CSI@LSI
CSI at the LSI Storyboard
THE CRIME:
Victim – Eve Hill:
Eve was a graduate student who was not well liked at the Life
Sciences Institute. Eve tended to work odd hours and was often
still at the LSI late into the evening working by herself. She was
found dead at her bench on the morning of Wednesday, October
24th and the autopsy revealed that the cause of death was
poisoning. There was an apparent struggle during which Eve
grabbed some of the attacker’s hair and as the struggle
progressed, some spit transferred from the attacker onto Eve’s
cheek. These samples as well as some of the victim’s blood and
skin cells were collected for subsequent forensic analysis.
Eve Hill
Samples collected from all of the suspects, to be matched with samples that transferred from the
suspect onto the victim.
Hair Sample (Eve managed to grab a handful of the suspect’s hair)
DNA and protein will be used from these samples to narrow down the suspects in the
DNA and protein gel workshops
Saliva Sample (suspect’s saliva got on Eve’s face during the struggle)
Microflora (bacteria) samples will be cultured in the microbiology workshop to see which
suspect has the incriminating strain
Skin Cell Sample
Skin cells taken from Eve to detect the poison will be used to compare against samples
taken from all of the suspects in the actin staining and electron microscopy workshop
Blood Sample
Blood taken from Eve will be used to determine what the toxin/poison was in the mass
spectroscopy workshop
Poison #1: Murderamine – causes a disruption of the actin cytoskeleton
Poison #2: Deathanolamine – results in nuclear disruption and cell death
You will want to pay attention to who had access to poison 1 and poison 2!
Orientation: The Crime Scene and Suspects
SAMPLES COLLECTED:
CSI@LSI
SUSPECTS and MOTIVES:
Suspect #1: Kerri Oki
A fellow graduate student at the Life Sciences Institute (LSI) who works
on a similar project as Eve in a different research lab. Recently, Eve
secretly worked on Kerri’s project and published her results in a scientific
journal without Kerri’s knowledge or permission. Kerri was then unable
to publish her work, preventing her from graduating this year. Kerri has
access to poisons #1 (murderamine) and #2 (deathanolamine).
Kerri Oki
Suspect #2: QWERTY Pixel
The building custodian works alone at night. She has been seen recently
yelling with Eve about her messy habits. QWERTY was recently
suspected of stealing some lab supplies including poison #2
(deathanolamine) last month.
Anna Sasin
Suspect #3: Anna Sasin
Eve’s ex-best friend and fellow graduate student in the LSI. Anna and
Eve have been close friends since their first year at UBC. Recently,
Anna’s long-time boyfriend Pepe left her and Eve tried to console her
through that emotional time. Anna recently found out, however, that Pepe
left her to be with Eve and they haven’t spoken since. Anna has access to
poison #1 (murderamine).
Orientation: The Crime Scene and Suspects
QWERTY Pixel
Pixel:
CSI@LSI
Suspect #4: Dr. Cal Sium
Eve’s graduate supervisor, Dr. Sium, was reluctant to take Eve as a
graduate student in his lab because he felt that her work ethic was
unprofessional and very slow. He recently lost research funding because
Eve did not complete the experiments he needed for the grant application.
Dr. Sium has access to poisons #1 (murderamine) & 2 (deathanolamine).
Dr. Cal Sium
Suspect #5: Dewey Hafta
Dewey is an undergraduate student who was in Eve’s tutorial last term.
He recently found out that Eve failed him in his tutorial and when
approached, she refused to reconsider her assessment of his work. As a
result, his grades were just below the pre-requisite average cut-off to
apply for the Medical School program.
Dewey Hafta
Suspect #6: Pepe Roni
Pepe is a fellow graduate student in the LSI. Eve recently convinced Pepe
to leave long-time girlfriend Anna to be with her. After 3 dates, Eve then
told Pepe that she didn’t have time to be in a serious relationship right
now and wanted to just be friends like before. Pepe has access to poison
#1 (murderamine).
Suspect #7: Chuck Wagon
Chuck is a ‘shady’ repairman that comes to the lab to fix broken lab
equipment. The majority of the time, he has to come into the lab for
unpaid overtime to fix the equipment that Eve uses carelessly and doesn’t
clean properly resulting in them breaking quite frequently. Chuck was
known to be working late at the LSI the night of the murder.
Chuck Wagon
Orientation: The Crime Scene and Suspects
Pepe Roni
CSI@LSI
þ
¨
¨
¨
2
Flow Alarm = Loud beeping and strobe light
Notify workshop supervisor
¨
3
Fume Hood Alarm = Beeping alarm
Notify workshop supervisor
¨
4
Elevator Alarm = Loud horn
Contact building security
¨
5
¨
6
Locate Emergency Exits
In the Event of an Earthquake: Move under lab bench until shaking stops, exit building
when instructed to do so
General Lab Safety
7
Locate Fire Extinguishers
Middle of the wing
¨
8
Emergency Eyewash and Showers:
Showers are in the middle of each wing
Showers are also in the washrooms at the end of the hall
Eye washes are located at every sink
¨
¨
¨
¨
9
Spill Kits
Located near washrooms on each floor of each wing
¨
10
11
No Food/Drink in the Lab (Includes gum)
Locate First Aid Kit
12
Laboratory dress: No shorts, skirts or sandals allowed in the lab for safety reasons.
¨
¨
¨
PPE needed: Gloves are mandatory for all students
Lab coats mandatory for all students
Safety goggles if required by workshop instructor
Don’t wear PPE outside of lab or to washroom, don’t touch door handles with gloves
Hand washing is required every time that you leave the lab area
Equipment: DO NOT Touch anything unless instructed to do so
Fume Hoods: Locate
¨
¨
¨
¨
¨
¨
¨
17
Hazardous Materials: Consider everything a hazardous material
Chemicals, Radioactivity, Sharps, Biohazardous materials
¨
18
Flammables: (NO OPEN FLAMES in lab)
Locate gas outlets on bench tops
Be aware of flammable materials being used
¨
¨
¨
19
Radiation and Biohazards: Do not touch anything with a warning label on it
¨
13
14
15
16
¨
Orientation: Safety Checklist
Safety Check List
General Building Safety
Alarms
Fire Alarm = Claxon horn
1
Evacuate the building immediately with your workshop supervisor
Know where pull alarm stations are (located near stair cases)
CSI@LSI
Workshop 1: DNA Fingerprinting and Agarose Gel Electrophoresis
Introduction
We have multiple suspects and we need to determine which suspect is responsible for the crime.
DNA from each suspect has been collected to compare to DNA extracted from the hair sample
found on the victim.
Figure 1. Structure of DNA.
DNA structure and sequence
DNA is a long thin molecule made up of nucleotides as building blocks. There are four different
types of nucleotides:
•
•
•
•
A- adenine
T- thymine
C - cytosine
G - guanine
Holding the nucleotides together is a backbone made of phosphates (P) and deoxyriboses (D). In
total, around 3 billion nucleotide pairs make up DNA in a single cell. The sequence of A, C, T,
and G’s in the DNA is called the “Genetic Code” because it codes for all the information needed
to make a complete organism.
Workshop 1: DNA Fingerprinting and Agarose Gel Electrophoresis
Basic Principles of DNA
CSI@LSI
DNA polymorphisms and DNA fingerprinting
Even though we are all unique, 99.9% our DNA is actually identical to other people’s DNA. The
0.1% DNA is variable between people and these variable regions are called DNA
polymorphisms. Variable number of tandem repeats (VNTRs) are a type of DNA
polymorphism. VNTRs are regions of DNA that contains repeats of the same nucleotide
sequence. For example, GATAGATAGATAGATAGATAGATA is a VNTR where the
sequence GATA is repeated six times. We inherit a copy of DNA from each of our parents;
therefore, we have two copies of DNA. So, we all have a very unique pair of VNTRs. For
example, we may have GATAGATAGATAGATAGATAGATA (6 repeats) and
GATAGATAGATAGATA (4 repeats). If a person has the same length of VNTR on both copies
of DNA, that person is homozygous. If they have different lengths of VNTR on their copies of
DNA, they are heterozygous.
Figure 2. Variable number of tandem repeats (VNTRs) for three individuals.
Since the pair of VNTR is unique to each person, VNTRs can be analyzed to give a DNA
fingerprint.
Workshop 1: DNA Fingerprinting and Agarose Gel Electrophoresis
Are these individuals homozygous or heterozygous for the VNTR?
CSI@LSI
Agarose Gel Electrophoresis
Today we will be using agarose gel electrophoresis to analyze VNTRs in the DNA samples
from our suspects, our victim, and the unknown DNA collected at the crime scene.
Agarose gel electrophoresis involves using electricity to separate DNA fragments by size.
Samples are loaded into small depressions (wells) in the agarose gel, and an electric field
applied. DNA is negatively charged, so it travels towards the positive pole. The agarose gel acts
like a mesh – smaller fragments move faster through this mesh and larger ones more slowly. A
DNA ladder is also loaded, a set of fragments of DNA of known sizes. The DNA is stained with
a dye and visualized under a special ultraviolet (UV) light, and then a photo is taken for analysis.
Student Worksheet
Today we will be analyzing DNA samples from our suspects, our victim, and the unknown
sample taken from the crime scene. DNA has already been extracted for you, and we will be
analyzing the VNTRs for each sample.
Today’s tasks - each group will perform these tasks:
Task
1
2
3
4
5
Prepare Agarose gel
Prepare/Load samples
Run gel
Image gel
Analyze the results
Description
Melt agarose and pour gel
Mix DNA samples with loading dye and load the gel
Separate samples based on size
Expose gel and take a picture of the results
Rule out suspects that didn’t commit the crime
Workshop 1: DNA Fingerprinting and Agarose Gel Electrophoresis
Figure 3. Schematic illustrating the procedure for agarose gel electrophoresis.
CSI@LSI
Samples: We will be running nine samples; be sure to know which order you load them in!!
Lane
1
2
3
4
5
6
7
8
9
10
Samples
DNA Ladder – 100bp
Victim’s Sample
Unknown Sample from Crime Scene
Suspect # 1
Suspect # 2
Suspect # 3
Suspect # 4
Suspect # 5
Suspect # 6
Suspect # 7
Remember that each individual may have one or two bands for each VNTR. If they have one
band, they are homozygous at this specific VNTR, and two bands mean they are heterozygous.
Task 1: To make an agarose gel, combine 1.5 g of Agarose with 150 mL of Buffer in a flask.
Place the flask in a microwave, and microwave for approximately 1 minute. When the solution is
completely clear, it is ready. CAUTION: it is very hot so do not touch it without a hot glove. Let
the agarose cool and add DNA dye. Pour the gel into the casting tray and let it solidify.
Task 2: Remove the comb from the now-solid agarose gel and place the gel apparatus in the
tank. Pour some buffer to cover the gel. Mix DNA samples with DNA dye (for a 20 uL sample,
add 4 uL DNA dye). This dye will allow us to visualize the DNA under UV light. Load the
samples into each well.
Task 3: Place the lid on the gel tank and connect it to power source. Make sure to connect red to
red and black to black. Your DNA is ready to migrate towards the positive pole! Wait
approximately 30 minutes for DNA migration.
Task 4: When the dye has reached ~2/3 of the way down the gel, turn off the power source and
disconnect the gel tank. Carefully remove gel apparatus from the gel tank. Expose the gel to UV
light (ask for help from the coordinator).
Task 5: The coordinator will print a picture of your gel for you. Try to eliminate suspects from
your list by answering the questions in your “results worksheet”. Good work!
Workshop 1: DNA Fingerprinting and Agarose Gel Electrophoresis
Detailed DNA Fingerprinting Instructions
CSI@LSI
Workshop 2: SDS-PAGE and Western Blotting
Introduction
We have multiple suspects and we need to determine which one is responsible for the crime.
Investigators have collected hair samples left at the crime scene, which means we have a protein
sample to use to identify the suspect. Investigators then collected hair samples from each of the
suspects to be compared to the one found at the scene. Using a technique called western blotting
we can compare the protein samples and rule out suspects if they do not match the crime scene
sample.
Basic Principles
Proteins
Most of the genetic code is identical within the human population, however, there are a few
genes that differ from person to person making us unique. DNA is transcribed into RNA which
is then translated into a string of amino acids to make a protein. Proteins can be further modified
in the following ways:
Not translated at all
Truncated or elongated
Post-translational modification (eg. addition of sugar groups)
Signaling-induced modification (eg. phosphorylation)
Figure 1. Different types of protein modification
The size of the final protein product will be a result of the amino acid sequence (as dictated by
the genetic code) and the post-translational modifications which it undergoes. The variation in
protein size allows us to identify individual proteins with a technique called western blotting.
Workshop 2: SDS-PAGE and Western Blotting
a)
a)
b)
c)
CSI@LSI
SDS-PAGE and Western Blotting
S - sodium
D - dodecyl
S - sulfate
P - poly
A - acrylamide
G - gel
E – electrophoresis
A given sample contains many, many proteins of different kinds. When we only want to look at
a specific protein in a sample we use a combination of two techniques, SDS-PAGE and western
blotting. SDS-PAGE allows us to physically separate proteins of different sizes contained in a
single sample. Western blotting allows us to detect only the proteins we care about after they
have been separated by SDS-PAGE. First sodium dodecyl sulfate (SDS) is added to the protein
samples to coat them evenly in a negative charge. Each protein sample is then loaded onto one
lane of a polyacrylamide gel. When electricity is applied to the gel, the SDS-coated proteins
(negative) move away from the negative electrode at the top toward the positive electrode at the
bottom; this movement is called electrophoresis. The polyacrylamide gel acts like a sieve, so
that small proteins can move quickly through the gel, while the larger proteins move more
slowly. As a result, proteins of different sizes can be separated on the gel (Figure 1).
(-) Negative
Movement
Large Protein
(+) Positive
Protein Ladder
Figure 2. Protein Gel (SDS-PAGE)
Once the proteins are separated by size using SDS-PAGE they are transferred from the gel to a
nitrocellulose membrane. The proteins adhere to the membrane creating a replica of the gel. To
detect a single protein of interest we then use western blotting in which the membrane is treated
with an antibody which will only bind to our protein of interest. Finally, a dye that reacts with
the antibody is added to detect the antibody bound to our protein and the signal is captured on
film. (Figure 2).
Workshop 2: SDS-PAGE and Western Blotting
Small Protein
Figure 3. SDS-PAGE and Western blotting for protein of interest
Workshop 2: SDS-PAGE and Western Blotting
CSI@LSI
CSI@LSI
Workshop 3: Microbiology
Background
We have multiple suspects and we need to determine which one is responsible for the crime.
There was an apparent struggle during which some spit transferred from the attacker to the
victim. The saliva was collected and it was analyzed by microbiological techniques to determine
the attacker’s microflora. Samples from all the suspects have been collected and analyzed.
Lab Introduction and Safety
Proper safety techniques are important in any laboratory setting, but they are imperative in
microbiology. In this field, improper lab technique could cause you or one of your classmates to
become ill. When handled properly, the organisms should not pose a risk; when handled
improperly however, the “bad” organisms find ways to do what they do best, make you ill. In
addition, in the lab we use other tools such as the flame, which must be handled properly and
with respect.
Working Aseptically
When working with organisms, it is important to maintain a clean environment. Talking,
coughing or sneezing should be avoided when working with bacterial cultures. Microorganisms
thrive essentially everywhere, so it is far too easy to contaminate your lab tests with stray
organisms from the air, the countertop, or your tools.
1. Autoclave media. In microbiology we use different media to grow microorganisms.
These media are usually a very rich source of nutrients; so many microorganisms already
present in there could grow and interfere with the organism we are trying to study. We
use high temperatures (121°C) for 10 min to eliminate them.
2. Maintain a clean environment. Once your media is sterile you don’t want it to be
contaminated with other microorganisms. Therefore, it is very important to maintain a
clean environment. You can do this by disinfecting tabletops before and after working
with microorganisms.
3. Working at the flame. A very important technique in microbiology is transferring
Workshop 3: Microbiology
Because we want to avoid contamination of our samples (which will give us incorrect results) we
have to work using the “aseptic technique”. Aseptic technique is a means of performing lab work
that greatly reduces the risk of contamination. There are many procedures to follow in order to
work in aseptic conditions:
CSI@LSI
microorganisms from one to another media. You have to do this in aseptic conditions. For
this reason you work at the flame. The heat provided by the flame makes the air around
it circulate inside-out, thereby creating a clean environment free of microorganisms in an
area approximately 30 cm around the flame. To transfer microorganisms you need loops
or swabs. The flame is also used to sterilize the loop in between transfers. To do this you
hold it in the flame until the metal glows orange-red. At this point sterilization is
considered complete.
Streak for isolation
One of the most important techniques in microbiology is to streak for isolation. As you might
guess, the purpose of streaking for isolation is to produce isolated colonies of an organism on an
agar plate. This is useful when you need to separate organisms in a mixed culture to study the
colony characteristics of an organism.
Figure 1. Streak for isolation technique.
Workshop 3: Microbiology
When streaking for isolation, you will begin by streaking a portion of your agar plate with an
inoculum. Then, after flaming the loop in between every step, you will streak successive areas
of your plate in an attempt to dilute the original inoculum so that single colony forming units
(CFUs) will give rise to isolated colonies. In Figure 1 you can see a graphic example of how to
do it.
CSI@LSI
Microorganism characteristics
How can you tell a tiger from a wolf? By observing the characteristics of the animal: shape,
color… In the same way, each species of bacteria exhibits characteristics (cultural, cellular,
biochemical) that, when taken together, can be used to differentiate the bacterial species in
question from other species of bacteria.
The simplest of these to observe are the cultural characteristics (also referred to as colonial
morphology) of an organism; you will need a plate on which there are isolated colonies of the
bacteria to be studied.
Blood agar
To determine who of the suspects is responsible for the crime we’ll use blood agar to isolate
single colonies from the saliva of the suspects and observe their hemolytic characteristics. Blood
agar contains general nutrients and 5% sheep blood. It is useful for cultivating fastidious
organisms and for determining the hemolytic capabilities of an organism.
Figure 2. Structure of bacteria cell wall.
Workshop 3: Microbiology
After analyzing the saliva found on the victim, it was containing a gram positive bacteria (See
figure 2) called Staphylococcus aureus, which is beta-hemolytic.
CSI@LSI
It has been reported that S. aureus is present in the anterior nares and the throat of individuals.
Approximately, 30% of the healthy population carries S. aureus in their anterior nares and 10%
also in the throat. S. aureus can cause a range of illnesses from minor skin infections to lifethreatening diseases, such as pneumonia and meningitis. It can occur in the skin, soft tissue,
respiratory tract, or wound infections. It is still one of the four most common causes of
nosocomial infections, often causing postsurgical wound infections. S. aureus was discovered in
Aberdeen, Scotland in 1880 by the surgeon Sir Alexander Ogston in pus from surgical abscesses.
Each year some 500,000 patients in American hospitals contract a staphylococcal infection.
Some bacteria produce proteins that lyse red blood cells and degrade hemoglobin; these are
called hemolysins. Bacteria can produce different types of hemolysins (See Figure 3). Betahemolysin breaks down the red blood cells and hemoglobin completely. This leaves a clear zone
around the bacterial growth. Such results are referred to as β-hemolysis (beta hemolysis). Alphahemolysin partially breaks down the red blood cells and leaves a greenish color behind. This is
referred to as α-hemolysis (alpha hemolysis). The greenish color is caused by the presence of
biliverdin, which is a by-product of the breakdown of hemoglobin. If the organism does not
produce hemolysins and does not break down the blood cells, no clearing will occur. This is
called γ-hemolysis (gamma hemolysis).
Figure 3. Alfa-hemolysis (left) and beta-hemolysis (right).
You may be surprised to discover places where bacteria live. As an example, only on the tip of
your fingers there are more bacteria than humans in the world! You can investigate where are
more bacteria, on the sole of your shoe, on your lip balm, on the water fountain, your hands...?
The answers may surprise you!
Workshop 3: Microbiology
Ubiquity of microorganism
CSI@LSI
Workshop 4: Cytoskeletal Fluorescent Imaging
Introduction
We know that some of the suspects have access to lethal agents that disrupt the actin
cytoskeleton, and we suspect from other observations of the cadaver that the cause of death was
poisoning. We have cultured skin cells from the deceased and are looking for actin cytoskeleton
disruption, and comparing them to skin cells collected from the suspects. Any of the suspects
that have been exposed to the poison by handling it will show the same cytoskeletal disruption as
the victim.
Basic Principles
Figure 1. Cytoskeleton of a cell.
Actin is also found in specialized structures such as
microvilli. Depending on the location within the cell, the
type of network formed can appear different. For example,
cells that move in response to a signal first send out
projections called filopodia that are formed when tight
parallel bundles of actin push the cell membrane forward.
In epithelial cells that are in contact with their neighboring
cells via junctions, there is an apical ring of actin that acts
as the base for microvilli to protrude from.
Figure 2. Actin cytoskeleton in a cell.
Workshop 4: Cytoskeletal Fluorescent Imaging
The cytoskeleton of a cell is important in the
maintenance of cellular morphology, that is the way
they look, or the cell shape. There are many
different types of cells in the body that have distinct
shapes and their cytoskeletons maintain these
shapes. The cytoskeleton is also involved in cellular
motion; both the movement of the organelles inside
the cells, as well as the movement of cells
themselves. These activities are critically important
for all biological processes including cell division,
cell growth, signaling and communication. There
are three major components to the cytoskeleton: The
thin filaments, or actin filaments, the intermediate
filaments, and microtubules.
CSI@LSI
There are many different toxins or poisons that have the ability to disrupt actin filaments and this
results in loss of function in the cells. Today we are going to be imaging the actin cytoskeleton to
determine if the poison used in the murder was one that disrupts actin filaments, as well as
determine which suspects were exposed to the poison. In order to do this, we are going to be
using a special stain called phalloidin. Phalloidin is actually a specific toxin that binds directly to
actin. When this toxin is coupled with the fluorescent molecule rhodamine, we can use a laser to
cause the phalloidin to fluoresce red and view it using a fluorescent microscope. When the laser
beam hits the sample containing the fluorescent molecule, it causes that molecule to release
electrons that are seen as different colors of the visible light spectrum. By using a high
magnification microscope and a laser beam we are able to view the actin cytoskeleton.
Workshop 4: Cytoskeletal Fluorescent Imaging
Figure 3. Fluorescent light microscope diagram (left) and spectra of fluorophores (right).
CSI@LSI
Student Worksheet
What we will be doing today:
Task
1
Safety Orientation
2
3
Staining the actin cytoskeleton
Staining the nuclei of cells
4
Image fluorescent staining
5
Analyze the results
Description
Put on personal protective equipment (PPE) and
become oriented to the location of eyewash stations
and emergency shower
Use rhodamine phalloidin stain
Use DAPI nuclear stain
Use fluorescent microscope to view and take
pictures of stained cells
Determine which suspect were exposed to a poison
and fill out worksheet
Samples:
1. Positive control treated with Murderamine
2. Negative control treated with Murderamine
3. Victim skin sample
4. Suspect #1 skin sample
5. Suspect #2 skin sample
6. Suspect #3 skin sample
7. Suspect #4 skin sample
8. Suspect #5 skin sample
9. Suspect #6 skin sample
10. Suspect #7 skin sample
Workshop 4: Cytoskeletal Fluorescent Imaging
Experimental Set-up:
CSI@LSI
Detailed Staining Protocol
Actin Staining Protocol
Comments: Protocol for staining for F-actin
Supplies and Reagents
1X PBS
Phalloidin solution (1:250) in 1X PBS
DAPI solution (1:10000) in 1X PBS
DABCO mounting media
Glass slides
Forceps (tweezers)
100 uL per coverslip
1 mL per coverslip
10 uL per coverslip
1 for every 2 coverslips
Note: Once done with a solution on the parafilm, carefully wipe it away with a Kim wipe
to make more room and reduce chance of liquids merging.
5. Pipette 100 uL of DAPI onto the parafilm beside each coverslip. Again use the forceps
to carefully lift the coverslip, dab off excess PBS, and place cell side down in DAPI.
6. Remove slides from DAPI solution and rinse 2 times with 100 ul of 1X PBS per slide
(as in step 4).
7. Label the glass slides with the sample name and what was stained for.
8. Pipette 10uL drops of DABCO mounting media on the glass slide (1 drop per coverslip)
9. Using the forceps, pick up the coverslips and place them cell side down on the droplet
of DABCO. To ensure there are no bubbles, dab off excess PBS on a Kim wipe and then
first touch the edge of the coverslip in the DABCO and slowly lower onto the slide.
10. Allow to dry at room temperature for 5 minutes ** Keep protected from light **
Workshop 4: Cytoskeletal Fluorescent Imaging
Procedure (Fluorescent Staining for Actin and Nuclei)
Cells have been fixed using 4% paraformaldehyde solution, and rinsed twice with 1 X
PBS. Cells are plated on the surface of the coverslip only (side facing up). Remember to
keep track of which side the cells are on.
1. Ensure you have a coverslip for each suspect, as well as the victim and a positive and
negative control. Parafilm should be labelled so samples do not get confused.
2. Pipette 100 uL of Phalloidin solution per coverslip onto the parafilm. Make sure the
droplets are far enough apart so the coverslips won’t touch while staining.
*Remember – Phalloidin is a toxin. Be careful and make sure you are wearing gloves
before handling.
3. Using the forceps, place coverslips cell side down on the droplet of phalloidin solution.
Incubate at room temperature for 10 min.
4. Pipette 100 uL of 1 X PBS onto the parafilm beside each coverslip. Ensure this does not
merge with the Phalloidin. Carefully use the forceps to pick up the coverslips and dab off
excess Phalloidin on a Kim wipe. Place coverslips cell side down into the PBS to wash.
Incubate at room temperature for 5 min. Repeat this step for a total of 2 PBS washes.
CSI@LSI
Workshop 5: Tour of LSI Electron Microscopy Facility
Introduction
We want to examine the ultra-structure of the nuclear envelope of the victim’s cells to learn more
about the toxin used to poison her. We will do this using transmission electron microscopy.
Basic Principles
The nuclear envelope encloses the DNA and defines the nuclear compartment. This envelope
consists of two concentric membranes which are spanned by nuclear pore complexes (NPCs).
The NPCs are protein complexes that regulate bidirectional trafficking between the cytoplasm
and the nucleus. Because the DNA encodes the cell’s genetic information, it is crucial that the
nuclear envelope keep harmful substances out of the nucleus. However, molecules must also be
able to travel between the nucleus and cytoplasm. For example, mRNA synthesis occurs in the
nucleus, but mRNAs must then be transported to the cytoplasm in order to be translated into
proteins. Conversely, nuclear proteins are made in the cytoplasm, and must be transported to the
nucleus to perform their functions. This trafficking between the nucleus and cytoplasm is
mediated by the NPCs.
Some drugs can disrupt the nuclear envelope, causing it to vesiculate, and exposing the cellular
DNA to harmful substances in the cytosol.
Figure 1. The nuclear envelope. Compartments of the cell including the nucleus (left). The
arrangement of the nuclear pore in the nuclear envelope and a transmission electron micrograph
showing the nuclear envelope in cross section (right).
Workshop 5: Tour of UBC BioImaging Facility and Electron Microscopy
The Nuclear Envelope
CSI@LSI
Electron Microscopy
Resolution is the ability to distinguish between 2 points. The resolution of a light microscope is
limited by the wavelength of light to about 0.2 µm. Electrons moving at high velocity have a
shorter wavelength than light. Thus, electron microscopes, which use a beam of electrons to
visualize samples, have a resolution of about 0.2 nm – 1000X greater than that of a light
microscope.
Figure 2. The scanning electron microscope. Top left shows a SEM micrograph of pollen grains.
Workshop 5: Tour of UBC BioImaging Facility and Electron Microscopy
There are 2 main types of electron microscopes. To examine an object using a scanning electron
microscope (SEM), samples are coated in a thin layer of heavy metal. The samples are then
scanned with a beam of electrons, and the electrons that bounce off the surface of the object are
measured using a detector. SEM is used to generate a highly detailed 3-dimensional image of the
surface of a sample. Thus, SEM is usually used to study whole cells and tissues rather than
subcellular organelles.
CSI@LSI
Figure 3. Comparison between a light and transmission electron microscope.
Workshop 5: Tour of UBC BioImaging Facility and Electron Microscopy
In a transmission electron microscope (TEM), an electron beam is shone through a thinly
sliced sample. Samples are dehydrated, embedded in plastic, sectioned into slices ~50 nm thin,
and stained with electron-dense heavy metals. In the microscope, some of the electrons passing
through the specimen are scattered by structures stained with the electron-dense material; the
remainder are focused to form an image on a phosphorescent screen. Because the scattered
electrons are lost from the beam, the dense regions of the specimen show up in the image as
areas of reduced electron flux, which look dark. Because samples are sectioned, TEM is ideal for
studying subcellular organelles.
CSI@LSI
Workshop 6: Mass Spectrometry
Introduction
We know the type of compound that was used in the crime. To identify the specific compound, a
blood sample taken from the scene can be compared with test compounds that have similar
chemical properties. Using an instrument termed a mass spectrometer, the composition of a
sample can be determined by generating a mass spectrum representing the masses of each of the
sample components.
Basic Principles
Mobilizing Atoms
If atoms are first turned into an ion, they can then be deflected by magnetic fields. Electrically
charged particles are affected by a magnetic field although electrically neutral ones aren't. The
amount of deflection is based upon the mass and charge of the ion. By measuring the amount of
deflection, the mass of the ion can be determined. By comparing the mass of the ion to a
database, the identification of the original atom or compound can be made.
Column Chromatography
In chromatography, individual components in a mobile phase are retained by a stationary phase
differently and separate from each other while they run at different speeds through a column.
At the end of the column, the components elute one at a time. The eluent is collected as a series
of fractions, which can then be analyzed by mass spectrometry.
What are some components of blood that would have to be separated from proteins
before chromatography? What are major blood proteins that would have to be
removed?
Workshop 6: Mass Spectrometry
If samples to be analyzed are complex, or a particular substance of interest (the analyte) is in low
concentration compared to the whole sample, as is the case with a toxin in blood, it may be
necessary to clean-up the sample prior to mass spectrometry analysis. A number of methods are
available to purify individual components from a mixture, though chromatography is most
commonly used.
CSI@LSI
Stages of Mass Spectrometry
Ionization Production of ions from the sample. The atom is ionized either by knocking one or
more electrons off or by addition of one or more protons (H+) to give a positive ion. There are a
number
of
different
ionization
instruments,
including
Matrix-assisted
laser
desporption/ionization (MALDI), Electrospray, Electron, Chemical and Thermal Ionization.
Deflection Separation of ions with different masses. The ions are then deflected by a magnetic
field according to their masses. The lighter they are, the more they are deflected. The amount of
deflection also depends on the number of positive charges on the ion – in other words, on how
many electrons were knocked off in the first stage. The more the ion is charged, the more it gets
deflected. Different ions are deflected by the magnetic field by different amounts. The amount of
deflection depends on:
• the mass of the ion. Lighter ions are deflected more than heavier ones.
• the charge on the ion. Ions with 2 (or more) positive charges are deflected more than ones
with only 1 positive charge.
These two factors are combined into the mass/charge ratio. Mass/charge ratio is given the
symbol m/z. For example, if an ion had a mass of 28 and a charge of 1+, its mass/charge ratio
would be 28. An ion with a mass of 56 and a charge of 2+ would also have a mass/charge ratio of
28.
Detection Detection of the number of ions of each mass produced. The beam of ions passing
through the machine is detected electrically.
Analysis Collection of data to generate the mass spectrum
A: The Y axis is labeled relative
intensity. This is the intensity
relative to the tallest peak in the
spectrum with the tallest peak set
to 100%.
B: The X axis is mass divided by
charge, m/z. For example if the
mass of a molecule is 2000 units
and the molecule posses two
proton adducts its m/z value is
equal to(2000+2)/ 2, the m/z value
read on the spectrum is 1001.
Workshop 6: Mass Spectrometry
MS Spectrum
CSI@LSI
C: This is the tallest peak in the spectrum also known as the “base peak”
D: A spectrum will have a certain number of counts associated with the tallest peak in the
spectrum. One should be forewarned that the count number is relative and can be adjusted with
the multiplier gain and strictly speaking cannot be related to concentration without an internal
standard. Counts could also be affected by spray needle, matrix, concentration of analyte, and
over all mass spectrometer maintenance.
E: All of the peaks in a spectrum are just that, peaks and should not be referred to as ions.
Note: The uncharged peptide is not observed because the mass spectrometer cannot influence it
and thus it never reaches the detector.
Matrix-assisted laser desorption/ionization Time-of-Flight (MALDI-TOF)
In MALDI-TOF, the sample is combined with a matrix and then spotted onto a plate, usually
made of stainless steel. Once in the mass spectrometer, a high voltage nitrogen laser using UV
light is used to induce a charge in the sample. Ions pass through the deflection plates into the
flight tube to the detector. The mass of the sample is calculated based upon the amount of time
that it takes for an ion with a given charge to reach the detector (otherwise known as “Time of
Flight”).
In MALDI-TOF/TOF, a single ion (a precursor) can be fragmented at a collision cell into
smaller ions. The way in which the precursor fragments, combined with information on the
smaller masses, allows for identification of the amino acids that make up the initial precursor
peptide.
Workshop 6: Mass Spectrometry
Figure 1. Schematic overview of MALDI-TOF
CSI@LSI
High performance liquid Chromatography Electrospray Ionization (HPLC-ESI MS/MS)
Figure 2. Schematic overview of ESI-MS/MS
High Performance Liquid Chromatography (HPLC) is used to separate components of a mixture
by using chemical interactions between the analyte and the column. This may include differences
in hydrophobicity, ionic charge or size. HPLC can be performed separately from MS, or in the
case of ESI-MS/MS, HPLC can be coupled to the mass spectrometer such that samples run
directly from the HPLC to enter the mass spectrometer.
In electrospray ionization, the liquid is pushed through a very small, charged and usually metal,
capillary. This liquid containing the analyte, which exists as an ion, is dissolved in a large
amount of solvent, which is usually much more volatile than the analyte. The liquid pushes itself
out of the capillary and forms an aerosol, a mist of small droplets about 10 µm across. Lone ions
move to the mass analyzer. In this case, the mass analyzer is quadropole time-of-flight (QTOF)
which uses oscillating electrical fields to selectively stabilize or destabilize ions passing through
a radio frequencey field, acting as a mass selective filter.
Workshop 6: Mass Spectrometry
What role do each of the components of the α-cyano-4-hydroxycinnamic acid (CHCA)
matrix solution play in the MALDI-TOF?