exocytosis phenotypes caused by changes
in Rcan1 expression are due to alterations in normal Ca2þ
entry. Cells were loaded with the Ca2þ-specific indicator,
Fluo-3, and stimulated with the same protocol used in the
amperometry experiments. This stimulation caused a rapid
rise in fluorescence, indicating Ca2þ entry, in both control
and Rcan1 2/2 cells followed by a gradual decline in intracellular Ca2þ concentration ([Ca2þ]i) once stimulation
ceased (Supplementary Materials, Fig. S2A). Similar results
were observed in RCAN1 ox cells (Supplementary Materials,
Fig. S2B). There was no difference in the peak level of
Ca2þ entry between Rcan1 2/2 (n ¼ 50) and control (n ¼ 25)
cells or RCAN1 ox (n ¼ 28) and control cells (n ¼ 24) (Supplementary Materials, Fig. S2C). There was also no difference
between these groups for the total area under the curve during
the period of cell stimulation (Supplementary Materials,
Fig. S2D).
The size of the RRP is unaltered by Rcan1
Brief exposure of chromaffin cells to a hypertonic solution and
subsequent re-exposure to an isotonic solution causes the
release of pre-fused vesicles (19,20). To find out whether
Rcan1 regulates the number of vesicles fused to the membrane, we performed carbon fibre amperometry on chromaffin
cells, exposed these cells to a hypertonic solution for 10 s and
measured the number of vesicles released upon a return to
isotonic solution (Supplementary Materials, Fig. S3). Under
these conditions release occurred in control (Supplementary Materials, Fig. S3A), Rcan1 2/2 cells (Supplementary Material, Fig. S3B) and RCAN1 ox cells (Supplementary
Materials, Fig. S3C). The number of vesicles released during
Human Molecular Genetics, 2008, Vol. 17, No. 7
1027
Figure 8. Calcineurin inhibition does not effect the rate of exocytosis or fusion pore kinetics. WT cells were stimulated before and after acute exposure to the
calcineurin inhibitors FK-506 (5 mM) and cyclosporine A (5 mM). No differences were seen in (A) spike number, (B) amplitude, (C) charge, (D) rise time, (E)
decay time (F) half-width, (G) foot duration or (H) foot area. Light grey bars indicate before and dark grey bars indicate after exposure to drugs.
the 30 s following a return to isotonic solution was 13.8 + 1.7
in Rcan1 2/2 cells (n ¼ 15) compared with 17.9 + 4.2 in
control cells (n ¼ 9). In RCAN1 ox cells, this number was
12.6 + 3.0 (n ¼ 9) compared with 16.2 + 3.6 vesicles in
control cells (n ¼ 7) (Supplementary Materials, Fig. S3D).
Thus, the effects of Rcan1 on exocytosis is not caused
by changes in the localization of vesicles on the plasma
membrane.
DISCUSSION
Our results in this study clearly illustrate that Rcan1 regulates
exocytosis at two separate stages: the number of vesicles
fusing with the plasma membrane and undergoing exocytosis;
and once this occurs, the speed at which the vesicle fuses with
the plasma membrane. The manner by which Rcan1 regulates
these two steps of exocytosis remains to be identified as no
previous evidence exists to link Rcan1 to the regulation of
vesicle exocytosis. Our results indicate, however, that Rcan1
does regulate exocytosis at stages of the process downstream
of Ca2þ entry.
The reduction in the number of vesicles undergoing exocytosis in both the Rcan1 2/2 and RCAN1 ox chromaffin cells
indicates a careful balance in Rcan1 expression is required
for optimal vesicle release to occur. A similar conclusion
was drawn from work in over-expressing and loss-of-function
nebula mutants, the Drosophila ortholog of Rcan1. Neurons of
these two mutants displayed similar abnormalities, including
mitochondrial anomalies such as increased numbers of
smaller mitochondria, decreased levels of mitochondrial
DNA, reduced ATP production and increased levels of ROS
(15). Both these nebula mutants also displayed severe learning
defects which are not caused by brain maldevelopment (14). If
defects in CNS neurotransmission occur in Rcan1 2/2 and
RCAN1 ox mice similar to the changes we observed in chromaffin cells, this may explain learning difficulties in nebula
mutants and potentially the cognitive defects occurring in individuals with DS. Care must be taken, however, when relating
our results in RCAN1 ox to what may occur in DS neurons due
to the larger overexpression (four times normal) of Rcan1 in
these mice compared with the 1.5 – 2 times overexpression of
most chromosome 21 genes in DS. It should be noted that we
did not investigate whether exocytosis is affected in chromaffin cells from heterozygous Rcan1 þ/2 mice.
Enlarged early endosomes are observed in neurons of the
Ts65Dn DS mouse model, DS patients and in sporadic AD
patients (3,4). The enlargement of these early endosomes is
associated with reduced rates of vesicle endocytosis (2).
Such a reduction in the rate of endocytosis could explain
how Rcan1 regulates exocytosis by reducing the amount of
vesicle recycling occurring in our experiments. However,
whether Rcan1 does regulate endocytosis and whether
recycled vesicles even undergo exocytosis during our stimulation period in these current experiments requires further
investigation. If vesicle endocytosis in chromaffin cells of
these mice was reduced to such an extent as to diminish
vesicle recycling, this could explain the reduced number of
vesicles observed undergoing exocytosis. If this was also to
occur in neurons of these mice then we may imagine that neuronal endosomes could also be enlarged. This type of neuronal
profiling into pathological hallmarks of DS and AD in our
Rcan1 mutant mice will provide further insight into the role
of Rcan1 in these diseases. We do know that the number of
1028
Human Molecular Genetics, 2008, Vol. 17, No. 7
vesicles located at the plasma membrane is not altered by
changes in Rcan1 expression, leading to the conclusion that
changes in the size of the readily releasable pool (RRP) do
not contribute to the phenomenon we have observed. The
fact that the RRP size is unaffected in Rcan1 mutant cells provides further strength to the possibility that slower vesicle
endocytosis and recycling may at least partially underlie the
reduced level of vesicle release we observe. Other possible
explanations include a reduced size of the reserve vesicle
pool or alterations in the number or localization of secretory
vesicles.
While we observed changes in amperometric spike rise
time, decay time, charge and half-width, spike amplitude
remained unaffected. Spike amplitude is thought to be dependent on vesicle loading, as increasing the amount of catecholamine within chromaffin cell vesicles by pre-incubation with
L-DOPA (21,22) or reducing levels by inhibiting the vesicular
Hþ-ATPase pump (22) or the vesicular monoamine transporter
(21), results in the spike amplitude increasing or decreasing,
respectively. We therefore assume that the alterations in multiple amperometric spike parameters is not caused by changes
in vesicle loading, but is more likely due to direct or indirect
regulation of the fusion pore machinery by Rcan1.
We can only speculate at this stage as to the mechanisms by
which Rcan1 regulates exocytosis. Rcan1 is an inhibitor of the
protein phosphatase, calcineurin, which dephosphorylates a
number of endocytotic proteins including dynamin 1, amphiphysins 1/2 and synaptojanin (23) and the exocytotic
protein, Munc-18 (24). Calcineurin is the main phosphatase
involved in dephosphorylating the exocytotic protein
Munc-18 in chromaffin cells (24). Munc18 and syntaxin
bind with lower affinity when Munc-18 is in a phosphorylated
state (25) resulting in a acceleration of fusion pore kinetics
(26) similar to that reported here in Rcan1 ox chromaffin
cells. With this in mind,it must be noted that calcineurin inhibition in chromaffin cells has previously been shown not to
alter the rate of exocytosis (27,28) but to reduce the rate of
endocytosis (27). We tested this ourselves using a combination
of FK-506 and cyclosporine A to ensure complete calcineurin
inhibition. Our results demonstrate that acute inhibition of calcineurin activity does not alter the amount or kinetics of exocytosis in chromaffin cells indicating that regulation of
calcineurin activity by Rcan1 may not underlie Rcan1dependent regulation of exocytosis. The changes in foot
signal parameters including foot duration and foot area also
signify a role for Rcan1 in regulating fusion pore stability
and formation. The foot signals seen in these amperometric
recordings occur due to the transient opening and closing of
the fusion pore and the slow release of catecholamines
during this time (17). The foot duration gives an indication
of the time taken to form a stable fusion pore before complete
dilation of the pore and release of vesicular contents, whereas
the foot area relates to the amount of molecules able to pass
through this transient fusion pore. Our results would indicate
that an increase amount of Rcan1 reduces the time taken for
the fusion pore to stabilize.
Regulation of exocytosis could also occur through protein
interactions of Rcan1. Rcan1 contains a functional motif
which binds calcineurin as well as two proline-rich SH3
binding domains (10), although the functions served by
these domains are unknown. Apart from calcineurin (29), the
only protein currently known to interact with Rcan1 is the
protein kinase Raf-1 (30). While Raf-1 is known to link Ras
to the MEK/ERK signalling pathway, there is no clear indication how this interaction might be linked directly to exocytosis. In primary neuronal cultures transfected with a
Rcan1-EGFP construct, Rcan1 is detected as punctate staining
in the cell body and neuronal processes and is co-localized
with synaptophysin, suggesting Rcan1 may be expressed on
vesicles (13). This localization may be of importance given
the newly identified role of Rcan1 as a regulator of exocytosis.
In this study, we identify a novel role of RCAN1 in the
regulation of exocytosis and fusion pore dynamics. This is
the first demonstration of any gene on human chromosome
21, which is over-expressed in DS having a role in regulating
vesicle exocytosis. The fact that we see regulation occurring at
two different stages, before and during vesicle fusion, indicates that RCAN1 may affect the exocytotic pathway via multiple mechanisms. The identity of these mechanisms remains
to be discovered. If similar effects of Rcan1 are observed in
neurons, these findings will have direct implications for the
disease pathogenesis of both DS and AD in which Rcan1 is
over-expressed and could potentially explain the early
vesicle trafficking anomalies and subsequent cognitive
decline observed in both these conditions.
MATERIALS AND METHODS
Generation of mutant mice
Dscr1/Rcan1 null mice were generated on a mixed 129SvJ C57BL/6 genetic background as described (31). RCAN1
transgenic mice were generated using the human RCAN1
cDNA encoding the exon 1 splice variant. The minigene transgene was engineered to encompass 4 kb upstream of exon 1,
parts of the flanking introns and exons 5 – 7 including the
30 -UTR. The final construct is represented in Figure 1A. The
minigene DNA was prepared for microinjection by double
digestion with HindIII and NotI and the gel purified insert
used to microinject fertilized mouse embryos (mixed genetic
background C57BL/6 CBA). Thirty-four injected eggs
gave rise to live offspring, five of which had the minigene
DNA integrated in their genomes. Mouse genotyping was performed by PCR on ear-clip DNA by amplifying a region in the
30 -UTR.
RCAN1 expression in chromaffin cells
Adrenal glands from 8-week-old mice killed according to the
guidelines approved by the Monash Medical Centre Animal
Ethics Committee were collected, the RNA extracted and
made into cDNA. RT – PCR was performed using either
human-specific oligonucleotides hRCAN1-3utrF3 [GCACAAGGACATTTGGGACTG] and RCAN1-3utrR4 [GTT
GGGGATGCTGAGTGAATG] or oligonucleotides that
amplify both human and mouse genes. Exon 1 [AGCTTCATCGACTGCGAGAT] and Exon 7 [GTGTACTCCGGT
CTCCGTGT]. The reactions were performed with an annealing temperature of 628C and an extension time of 45 s.
Human Molecular Genetics, 2008, Vol. 17, No. 7
1029
Western blot analysis
Ca21 imaging
Adrenal protein extracts from knockout, transgenic and WT
counterparts were assessed by western blot analysis for
RCAN1 expression, using an anti-RCAN1 antibody that
cross reacts with both human and mouse proteins (31). The
mouse tissue extracts were prepared by homogenization in
tissue-lysis buffer containing (10 mM Tris – HCL, 150 mM
NaCl, 0.1% SDS, 1% Na deoxycholate, 1% TritonX100, pH
7.4), run through 12% SDS-polyacrylamide gels, and the proteins transferred onto Immobilon-P membrane (Millipore).
The anti-RCAN1 antibody was used to probe the membrane
at a dilution of 1/1000, and the secondary goat anti-rabbit antibody, conjugated to horse radish peroxidase (DAKO), was
used at a dilution of 1/2000.
For single cell Ca2þ imaging, cells were loaded with the Ca2þ
indicator Fluo-3 AM (5 mM) in serum-free DMEM at 378C for
45 min. Before recording, cells were rinsed in bath solution for
at least 10 min to allow for full de-esterification of the dye.
Cells were perfused at 2 ml/min. Confocal microscopy was
applied using an argon ion laser (Olympus, Australia) scanning at a peak of 488 nm and emitted light was detected at
wavelengths .515 nm. Images were captured and analyzed
using in-built software (Fluoview-300, Olympus). Laser intensity was reduced to 5% of maximum by use of neutral density
filters and the scan rates kept at one scan per 5 s to avoid
photobleaching. Changes in intracellular Ca2þ levels were
taken as the ratio of the maximum mean pixel value of the
whole cell during stimulation compared with that in the
control period, named DF/F0, in order to rule out the influence
of cell batch or Fluo-3 loading efficiencies (Keating, 2001
#167). This ratio is calculated according to the equation:
DF/F0 ¼(F-Fmin)/Fmin, where Fmin, mean fluorescence intensity during control period and F, maximum fluorescence intensity during stimulation.
Chromaffin cell culture
Adrenal glands were taken from 6 –8-week old male mice. The
adrenal medulla was dissected out in cold Locke’s buffer
(154 mM NaCl, 5.6 mM KCl, 3.6 mM NaHCO3, 5.6 mM
glucose, 5.0 mM HEPES, pH 7.4) and then incubated with collagenase type A, (Roche, Germany) in Locke’s buffer at a concentration of 3 mg/ml, in a shaking bath at 378C. The
collagenase was diluted further in cold Locke’s buffer, cells
pelleted and resuspended in DMEM medium supplemented
with 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA,
USA) and 10% FCS (JRH Biosciences, Lenexa, USA) and filtered through nylon mesh. Cells were pelleted, resuspended in
supplemented DMEM and plated on 35 mM culture dishes and
incubated at 378C with 5% CO2. Cells were maintained in
primary culture for 3 –4 days prior to experiments.
Amperometry
Catecholamine release from single chromaffin cells was
measured using amperometry (17). A carbon fibre electrode
(ProCFE, Dagan Corporation, USA) was placed on a chromaffin cell and þ800 mV applied to the electrode under voltage
clamp conditions. Current due to catecholamine oxidation
was recorded using an EPC-9 amplifier and Pulse software
(HEKA Electronic, Germany), sampled at 10 kHz and
low-pass filtered at 1 kHz. For quantitative analysis files
were converted to Axon Binary Files (ABF Utility, version
2.1, Synaptosoft, USA) and secretory spikes analysed (Mini
Analysis, version 6.0.1, Synaptosoft, USA) for a period of
60 s from the start of stimulation. The standard bath solution
contained 140 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM
MgCl2, 5 mM D-glucose, 10 mM HEPES, pH 7.4. High Kþcontaining solution was the same as control bath solution
except that 70 mM Kþ replaced an equimolar amount of
NaCl. For evaluation of the number of vesicles contained in
the RRP, cells were exposed for 10 s to a control bath solution
to which 500 mM sucrose was added (19,20). All solutions
were applied to cells using a gravity perfusion system, the
outlet of which was placed within 500 mm from the recorded
cell. All experiments were carried out at room temperature
(22 –248C). FK-506 and cyclosporine A were acquired from
Sigma (Australia).
Data analysis
Amperometric spikes were selected for analysis of event frequency if spike amplitude exceeded 10 pA and overlapping
peaks were included. Cells with fewer than 10 or .130
events within the 60 s stimulation period were excluded
from analysis. For kinetic analysis of spikes and spike feet,
only those events which exceeded 20 pA or were not overlapping with other spikes were included. Only pre-spike foot features longer than 1 ms and .2.5 times the RMS noise of the
baseline in that recording were analyzed as foot signals.
Difficulties arise when analyzing amperometric spike data
because of the large number of events per cells combined
with a large cell-to-cell variability in spike parameters. Due
to this, errors can occur when all the spikes are pooled for statistical testing (21). We analyzed all the spikes recorded in a
cell that met our threshold criteria to estimate one statistic
per cell (the cell median of each spike parameter) and compared this statistic between cell populations (21). For foot
analysis, data was pooled from all recorded cells as many
recordings contained a low number of foot signals so that an
adequate median value could not be obtained for each cell.
Foot onset was defined when the signal exceeded the
peak-to-peak noise of a 5 ms time segment, while the end of
the foot was defined by the inflection point between the foot
and the main event. This threshold value was determined by
mathematically taking the second derivative of the trace.
Recordings of both WT and mutant cells used the same
carbon fibres to eliminate potential effects of inter-fibre variability. When analyzing the number of vesicles contained in the
RRP in contact with the plasma membrane, all spikes with an
amplitude .2 pA were included. The same carbon fibre electrode was not utilized for WT and mutant cell recordings as
event number only was analyzed, not the vesicle release kinetics. For the analysis of this data we included all events
detected for 30 s after cells were exposed to the high
sucrose solution. As the number of release events per cell
1030
Human Molecular Genetics, 2008, Vol. 17, No. 7
and the amperometric spike parameters are non-parametrically
distributed, differences between means of different groups
were evaluated for statistical significance using the Mann –
Whitney test. All data presented are shown as mean + SEM.
SUPPLEMENTARY MATERIAL
Supplementary Material is available at HMG Online.
Conflict of Interest statement. None declared.
FUNDING
M.A.P. acknowledges funding support from the Australian
NH&MRC, ANZ Charitable Services and the L.E.W. Carty
Charitable Fund and D.J.K. acknowledges support from the
TM Ramsay Trust, Bio Innovation SA and the Australian
NH&MRC. M.L.A. the European Union (QLG1_CT2002-00816) and the Spanish Ministry of Education and
Science (SAF2004-01821).
REFERENCES
1. Lai, F., Kammann, E., Rebeck, G.W., Anderson, A., Chen, Y. and Nixon,
R.A. (1999) APOE genotype and gender effects on Alzheimer disease in
100 adults with Down syndrome. Neurology, 53, 331– 336.
2. Bucci, C., Parton, R.G., Mather, I.H., Stunnenberg, H., Simons, K.,
Hoflack, B. and Zerial, M. (1992) The small GTPase rab5 functions as a
regulatory factor in the early endocytic pathway. Cell, 70, 715– 728.
3. Cataldo, A.M., Peterhoff, C.M., Troncoso, J.C., Gomez-Isla, T., Hyman,
B.T. and Nixon, R.A. (2000) Endocytic pathway abnormalities precede
amyloid beta deposition in sporadic Alzheimer’s disease and Down
syndrome: differential effects of APOE genotype and presenilin
mutations. Am. J. Pathol., 157, 277– 286.
4. Cataldo, A.M., Petanceska, S., Peterhoff, C.M., Terio, N.B., Epstein, C.J.,
Villar, A., Carlson, E.J., Staufenbiel, M. and Nixon, R.A. (2003) App gene
dosage modulates endosomal abnormalities of Alzheimer’s disease in a
segmental trisomy 16 mouse model of down syndrome. J. Neurosci., 23,
6788– 6792.
5. Greber, S., Lubec, G., Cairns, N. and Fountoulakis, M. (1999) Decreased
levels of synaptosomal associated protein 25 in the brain of patients with
Down syndrome and Alzheimer’s disease. Electrophoresis, 20, 928– 934.
6. Arai, Y., Ijuin, T., Takenawa, T., Becker, L.E. and Takashima, S. (2002)
Excessive expression of synaptojanin in brains with Down syndrome.
Brain Dev., 24, 67–72.
7. Tan, T.C., Valova, V.A., Malladi, C.S., Graham, M.E., Berven, L.A.,
Jupp, O.J., Hansra, G., McClure, S.J., Sarcevic, B., Boadle, R.A. et al.
(2003) Cdk5 is essential for synaptic vesicle endocytosis. Nat. Cell Biol.,
5, 701–710.
8. Lee, M.S., Kwon, Y.T., Li, M., Peng, J., Friedlander, R.M. and Tsai, L.H.
(2000) Neurotoxicity induces cleavage of p35 to p25 by calpain. Nature,
405, 360– 364.
9. Patrick, G.N., Zukerberg, L., Nikolic, M., de la Monte, S., Dikkes, P. and
Tsai, L.H. (1999) Conversion of p35 to p25 deregulates Cdk5 activity and
promotes neurodegeneration. Nature, 402, 615– 622.
10. Fuentes, J.J., Pritchard, M.A., Planas, A.M., Bosch, A., Ferrer, I. and
Estivill, X. (1995) A new human gene from the Down syndrome critical
region encodes a proline-rich protein highly expressed in fetal brain and
heart. Hum. Mol. Genet., 4, 1935– 1944.
11. Ermak, G., Morgan, T.E. and Davies, K.J. (2001) Chronic overexpression
of the calcineurin inhibitory gene DSCR1 (Adapt78) is associated with
Alzheimer’s disease. J. Biol. Chem., 276, 38787–38794.
12. Fuentes, J.J., Genesca, L., Kingsbury, T.J., Cunningham, K.W.,
Perez-Riba, M., Estivill, X. and de la Luna, S. (2000) DSCR1,
overexpressed in Down syndrome, is an inhibitor of calcineurin-mediated
signaling pathways. Hum. Mol. Genet., 9, 1681– 1690.
13. Ma, H., Xiong, H., Liu, T., Zhang, L., Godzik, A. and Zhang, Z. (2004)
Aggregate formation and synaptic abnormality induced by DSCR1.
J. Neurochem., 88, 1485–1496.
14. Chang, K.T., Shi, Y.J. and Min, K.T. (2003) The Drosophila homolog of
Down’s syndrome critical region 1 gene regulates learning: implications
for mental retardation. Proc. Natl. Acad. Sci. USA, 100, 15794–15799.
15. Chang, K.T. and Min, K.T. (2005) Drosophila melanogaster homolog of
Down syndrome critical region 1 is critical for mitochondrial function.
Nat. Neurosci., 8, 1577– 1585.
16. Fuentes, J.J., Pritchard, M.A. and Estivill, X. (1997) Genomic
organization, alternative splicing, and expression patterns of the DSCR1
(Down syndrome candidate region 1) gene. Genomics, 44, 358– 361.
17. Chow, R.H., von Ruden, L. and Neher, E. (1992) Delay in vesicle fusion
revealed by electrochemical monitoring of single secretory events in
adrenal chromaffin cells. Nature, 356, 60– 63.
18. Alvarez de Toledo, G., Fernandez-Chacon, R. and Fernandez, J.M. (1993)
Release of secretory products during transient vesicle fusion. Nature, 363,
554–558.
19. Borges, R., Travis, E.R., Hochstetler, S.E. and Wightman, R.M. (1997)
Effects of external osmotic pressure on vesicular secretion from bovine
adrenal medullary cells. J. Biol. Chem., 272, 8325–8331.
20. Gil, A., Viniegra, S. and Gutierrez, L.M. (2001) Temperature and PMA
affect different phases of exocytosis in bovine chromaffin cells.
Eur. J. Neurosci., 13, 1380– 1386.
21. Colliver, T.L., Pyott, S.J., Achalabun, M. and Ewing, A.G. (2000)
VMAT-Mediated changes in quantal size and vesicular volume.
J. Neurosci., 20, 5276–5282.
22. Pothos, E.N., Mosharov, E., Liu, K.P., Setlik, W., Haburcak, M., Baldini,
G., Gershon, M.D., Tamir, H. and Sulzer, D. (2002)
Stimulation-dependent regulation of the pH, volume and quantal size of
bovine and rodent secretory vesicles. J. Physiol., 542, 453 –476.
23. Cousin, M.A. and Robinson, P.J. (2001) The dephosphins:
dephosphorylation by calcineurin triggers synaptic vesicle endocytosis.
Trends Neurosci., 24, 659– 665.
24. Craig, T.J., Evans, G.J. and Morgan, A. (2003) Physiological regulation of
Munc18/nSec1 phosphorylation on serine-313. J. Neurochem., 86, 1450–
1457.
25. Fujita, Y., Sasaki, T., Fukui, K., Kotani, H., Kimura, T., Hata, Y., Sudhof,
T.C., Scheller, R.H. and Takai, Y. (1996) Phosphorylation of Munc-18/
n-Sec1/rbSec1 by protein kinase C: its implication in regulating the
interaction of Munc-18/n-Sec1/rbSec1 with syntaxin. J. Biol. Chem., 271,
7265– 7268.
26. Graham, M.E., Fisher, R.J. and Burgoyne, R.D. (2000) Measurement of
exocytosis by amperometry in adrenal chromaffin cells: effects of
clostridial neurotoxins and activation of protein kinase C on fusion pore
kinetics. Biochimie, 82, 469 –479.
27. Chan, S.A. and Smith, C. (2001) Physiological stimuli evoke two forms of
endocytosis in bovine chromaffin cells. J. Physiol., 537, 871–885.
28. Nagy, G., Reim, K., Matti, U., Brose, N., Binz, T., Rettig, J., Neher, E.
and Sorensen, J.B. (2004) Regulation of releasable vesicle pool sizes by
protein kinase A-dependent phosphorylation of SNAP-25. Neuron, 41,
417–429.
29. Chan, B., Greenan, G., McKeon, F. and Ellenberger, T. (2005)
Identification of a peptide fragment of DSCR1 that competitively inhibits
calcineurin activity in vitro and in vivo. Proc. Natl. Acad. Sci. USA, 102,
13075– 13080.
30. Cho, Y.J., Abe, M., Kim, S.Y. and Sato, Y. (2005) Raf-1 is a binding
partner of DSCR1. Arch. Biochem. Biophys., 439, 121–128.
31. Porta, S, Serra, S.A., Huch, M., Valverde, M.A., Llorens, F., Estivill, X.,
Arbonés, M.L. and Martı́, E. (2007) RCAN1 (DSCR1) increases neuronal
susceptibility to oxidative stress: a potential pathogenic process in
neurodegeneration. Hum. Mol. Genet. 16, 1039–1050.