University of Birmingham
Functional analysis of xenobiotic response
elements (XREs) in CYP 1A of the European
Flounder (Platichthys flesus)
Lewis, N; Williams, Timothy; Chipman, K
DOI:
10.1016/j.marenvres.2004.03.002
License:
None: All rights reserved
Document Version
Publisher's PDF, also known as Version of record
Citation for published version (Harvard):
Lewis, N, Williams, T & Chipman, K 2004, 'Functional analysis of xenobiotic response elements (XREs) in CYP
1A of the European Flounder (Platichthys flesus)' Marine Environmental Research, vol 58, no. 2-5, pp. 101-105.
DOI: 10.1016/j.marenvres.2004.03.002
Link to publication on Research at Birmingham portal
General rights
When referring to this publication, please cite the published version. Copyright and associated moral rights for publications accessible in the
public portal are retained by the authors and/or other copyright owners. It is a condition of accessing this publication that users abide by the
legal requirements associated with these rights.
• You may freely distribute the URL that is used to identify this publication.
• Users may download and print one copy of the publication from the public portal for the purpose of private study or non-commercial
research.
• If a Creative Commons licence is associated with this publication, please consult the terms and conditions cited therein.
• Unless otherwise stated, you may not further distribute the material nor use it for the purposes of commercial gain.
Take down policy
If you believe that this document infringes copyright please contact [email protected] providing details and we will remove access to
the work immediately and investigate.
Download date: 18. Jun. 2017
MARINE
ENVIRONMENTAL
RESEARCH
Marine Environmental Research 58 (2004) 101–105
www.elsevier.com/locate/marenvrev
Functional analysis of xenobiotic response
elements (XREs) in CYP 1A of the European
Flounder (Platichthys flesus)
Nicholas Lewis *, Tim D. Williams, Kevin Chipman
School of Biosciences, The University of Birmingham, Edgbaston, Birmingham B15 2TT, UK
Abstract
The induction of hepatic cytochrome P450 1A (CYP 1A) is an important step in the response to contaminants such as polycyclic aromatic hydrocarbons (PAHs), and has been used
as a biomarker of exposure in fish. Several consensus response elements have been identified,
including eight potential xenobiotic response elements (XREs) in the promoter region of the
European flounder cytochrome P450 1A gene. However not all of these sequences are necessarily active. To help elucidate the molecular regulation of this important gene, site directed
mutagenesis and dual-luciferase reporter gene assays were employed to characterize the
consensus transcription factor binding sites of the CYP 1A 50 flanking region.
Mutation of response elements situated )1103, )859, )709 and )172 bases upstream of the
transcription start site reduced the induction to 2.75, 1.51, 3.25 and 3.05 fold, respectively,
compared with the full-length promoter (4.0-fold induction) on exposure to the PAH
3-methylcholanthrene (3MC) (1.0 lM). These results indicate that four out of eight different
XREs are functional in the control of CYP 1A in the flounder. The activity of these response
elements adds to the evidence for considerable diversity in vertebrate CYP 1A regulation.
Ó 2004 Elsevier Ltd. All rights reserved.
Keywords: Cytochrome P450 1A; Ecotoxicology; European flounder; Fish; Reporter assay; XRE
The cytochrome P450 superfamily of haemoproteins consists of mono-oxygenases, which catalyse the oxidative metabolism of a wide variety of substrates. Environmental contaminants such as polycyclic aromatic hydrocarbons (PAHs) are
metabolized by CYP 1A, and induction of these enzymes may contribute to the toxic
*
Corresponding author. Fax: +44-121-4145925.
E-mail address: [email protected] (N. Lewis).
0141-1136/$ - see front matter Ó 2004 Elsevier Ltd. All rights reserved.
doi:10.1016/j.marenvres.2004.03.002
102
N. Lewis et al. / Marine Environmental Research 58 (2004) 101–105
action of certain contaminants. The induction of hepatic cytochrome P450 1A (CYP
1A) is recognized as a useful biomarker of exposure of fish to environmental contaminants such as polycyclic aromatic hydrocarbons (PAHs). Induction and regulation of CYP 1A transcription by PAHs is dependent on the aryl hydrocarbon
receptor (AhR) pathway and it is believed that AhR function is necessary for most
toxic consequences of PAH exposure. The AhR functions together with a second
protein, the AhR nuclear translocator (Arnt), to generate a heteromeric DNAbinding transcription factor that recognizes xenobiotic response elements in the CYP
1A promoter region (Whitlock et al., 1996). In the European flounder (Platichthys
flesus) CYP 1A promoter region, several consensus response elements including eight
potential xenobiotic response elements (XREs) have been identified (Williams,
Sheader, Lee, & Chipman, 2000), but not all of these sequences are necessarily active.
The functionality of these XREs was investigated in response to the prototypical
PAH, 3-methylcholanthrene (3MC). An understanding of the responsiveness of this
gene in the flounder is important since CYP 1A induction is a major biomarker
utilised in this species for example within the UK National Marine Monitoring
Programme.
The European flounder CYP 1A promoter region (EMBL Acc. No. AJ 132353)
was ligated into the pGL3-basic plasmid (Promega). This was designated P1. To
analyse the functional properties of the XREs, site-directed mutagenesis using
mismatched primers (Table 1) was employed. These plasmids containing mutated
XREs were designated P2–P9. All constructs were verified by sequencing.
PLHC-1 (Poeciliopsis lucida) cells were routinely grown as previously described
(Ackerman & Fent, 1998). For transient transfection, PLHC-1 cells were seeded at a
density of 5.0 105 cells/well (2 ml media/well). Cells were transiently co-transfected
with one of the experimental (P1–P9) pGL3 plasmids (1 lg) and the pRL-CMV
control vector (1 lg) (Promega), treated with 3MC (0–1.0 lM) (16 h) delivered in
DMSO and expression measured using the Dual–Luciferase Reporter Assay System
(Promega) as previously described (Williams et al., 2000). Cytotoxicity was assessed
using the MTT and LDH assays.
Upon exposure to 3MC (0–1.0 lM) cells remained P 93% viable. Treatment of
PLHC-1 cells co-transfected with the P1 plasmid produced a concentration-dependent induction of luciferase, with an apparent increase at an exposure level as low as
0.05 lM (Fig. 1(a)). Treatment with 3MC at 0.5–1.0 lM resulted in a statistically
significant increase in CYP 1A induction (2.9 and 4.0 fold, respectively) compared to
control incubations (Fig. 1(a)).
The Dual–Luciferase assay therefore established the responsiveness of the reporter construct to a model PAH. The dose-dependent inducibility of the reporter
gene concurs with the general observation that CYP 1A expression is regulated via
the AhR and this pathway is functional in fish liver cells (Billiard et al., 2002).
The consensus XRE sequences located at )1054, )1001, )203, and )189
(P3,4,7,8) upstream of the transcription start site may be non-functional, as induction with 3MC was unaffected when these sites were mutated (Fig. 1(b)). Gel mobility shift assays are being completed to determine potential non-functionality. In
contrast, mutation of response elements situated )1103, )859, )709 and )172
Response
elementa
50 -Primer
30 – Primer
P2
P2
P3
P3
P4
P4
P5
P5
P6
P6
P7
P7
P8
P8
P9
P9
TAAGGAGCTCGAATAAAACCAGAGC
GATCACTGCGCTCTAGATCTACTG
TAAGGAGCTCGAATAAAACCAGAGC
CCAACAGGTACAAGAAGCTTATGGC
TAAGGAGCTCGAATAAAACCAGAGC
GTCCGGGTGGCTGCTGGTACCGGCAG
TAAGGAGCTCGAATAAAACCAGAGC
TAAATATAAGTTGTGCTAGCATTTT
TAAGGAGCTCGAATAAAACCAGAGC
TTAAAAACCATGCCCCCGGGTTAG
TAAGGAGCTCGAATAAAACCAGAGC
TTCTAGCACTCCCTCTCGAGCGTAC
TAAGGAGCTCGAATAAAACCAGAGC
CGTACACAGAATTCACACAGACAC
TAAGGAGCTCGAATAAAACCAGAGC
CACAGACACAGATATCCACATACAC
CAGTAGATCTAGAGCGCAGTGATC
CGGTAGCATTAGCTCCATGGTGCGAC
GCCATAAGCTTCTTGTACCTGTTGG
CGGTAGCATTAGCTCCATGGTGCGAC
CTGCCGGTACCAGCAGCCACCCGGAC
CGGTAGCATTAGCTCCATGGTGCGAC
AAAATGCTAGCACAACTTATATTTA
CGGTAGCATTAGCTCCATGGTGCGAC
CTAACCCGGGGGCATGGTTTTTAA
CGGTAGCATTAGCTCCATGGTGCGAC
GTACGCTCGAGAGGGAGTGCTAGAA
CGGTAGCATTAGCTCCATGGTGCGAC
GTGTCTGTGTGAATTCTGTGTACG
CGGTAGCATTAGCTCCATGGTGCGAC
GTGTATGTGGATATCTGTGTCTGTG
CGGTAGCATTAGCTCCATGGTGCGAC
a
F
R
F
R
F
R
F
R
F
R
F
R
F
R
F
R
F ¼ forward PCR reaction; R ¼ reverse PCR reaction.
N. Lewis et al. / Marine Environmental Research 58 (2004) 101–105
Table 1
Primer sequences used in site-directed mutagenesis
103
104
N. Lewis et al. / Marine Environmental Research 58 (2004) 101–105
Fig. 1. Luciferase activity of various flounder CYP 1A-reporter constructs in PLHC-1 cells following
treatment with 3MC (0–1.0 lM) (n ¼ 3 s:d:). (a) Luciferase activity of the unmutated CYP 1A promoter
(*p < 0:05 paired t-test compared to the control). (b) Luciferase activity of the unmutated CYP 1A
promoter (P1) and mutants P3, P4, P7, and P8. (c) Luciferase activity of the unmutated promoter (P1) and
mutants P2, P5, P6 and P9 (*p ¼ 0:05) paired t-test compared to unmutated promoter.
(P2,5,6,9) bases upstream of the transcription start site resulted in a statistically
significant reduction in activation to 2.75, 1.51, 3.25 and 3.05 fold, respectively,
compared with the P1 promoter (4.0-fold induction) on exposure to 3MC (1.0 lM)
(Fig. 1(c)).
These results extend previous studies showing that deletion of the CYP 1A promoter region between positions )1348 and )508 greatly reduces transcriptional activity (Williams et al., 2000). The activity of these response elements adds to the
evidence for considerable diversity in fish CYP 1A regulation. Of the fish CYP 1A
N. Lewis et al. / Marine Environmental Research 58 (2004) 101–105
105
control elements sequenced so far, the flounder possesses eight XRE whereas six
have been identified in eel (Anguila japonica), four in tomcod (Microgadus tomcod),
and two in a trout (Oncorhynchus mykiss) gene. Presently only the eel CYP 1A
promoter region has been analysed in terms of functionality (Ogino, Itakura, Kato,
Aoki, & Sato, 1999), interestingly both promoters contain functional XREs close to
the TATA box and at least one in the distal promoter region. Comparison of
mammalian CYP 1A1 and the CYP 1B1 promoters, also in part regulated via the
AhR pathway, demonstrate no steadfast rules regarding the number, position or
functionality of XREs (Zheng et al., 2003). The use of reporter gene assays has been
utilised in numerous bioassays for analysis of chemicals in sediment and pore water,
namely the CALUX (Murk et al., 1996) and P450 RGS (Anderson, Jones, Hameedi,
Long, & Tukey, 1999) assays. These bioassays both use the firefly Luciferase gene
under the control of mouse and human CYP 1A1 genes, respectively. Investigations
are now centred on assessing the potential role of metal response elements also
identified in the flounder CYP 1A promoter region (Williams et al., 2000).
Acknowledgements
This work was supported by the Natural Environment Research Council.
References
Ackerman, G. E., & Fent, K. (1998). The adaptation of the permanent fish cell line PLHC-1 and RTG-2 to
FCS-free media results in similar growth rates compared to FCS-containing conditions. Marine
Environmental Research, 46, 363–367.
Anderson, J. W., Jones, J. M., Hameedi, J., Long, & Tukey, R. H. (1999). Comparative analysis of
sediment extracts from NOAA’s bioeffects studies by the biomarker, P450 Reporter Gene System.
Marine Environmental Research, 48, 407–425.
Billiard, S. M., Hahn, M. E., Franks, D. G., Peterson, R. E., Bols, N. C., & Hodson, P. V. (2002). Binding
of polycyclic aromatic hydrocarbons (PAHs) to teleost aryl hydrocarbon receptors (AhRs).
Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 133(1),
55–68.
Murk, A. J., Legler, J., Denison, M. S., Giesy, J. P., Van De Guchte, C., & Brouwer, A. (1996). ChemicalActivated Luciferase Gene Expression (CALUX): A novel bioassay for Ah receptor active compounds
in sediments and pore water. Fundamental and Applied Toxicology, 33, 149–160.
Ogino, T., Itakura, T., Kato, H., Aoki, J., & Sato, M. (1999). Functional analysis of promoter region from
eel cytochrome P450 1A1 gene in Transgenic Medaka. Marine Biotechnology, 1, 364–370.
Whitlock, J. P., Jr., Okino, S. T., Dong, L., Ko, H. P., Clarke-Katzenberg, R., Ma, Q., & Li, Hui. (1996).
Induction of cytochrome P4501A1: a model for analysing mammalian gene transcription. The FASEB
Journal, 10, 809–818.
Williams, T. D., Sheader, D. L., Lee, -S., & Chipman, J. K. (2000). The cytochrome P450 1A gene
(CYP1A) from European flounder (Platichthys flesus), analysis of regulatory regions and development
of a dual luciferase reporter gene system. Marine Environmental Research, 50, 1–6.
Zheng, W., Brake, P. B., Bhattacharyya, K. K., Zhang, L., Zhao, D., & Jefcoate, C. R. (2003). Cell
selective cAMP induction of rat CYP1B1 in adrenal and testis cells. Identification of a novel cAMPresponsive far upstream enhancer and a second Ah receptor-dependant mechanism. Archives of
Biochemistry and Biophysics, 416, 53–67.