4196-4201
1
Nucleic Acids Research, 1995, Vol. 23, No. 20
1995 Oxford University Press
Initiation of unidirectional ColE2 DNA replication by a
unique priming mechanism
Shinji Takechi and Tateo Itoh*
Laboratory of Genetics, Department of Biology, Faculty of Science, Osaka University, Toyonaka, Osaka 560,
Japan
Received May 16, 1995; Revised and Accepted September 18, 1995
ABSTRACT
The ColE2 DNA can be replicated in an in vitro system
consisting of a crude extract of Escherichia co//cells.
DNA synthesis requires a plasmid-coded protein (Rep)
and host DNA polymerase I but not host RNA polymerase. Replication starts at a fixed region containing the
origin and proceeds unidirectionally. The leading- and
lagging-strand DNA fragments synthesized around the
origin were identified from early replicative intermediates. The 5' end of the leading-strand DNA fragment
was mapped at a unique position in the minimal origin
and carried RNA of a few residues. The results
suggested that the initiation of the leading-strand DNA
synthesis does not require the host DnaG protein.
Thus the Rep protein itself seems to be a primase.
Synthesis of the primer RNA at a fixed site in the origin
region on a double-stranded DNA template is a unique
property of the ColE2 Rep protein among other known
primases. The 3' end of the lagging-strand DNA
fragment was mapped at a unique position just at the
end of the minimal origin region. Termination of the
lagging-strand DNA fragment at that position seems to
be the mechanism of the unidirectional replication of
ColE2 plasmid.
INTRODUCTION
The colicin E2 (ColE2) plasmid is a circular duplex DNA
molecule of -7 kb pairs (1). The plasmid is present in -10-15
copies per host chromosome (2,3). Its replication requires host
DNA polymerase I like ColEl plasmid (4-6). Unlike ColEl,
however, its replication requires a plasmid-specified trans-acling
protein (Rep) of 296 amino acids (3,6,7). Besides the coding
region for the Rep protein, the 1.3 kb Pvul-BgR segment of
plasmid ColE2, that is sufficient for autonomous replication (3),
also contains a 32 bp cw-acting site (origin) required for DNA
replication (7). Purified Rep protein specifically binds to the
origin as revealed by a filter binding assay (8). ColE2 DNA
replication starts in a fixed region containing the origin and
proceeds unidirectionally as revealed by electron microscopic
analysis (6). About 100 bp downstream from the origin there is
a primosome assembly site (PriA-pas) that promotes initiation of
DNA synthesis on a single-stranded DNA template (9,10). The
orientation of the site is for the lagging-strand DNA synthesis, but
it is dispensable for ColE2 DNA replication (3). As initiation of
ColE2 DNA replication does not require host RNA polymerase
(6), the Rep protein might be a plasmid-specified priming enzyme
(primase) or it might help the host primase and other host proteins
to interact with the origin.
We identified the leading- and lagging-strand DNA fragments
in early replicative intermediates synthesized in the in vitro
replication system and mapped the 5' end of the former and the
3' end of the latter in the origin region. We found several residues
of RNA at the 5' end of the leading-strand fragment. The results
suggested that the host DnaG primase is not required for the
synthesis of the leading-strand DNA fragment.
MATERIALS AND METHODS
Bacterial strains and plasmids
The E.coli K12 strain used are NT525 rnapnp endA (11), WD42
dnaB42 (12,13), JG153 dnaC7 (14), JG32 dnaG308 (15) and
AX727 dnaZ2016 (16). Plasmids pEC22 (3) is a derivative of
ColE2 carrying the 2.4 kb segment sufficient for autonomous
replication. Plasmid pTI12-6A/-ep (8) is a derivative of pBR322
(17) carrying the rep gene of plasmid ColE2 under the control of
the promoter PR and the heat-labile cl857 repressor of bacteriophage X. Plasmid pTC2101 is a derivative of pBR322 carrying the
1.6 kb Pvull-Xbal segment derived from a derivative of pEC22
with an Xbal linker (insertion 10; 3) inserted ~ 100 bp downstream
the origin.
Construction of phages
A derivative of bacteriophage M13mpl8 or M13mpl9 (18)
containing a DNA segment of either the leading- or the
lagging-strand template of plasmid ColE2 was constructed by
inserting the 100 bp Bglll-Xbal segment of pTC2101 containing
the origin of ColE2 between the BamHl and Xbal sites or the
1.2 kb BamHl segment of plasmid pEC22 at the BamHl site of
M13mpl8 or M13mpl9. Single-stranded or double-stranded
DNA molecules of M13 derivatives were prepared as described
(19).
* To whom correspondence should be addressed at present address: Department of Biology, Faculty of Science, Shinshu University, Matsumoto, Nagano 390, Japan
+
Present address: Department of Biochemistry, Miyazaki Medical College, Kiyotake, Miyazaki 889-16, Japan
Nucleic Acids Research, 1995, Vol. 23, No. 20 4197
Other materials
DNA sequencing
Chemicals, antibiotics and most enzymes were from commercial
sources. Terrific Broth was prepared as described (20).
Eco47in-digested pEC22 DNA treated with alkaline phosphatase was labelled with [y-32P] ATP and T4 polynucleotide kinase.
It was cleaved with Xhol and the shorter fragment containing the
ColE2 origin region was used for nucleotide sequencing.
Chemical modifications and cleavage of the DNA fragment were
performed as described (20,21).
Preparation of cell extracts
Cell extracts of NT525 and NT525 carrying pTI12-6Arep were
prepared essentially as described (6,8) except that bacteria were
grown in Terrific Broth. Extracts were passed through a column
of Sephadex G-25, when necessary. Cell extracts of temperaturesensitive dna mutant bacteria were prepared similarly except that
bacteria were grown at 30 °C and then treated at 42 °C for 2 h to
inactivate the mutant Dna proteins prior to harvesting.
In vitro DNA synthesis
DNA synthesis was measured essentially as described (6). The
standard reaction mixture (25 u.1) contained cell extracts (5 |il),
20 nM plasmid pEC22 DNA, 34 mM potassium phosphate buffer
pH 7.5, 12 mM MgCl2, 80 mM KC1, 1 mM dithiothreitol (DTT),
2 mM ATP, 0.4 mM each of GTP, CTP, UTP, 50 \\M each of
4 dNTPs with [cc-32P] dCTP (-500 c.p.m./pmol), 0.3 mM cAMP,
0.3 mM NAD, 10 mM creatine phosphate, 0.1 mg/ml creatine
kinase, 0.1 mg/ml bovine serum albumin, 5% poly vinyl alcohol
(PVA) or polyethylene glycol (PEG), 0.2 mg/ml chloramphenicol
and 24 fxg/ml rifampicin. After incubation at 32°C for 60 min,
incorporation of radioactivity into acid insoluble fraction was
determined by a liquid scintillation counter.
Analysis of the products of in vitro DNA synthesis
The reaction mixture contained 5% PEG. The reaction was
stopped by addition of 20 mM ethylenediamine tetraacetic acid
(EDTA) and 0.25% sodium lauroyl sarcosinate (SLS) and the
mixture was treated with 0.1 mg/ml pronase at 32°C for 30 min.
The purified products were digested with appropriate restriction
endonucleases, followed by treatment with 0.3 N NaOH at 37°C
for 16 h, when necessary. The sample was dissolved in a sample
solution containing 0.1% SLS, 0.5 (i,g/ml ethidium bromide
(EtdBr), 0.1% (w/v) bromophenol blue (BPB) and 0.1% (w/v)
xylene cyanol (XC) or in a sample solution containing 8 M urea,
1 mM EDTA, 0.1% BPB and 0.1 % XC. The samples were heated
for 5 min at 95 °C when necessary and subjected to electrophoresis
in a 1% agarose gel or a 6% polyacrylamide/7 M urea gel.
Autoradiography was carried out after drying the gel.
Determination of strand-specificity of DNA fragments
from replication intermediates
The 3^P-labelled DNA was dissolved in 40 (xl of a solution of
0.5 M NaCl and 0.1% SDS. The sample was heated for 5 min at
95 °C and subjected to hybridization with 1 |xl of 200 |ig/ml of
single-stranded DNA of an M13 derivative carrying a segment of
ColE2 DNA for 10 min at 65 °C followed by ethanol precipitation. The precipitate was dissolved in 10 fxl of a solution of 50%
glycerol, 10 mM Tris-HCl, pH 7.5,10 mM EDTA, 0.1% BPB and
0.1% XC and subjected to electrophoresis in a 1% agarose gel in
the presence of 0.5 fig/ml EtdBr. The reaction products in the
wild-type and dnaG cell extracts were fragmented by cleavage
with Rsal before hybridization. When necessary, DNA fragment
was eluted from crashed gel slices and purified using yeast tRNA
as a carrier.
RESULTS
Early replicative intermediates produced in crude cell
extracts
The in vitro replication system of plasmid ColE2 consisted of a
crude cell extract of plasmid-free bacteria (receptor extract) as the
source of the host enzymes (6). The Rep protein of plasmid ColE2
was supplied to this system by adding a small amount of a crude
cell extract of donor bacteria (donor extract) in which the Rep
protein was accumulated. The donor bacteria carry a derivative of
pBR322 with the cloned rep gene of plasmid ColE2 under the
control of the PR promoter and the heat-labile cI857 repressor of
bacteriophage X and synthesis of the Rep protein was enhanced
by treating bacteria at 42°C (8). The standard reaction mixtures
contained rifampicin and chloramphenicol to inhibit RNA and
protein syntheses. Rifampicin also inhibited replication of
pBR322-type plasmid DNA in the donor cell extract.
DNA synthesis was carried out in the standard reaction mixture
using plasmid pEC22 (Fig. IB; 3) DNA as a template and the
products were analyzed by the agarose gel electrophoresis (Fig.
2, lane 1). The products contained mainly the covalently closed
circular (CCC) DNA molecules with some open circular (OC)
DNA molecules. In order to accumulate early replicative
intermediates, ddTTP was added to the reaction mixtures, which
terminated elongation of DNA chains prematurely, as described
previously (6). When the concentration of ddTTP was 50 |iM,
which decreased the total amount of DNA synthesis to 30% of
that in the standard reaction mixture, the amounts of the CCC and
OC molecules became much less and a broad band of labelled
DNA was found which migrated between the positions of the
CCC and OC molecules in the agarose gel (Fig. 2, lane 3). When
the sample was heated before electrophoresis, a new band of
DNA with the unit-length single-stranded plasmid DNA for the
reaction without ddTTP (Fig. 2, lane 2) or a new broad band of
shorter DNA for the reaction with ddTTP (Fig. 2, lane 4)
appeared. We assumed that the products obtained in the presence
of ddTTP contained replicative intermediates of a very early stage
and that those short DNA fragments contained those synthesized
from the region containing the origin, as suggested by the
previous electron microscopic observation (6).
Localization of newly synthesized DNA fragments
contained in the early replicative intermediates
The early replicative intermediates of pEC22 were digested with
each of the restriction endonucleases EcoAlYR and Neil and
analyzed by electrophoresis in a polyacrylamide gel after heat
treatment (Fig. 3A). Digestion with EcoAllW gave very heterogeneous products of -500 nucleotides and longer including the
3.6 kb unit-length fragment (Fig. 3 A, lane 2). In addition, a broad
DNA band of-100 nucleotides was found. Digestion with Neil
gave heterogeneous products of 200 nucleotides or longer
including the three fragments (0.72, 1.2 and 1.7 kb) produced by
4198 Nucleic Acids Research, 1995, Vol. 23, No. 20
A
500
1000
1500 bp
I
M
I
B
12 3 4
M
1 2,-!5—,
C
1 234
O
I
~-M13
Rep protein E l
Orl-
PviA
Xhct*
Bgll\
Bgl\'
Eco47\\\Ncn
BamHI
PrlA-pas
95--
Ata/I
BamHI
Bgl\
Figure 1. (A) Structure of the 1.65 kb Pvu\\-Nci\ region of plasmid ColE2
sufficient for autonomous replication. Only relevant restriction sites are
indicated. The coding region for the Rep protein is represented by an open box
and the N- and C-termini are indicated. The direction of DNA replication is
indicated by a large open arrow above the origin region (On; a short black bar).
The primosome assembly site recognized by the PriA protein (PriA-pas) is
indicated by a black bar with an arrowhead indicating the direction of DNA
synthesis. (B) Structure of plasmid pEC22. The ColE2-derived segment (2.4
kb) and the segment containing a chloramphenicol resistance gene (1.2 kb) are
shown by an open box and a thin line, respectively. The position of the origin
(Ori) and the direction of replication are indicated by an open arrow.
1234
OC-
I
Figure 3. Localization and strand-specificity of newly synthesized DNA
fragments in early replicative intermediates. (A) The product synthesized with
[a-32P]dCTP (1000 c.p.m./pmol) in the absence (lanes 1 and 3) or presence
(lanes 2 and 4) of ddTTP as in Figure 3 was digested with EcoAllll (lanes 1 and
2) or Neil (lanes 3 and 4) and analyzed by electrophoresis in a 6%
polyacrylamide/7 M urea gel after heat treatment. Positions of unique DNA
fragments released from early replicative intermediates are indicated by their
approximate sizes (100 nucleotides for Eco47lll digests and 180 nucleofides for
Neil digests), deduced from size markers (pBR322 DNA digested simultaneously with Hindlll and Hind). The origin of electrophoresis is marked as O.
(B) The product synthesized with [a-32P]dCTP (10 000 c.p.m./pmol) in the
presence of ddTTP was digested with Eco47lli and analyzed before (lane 1) or
after (lane 2) alkaline treatment by electrophoresis in a 6% polyacrylamide/7 M
urea gel. The numbers on both sides of the panel are numbers of nucleotides
deduced from the sequencing ladders (M), which were produced by chemical
modifications of the 267 nucleotide Eco47lll—Xhol fragment labeled at the 5'
Eco47lll end (C, C+T, A+G and G, from the left to the right). The nucleotide
sequence of the marker fragment is identical to that of the lagging-strand
fragment. (C) The DNA fragment of 104 nucleotides (lanes 1 and 2) or 95
nucleotides (lanes 3 and 4) in B were purified and hybridized with
bacteriophage Ml3 DNA carrying the template strand for the leading strand
(lanes 1 and 3) or the lagging strand (lanes 2 and 4) at 65°C for 5 min. The
samples were analyzed by electrophoresis in a 1 % agarose gel as described in
Materials and methods. The position of M13 DNA is marked. The origin of
electrophoresis is marked as O.
ss-
Localization of the 5' and 3' ends of the newly
synthesized DNA fragments
Figure 2. Products synthesized in an in vitro ColE2 DNA replication system.
A standard reaction mixture containing 20 nM of pEC22 DNA and 50 p.M each
of 4 dNTPs with [a-32P]dCTP (1000 c.p.m./pmol) in the absence (lanes 1 and
2) or presence (lanes 3 and 4) of 50 nM ddTTP was incubated for 60 min at
32°C. The products were analyzed by electrophoresis in a 1% agarose gel
before (lanes 1 and 3) or after (lanes 2 and 4) heat treatment. Exposure of the
X-ray film for lanes 3 and 4 was ~3-fold as long as that for lanes 1 and 2.
Positions of covalently closed circular (CCC), open circular (OC) and
unit-length single-stranded (SS) plasmid DNA molecules are indicated. The
approximate position of the early replicative intermediates (I) is also indicated.
The origin of electrophoresis is marked as O.
A/c/1-digestion of the plasmid DNA (Fig. 3 A, lane 4). In addition
a broad DNA band of -180 nucleotides was found. The EcoAlWl
and Neil sites are located 148 and 229 bp, respectively,
downstream from the unique BglH site near the origin in the
direction of replication (Fig. 1). The results, therefore, suggested
that the 100 nucleotide DNA fragments produced by digestion
with Eco41Ul and the 180 nucleotide DNA fragments with Neil
were derived from the same longer DNA fragments with an end
located near the origin region.
In order to precisely localize the ends of the above mentioned
short DNA fragments in the origin region, the products formed by
Zsco47III digestion were analyzed by a DNA sequencing gel (Fig.
3B). The results showed that the broad DNA bands of -100
nucleotides long actually consisted of two DNA fragments of-95
and 107 nucleotides long (Fig. 3B, lane 1). Similar analysis with
the Afal-digested products gave a set of two DNA fragments of
-175 and 185 nucleotides long (data not shown). These results
showed that the short DNA fragments produced by digestion with
£cc47HI and Neil were derived from common DNA fragments
and made it possible to locate the ends of the fragments in the
origin region.
When the early replicative intermediates were digested with
EcoAllll followed by alkaline treatment and then analyzed by gel
electrophoresis (Fig. 3B, lane 2), two DNA fragments of-95 and
104 nucleotides long were produced. Similarly alkaline treatment
of the AWI-digested products shortened the longer DNA fragment
of the two (data not shown). These results suggested that the
longer of the two original fragments in each case contained about
Nucleic Acids Research, 1995, Vol. 23, No. 20 4199
Bgll
Bglll
5' AGATCTCGCAAAATGAGACCAGATAAGCCTTATCAGATAACAGCGCCCTTTTGGC
3' TCTAGAGCGTTTTACTCTGGTCTATTCGGAATAGTCTATTGTCGCGGGAAAACCG
•
•
1450
•
•
12 3 4 5 6 7 8
. •
1470
M I
105-4
102"
Figure 4. Nucleotide sequence of the BgRX—Bgli segment of ColE2 plasmid
containing the origin of replication. Nucleotide positions are numbered as
described (7). The leading-strand DNA fragment (an arrow above the sequence)
with RNA (a dotted line) at its 5' end starts around position 1470. The
lagging-strand DNA fragment (an arrow with a bar below the sequence) ends
at position 1479. The minimal origin region is indicated by a bracketed region.
three ribonucleotide residues at their 5' ends and that they might
be the leading strand that was elongated in the same direction as
that of the overall DNA replication.
To determine the strand specificity of these DNA fragments,
each of the 95 and 104 nucleotide DNA fragments produced by
£co47III digestion were purified and hybridized with bacteriophage M13 derivatives carrying the strand-specific probes for the
region containing the origin. The samples were analyzed by
electrophoresis in an agarose gel (Fig. 3C). The 104 nucleotide
DNA fragment specifically hybridized with the template strand
for the leading strand (Fig. 3C, lanes 1 and 2), demonstrating that
this fragment is a leading strand. The result roughly localized the
5' end of the 104 nucleotide DNA fragment around the G residue
at position 1470 in the origin region (Fig. 4). The RNA moiety at
the 5' end of the 107 nucleotide leading strand was probably the
primer RNA for initiation of ColE2 DNA replication or its
remnant. Whatever mechanism might produce the primer RNA,
it leaves precisely afixednumber of ribonucleotides. On the other
hand the 95 nucleotide DNA fragment specifically hybridized
with the template strand for the lagging strand (Fig. 3C, lanes 3
and 4) and therefore it is a lagging strand. The results localized the
3' end of the fragment at the C residue at position 1479 in the
origin region by comparison with the sequencing ladders (Fig. 4).
The 32 nucleotide origin segment of plasmid ColE2 (see Fig.
4) has been shown to support both in vivo and in vitro DNA
synthesis in the presence of the Rep protein (3,6). Thus the region
contains all the necessary pieces of information to start the
leading-strand DNA synthesis and to terminate the lagging-strand
DNA synthesis in the origin region in the presence of the Rep
protein.
Ribonucleotide triphosphates dependency of the
leading strand synthesis
The in vitro ColE2 DNA synthesis was stimulated only little by
addition of the four rNTPs, probably because enough amounts of
them are contained in a crude cell extract (6). Therefore, a cell
extract was passed through a gel filtration column to remove
rNTPs and used for the in vitro ColE2 DNA synthesis (Table 1).
The activity was considerably lower than that of the untreated
one, probably because of dilution of some essential cellular
components. When either ATP or GTP was omitted, DNA
synthesis decreased significantly. On the other hand, when either
CTP or UTP or both were omitted, DNA synthesis decreased only
a little, if at all. The results suggested that the initiation of ColE2
DNA synthesis requires ATP and GTP, but not CTP and UTP.
95- '
Figure 5. Newly synthesized DNA fragments produced infilteredcell extracts.
Early replicative intermediates were prepared in the cell extracts used for
experiments in Table I with all four rNTPs (lanes 1 and 2) or without CTP (lanes
3 and 4), UTP (lanes 5 and 6) or both UTP and CTP (lanes 7 and 8) and digested
with EcoAlYH. The samples were analyzed by polyacry lamide gel electrophoresis before (lanes 1,3,5 and 7) or after (lanes 2,4,6 and 8) treatment with alkali
as in Figure 3B.
Table 1. Dependence on rNTPs of in vitro ColE2 DNA replication
Component omitted
dCMP incorporation
pmol
%
None
3.0
100
ATP
0.7
23
GTP
0.7
23
UTP
3.0
100
CTP
2.0
67
UTP, CTP
2.5
83
Crude cell extracts of NT525 and NT525 (pTI 12-6Arep) were passed through
Sephadex G-25 columns (0.5 x 6 cm) to remove rNTPs. Standard reaction mixtures containing 10 u.1 of rNTP-free NT525 extract, 5 Hi of rNTP-free NT525
(pTI12-6A/-c/)) extract, 20 nM pEC22 DNA and [a- 32 P]dCTP (1000 c.p.m./
pmol) were incubated at 32°C for 60min with omissions as indicated. Incorporation without the Rep protein fraction (-0.6 pmol) was subtracted from each
value.
The products synthesized in the filtered extract were then
analyzed by a DNA sequencing gel (Fig. 5) as described above.
Omission of either CTP or UTP or both showed essentially no
effects on the synthesis of the leading- and lagging-strand DNA
fragments and the size of the RNA residues at the 5' end of the
leading-strand fragment was unaffected. On the other hand, when
ATP or GTP was omitted, very small amounts of the leading- and
lagging-strand fragments were detected (data not shown), which
could be due to incomplete removal of ATP and GTP. These
results suggested that the primer RNA is only composed of
adenine and guanine nucleotides.
Roles of some host Dna proteins in initiation of ColE2
DNA replication
To examine possible involvement of some of the host Dna
proteins {dna gene products), especially the DnaG protein
(primase), in the initiation reaction of the ColE2 DNA replication
we used an E.coli strain carrying a temperature-sensitive
mutation in each of the dnaB, dnaC, dnaG and dnaZ genes. In
4200 Nucleic Acids Research, 1995, Vol. 23, No. 20
strand DNA synthesis at the origin but that they are required for
the continuation of elongation of the leading-strand DNA. In
addition the results suggested that all these Dna proteins are
required for the lagging-strand DNA synthesis, which is consistent
with the results reported previously (9,10). Similar uncoupling of
the leading-strand DNA synthesis from the lagging-strand DNA
synthesis in the dnaG cell extract has been reported previously in
the ColEl DNA replication system (22).
DISCUSSION
Figure 6. Products synthesized in cell extracts of mutant dna bacteria. (A) A
standard reaction mixture containing a cell extract of dnaC (lanes 1 and 2) or
dnaG (lanes 3 and 4) mutant bacteria was incubated for 60 min at 32°C and
analyzed as in Figure 2 before (lanes 1 and 3) or after (lanes 2 and 4) heat
treatment. Species of DNA molecules are indicated as in Figure 2. (B) The
labelled DNA fragments produced in a dnaC mutant cell extract (lanes 1 and
2), those produced in a dnaG mutant cell extract and cleaved with Rsal (lanes
3 and 4) or those produced in the wild-type cell extract and cleaved with Rsal
(lanes 5 and 6) were heated and hybridized with bacteriophage Ml3 DNA
carrying the probe for the leading-strand (lanes 1, 3 and 5) or lagging-strand
(lanes 2, 4 and 6) component. Hybridization products were analyzed as in
Figure 2. The positions of bacteriophage Ml 3 DNA are indicated. The positions
of free DNA fragments are shown by a bracket.
vitro ColE2 DNA replication in each of these cell extracts was less
than that in a cell extract prepared from the wild-type bacteria
treated similarly: about one-tenth to one-twentieth for the dnaB,
dnaC and dnaZ cell extracts and about one-third for the dnaG cell
extract (data not shown).
We then examined the structure and strand specificity of the
reaction products as described above (Fig. 6). Early replicative
intermediates (Fig. 6A, lanes 1 and 2) containing newly
synthesized leading-strand DNA fragments (Fig. 6B, lanes 1 and
2) were accumulated in the dnaC cell extract. On the other hand
the dnaG extract yielded the products consisting of the CCC and
OC molecules (Fig. 6A, lanes 3 and 4), indicating that a round of
replication was completed. The labelled DNA fragments synthesized in the dnaG cell extract were, however, revealed to be
exclusively the leading-strand components (Fig. 6B, lanes 3 and
4). When the products synthesized in the dnaC cell extract or
those synthesized in the presence of ddTTP in the dnaG cell
extract were treated with EcoAllW, the leading-strand DNA
fragment with a few ribonucleotide residues at its 5' end derived
from the origin region identical to that synthesized in the presence
of ddTTP in the wild-type cell extract (see Fig. 3B) were detected
(data not shown). The products made in the dnaB and dnaZ cell
extracts gave results similar to that in the dnaC cell extract (data
not shown).
These results showed that the leading-strand DNA synthesis
initiated at the origin in the dnaG cell extract just as in the
wild-type cell extract and that a complete round of the leadingstrand DNA synthesis also occurred. As the cell extract of the
same dnaG mutant prepared by a method similar to that used in
this study has been known to lack DnaG activity required for the
())X174 DNA synthesis even at 30 °C (22), it is suggested that the
DnaG protein is not required for the initiation of the leadingstrand DNA synthesis at the origin and for the continuation of its
elongation. These results also suggested that the DnaB, DnaC and
DnaZ proteins are not required for the initiation of the leading-
We analyzed the initiation of ColE2 DNA replication in an in vitro
system using a crude extract of E.coli cells and identified the
leading- and lagging-strand DNA fragments synthesized in the
region containing the origin. The results suggested that the
initiation of the leading-strand DNA synthesis at the origin does
not require the host DnaG protein. ColE2 DNA replication in
vitro has been shown to specifically require ColE2 Rep protein
and host DNA polymerase I but not host RNA polymerase (6).
Therefore the leading-strand DNA fragment described here is
probably the first one to be synthesized and its synthesis is
mediated by a plasmid-specific priming system containing the
Rep protein. The ColE2 Rep protein itself seems to be a priming
enzyme. Although a possibility that DNA polymerase I is the
catalytic enzyme for primer RNA synthesis and that the ColE2
Rep protein is a specific cofactor can not be completely ruled out,
we believe it unlikely, because incorporation of ribonucleotides
by DNA polymerase I is very inefficient and occurs under a
nonphysiological condition (23).
If the ColE2 Rep protein is really a primase, it is unique among
other known primases in that it specifically binds to the origin in
a double-stranded form (8) and that it synthesizes a unique primer
RNA at the origin. The gene a protein of bacteriophage P4
specifically binds to the P4 origin in a double-stranded form (24)
and possesses a primase activity (24-26) but synthesis of primer
RNA molecules at the origin has not been examined. All other
known primases bind only to single-stranded DNA (for a review
see ref. 27).
Among plasmid replicons which replicate through the thetatype replicative intermediates, transition points from the primer
RNA to DNA in the leading strand synthesis depending upon the
origin sequences have been identified for ColEl-type plasmids
(28-31), IncFII plasmids (32-34) and plasmid pAMfJ 1 (35). The
primer RNA of ColEl is formed by RNA polymerase and RNase
H (36,37) and DNA polymerase I starts DNA synthesis. Three
consecutive transition points at a unique site have been identified
but the nucleotide sequence in the region containing the transition
points does not need to be specific for ColEl (38,39). The primer
RNA of IncFII plasmids is synthesized by E.coli DnaG protein
with the aid of the plasmid-specified RepA protein and the host
proteins including the DnaA and DnaB proteins and the replisome
containing DNA polymerase III starts DNA synthesis. Multiple
transition sites have been identified outside the essential origin
region. For plasmid pAMpl a single unique transition point in the
origin has been identified. DNA polymerase I seems to start DNA
synthesis (40), but nothing is known about the primer formation.
For plasmid ColE2 the primer RNA synthesis for initiation of the
leading-strand DNA synthesis and the transition from RNA to
DNA occur at specific sites in the essential origin region, where
ColE2 Rep protein binds (8). The primer RNA seems to be
Nucleic Acids Research, 1995, Vol. 23, No. 20 4201
synthesized by the Rep protein and it is specifically used by DNA
polymerase I to start the leading-strand DNA synthesis.
The lagging-strand DNA synthesis terminates at a unique
position just at the right end of the origin region. We have shown
that the termination of DNA synthesis in vitro at the particular
position requires the presence of the Rep protein in the reaction
(unpublished results). The Rep protein might stay bound to the
origin after initiation of replication and physically prevent the
replisome synthesizing the lagging-strand DNA from traveling
through the origin. This is likely to be the cause for unidirectional
replication of ColE2 plasmid.
No specific 5' ends of the lagging-strand DNA fragments near
the origin were detected in this study. The lagging-strand DNA
synthesis probably starts at multiple sites depending upon the
Y*nA.-pas site (a primosome assembly site specifically recognized
by the PriA protein) located downstream from the origin (see Fig.
1 A) and upon the E.coli proteins including the PriA, DnaB, DnaC
and DnaG proteins (9,10). The PriA-pas of plasmid ColE2,
however, is dispensable for ColE2 DNA replication (3). The
situation is quite similar to that in plasmid ColEl. It has been
known that the YriiK-pas located downstream from the origin is
dispensable for normal ColEl DNA replication but that inactivation of the host priA gene drastically reduces the plasmid copy
number (41).
We propose a possible scheme for initiation of ColE2 DNA
replication based upon the previous and present results. The
ColE2 Rep protein binds to the origin region and synthesizes a
specific primer RNA. DNA polymerase I starts the leading-strand
DNA synthesis by using the primer RNA. Initiation of the
lagging-strand DNA synthesis takes place on the displaced
leading-strand and continuation of the leading- and laggingstrand DNA syntheses occurs just as proposed for the ColEl
DNA replication previously (9,37,42). The lagging-strand synthesis terminates at the origin due to the Rep protein staying
bound, which results in unidirectional replication. We have
recently reconstituted the initiation reaction of the leading-strand
DNA synthesis by using the purified ColE2 Rep protein and DNA
polymerase I and showed that the ColE2 Rep protein synthesizes
oligoribonucleotides (Takechi, Matsui and Itoh, submitted).
ACKNOWLEDGEMENTS
We are grateful to Hideyuki Ogawa, Tomoko Ogawa and
Toshihiro Horii for their helpful discussions and continuing
encouragement and Jun-ichi Tomizawa for critical reading of the
manuscript. We also thank Motoko Hori-Mori for her participation in the early phase of this work and T. Ogawa, T. Nagata and
M. Inuzuka for materials used. This work was supported in part
by a grant-in-aid for Scientific Research from the Ministry of
Education, Science and Culture of Japan.
REFERENCES
1 Herschman,H.R. and Helinski.D.R. (1967) J. Bacterioi, 94, 691-699.
2 Bazaral,M. and Helinski.D.R. (1968) J. Mol. Biol., 36,185-194.
3 Horii,T. and Itoh.T. (1988) Mol. Gen. Genet., 212, 225-231.
4 Kingsbury.D.T. and Helinski.D.R. (1970) Biochem. Biophys. Res. Comm.,
41,1538-1544.
5 Tacon.W. and Sherratt,D.J. (1976) Mol. Gen. Genet., 147, 331-335.
6 Itoh,T. and Horii.T. (1989) Mol. Gen. Genet., 219, 249-255.
7 Yasueda,H., Horii.T. and ItohJ. (1989) Mol. Gen. Genet., 215, 209-216.
8 Kido,M., Yasueda,H. and ltoh,T. (1991) Nucleic Acids Res., 19,
2875-2880.
9 Masai,H., Nomura,N., Kubota.Y. and Arai,K. (1990) / Biol. Chem., 265,
15 124-15 133.
10 Nomura,N., Masai,H., Inuzuka,M., Miyazaki.C, Ohtsubo.E., Itoh.T.,
Sasamoto,S., Matsui,M., Ishizaki.R. and Arai.K. (1991) Gene, 108, 15-22.
11 Gellert.M, O'Dea,M., Itoh.T. and TomizawaJ. (1976) Proc. Natl. Acad.
Sci. USA, 73, 4474-4478.
12 Kohiyama,M., Cousin.D., Ryter.A. and Jacob.F. (1966) Ann. Inst. Pasteur,
110, 465^*86.
13 Ogawa,T. (1975)7. Mol. Biol., 94, 327-340.
14 Carl,P. (1970) Mol. Gen. Genet., 109, 107-122.
15 Wechsler,J.A. and GrossJ.D. (1971) Mol. Gen. Genet., 113, 273-284.
16 Filip.C.C, AllenJ.S., Gustafson.R.A., Allen.R.G. and WalkerJ.R. (1974)
J. Bacterioi., 119, 443-449.
17 Bolivar.E, Rodriguez.R.L., Greene.P.R, Betlach.M.C, Heyneker.H.L. and
Boyer,H.W. (1977) Gene, 2, 95-113.
18 Yanisch-Perron.C, VieraJ. and MessingJ. (1985) Gene, 33, 103-119.
19 MessingJ. (1983) In Wu,R., Grossman.L. and Moldave,K. (eds), Methods
Enzymology. Academic Press, New York, Vol.101, pp. 20-78.
20 SambrookJ., Fritsch,E.F. and Maniatis.T. (1989) Molecular Cloning: A
Laboratory Manual. 2nd edn, Cold Spring Harbor Laboratory Press, New
York.
21 Maniatis,T., Fritsch.E.F. and SambrookJ. (1982) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY.
22 Staudenbauer.W.L., Scherzinger,E. and Lanka,E. (1979) Mol. Gen. Genet.,
177, 113-120.
23 Van de SandeJ.H., Loewen,P.C. and Khorana.H.G. (1972) J. Biol. Chem.,
247,6140-6148.
24 Ziegelin.G., Scherzinger.E., Lurz,R. and Lanka.E. (1993) EMBO J., 12,
3703-3708.
25 Krevolin,M.D. and Calendar,R. (1985) J. Mol. Biol., 182, 509-517.
26 Strack,B., Lessl,M., Calendar.R. and Lanka.E. (1992) J. Biol. Chem., 267,
13 062-13 072.
27 Kornberg,A. and Baker.T. (1992) DNA Replication, 2nd edn, W.H.
Freeman and Co., New York.
28 TomizawaJ., Ohmori.H. and Bird.R.E. (1977) Proc. Natl. Acad. Sci. USA,
74, 1865-1869.
29 Bolivar,F., Betlach,M.C, Heyneker.H.L., ShineJ., Rodriguez.R.L. and
Boyer,H.W. (1977) Proc. Natl. Acad. Sci. USA, 74, 5265-5269.
30 Som,T. and TomizawaJ. (1982) Mol. Gen. Genet., 187, 375-383.
31 Selzer.G., Som.T., Itoh.T. and TomizawaJ. (1983) Cell, 32, 119-129.
32 Miyazaki.C, Kawai.Y, Ohtsubo.H. and Ohtsubo.E. (1988) J. Mol. Biol.,
204,331-343.
33 Masai.H. and Arai.K. (1989) J. Biol. Chem., 264, 8082-8090.
34 Bernander.R., Krabbe.M. and Nordstrom.K. (1992) EMBO J.,U,
4481^*487.
35 Bruand,C, Ehr!ich,S.D. and Janniere,L. (1991) EMBO J., 10, 2171-2177.
36 Itoh,T. and TomizawaJ. (1980) Proc. Natl. Acad. Sci. USA, 77,
2450-2454.
37 Dasgupta.S.. Masukata.H. and TomizawaJ. (1987) Cell. 51. 1113-1122.
38 Ohmori.H., Murakami.Y. and Nagata,T. (1987) J. Mol. Biol., 198,
223-234.
39 Masukata,H. and TomizawaJ. (1990) Cell, 62, 331-338.
40 Bruand.C, Le Chatelier,E., Ehrlich.S.D. and Janniere,L. (1993) Proc. Natl.
Acad. Sci. USA, 90, 11 668-11 672.
41 Nurse,P., Zavitz.K.H. and Marians.KJ. (1991) / Bacterioi., 173,
6686-6693.
42 Masukata,H., Dasgupta.S. and TomizawaJ. (1987) Cell, 51, 1123-1130.