J. gen. ViroL (1989), 70, 203-208. Printed in Great Britain
203
Key words: AcNP V/plO promoter/CA T expression
Analysis of the Promoter of the Autographa californica Nuclear
Polyhedrosis Virus pl0 Gene
By U L R I K E W E Y E R AND R O B E R T D. P O S S E E *
N E R C Institute of Virology, Mansfield Road, Oxford OX1 3SR, U.K.
(Accepted 21 September 1988)
SUMMARY
Functional analyses of the pl0 gene promoter from the Autographa californica
nuclear polyhedrosis virus (AcNPV) were performed by progressively deleting the 230
nucleotides upstream from the pl0 coding sequences towards the ATG codon.
Truncated promoter sequences retaining the full 5' non-coding leader of pl0 were
inserted in front of the chloramphenicol acetyltransferase (CAT) gene, and promoter
activity in transfected AcNPV-infected cells was measured using the transient CAT
expression assay. The removal of sequences to a position 101 nucleotides upstream
from the pl0 ATG did not affect the level of CAT expression. Deletion of a further 13
nucleotides reduced CAT expression by three- to fourfold, but the removal of three
more nucleotides, which deleted most of the baculovirus very late gene transcription
consensus sequence, almost completely abolished activity. The removal of the TATA
motif had no effect on the level of transient expression. We conclude that a sequence of
about 101 nucleotides upstream from the ATG codon of p l0 is sufficient for high level
promoter activity in this transient system.
Throughout the very late phase of infection of insect cells with the Autographa californica
nuclear polyhedrosis virus (AcNPV), two polypeptides, the 29K polyhedrin structural protein
and a 10K non-structural protein (pl0) are expressed at very high levels. Together, they
comprise the major proportion of the virus RNA and cell protein mass present in insect cells at
48 h post-infection (p.i.) (Smith et aL, 1982, 1983b; Rohel et al., 1983).
The polyhedrin protein is the major component of the matrix of the occlusion bodies
(polyhedra) (see Kelly, 1985; Vlak & Rohrmann, 1985). Polyhedrin is not essential for the
formation of infectious virus particles (Smith et al., 1983a); hence foreign genes can be inserted
in lieu of polyhedrin-coding sequences and expressed to high levels in infected cells (reviewed by
Luckow & Summers, 1988). The polyhedrin promoter has been shown to be present in a 69
nucleotide sequence extending upstream from the ATG translation start codon (Matsuura et al.,
1987; Possee & Howard, 1987). The 49 nucleotides between the ATG and mRNA start site
(Howard et al., 1986) are particularly important for efficient promoter activity (Matsuura et al.,
1987).
The sequence of the pl0 gene and its flanking regions have been determined, together with
the mRNA transcription initiation site (Kuzio et al., 1984; Lubbert & Doerfler, 1984; Liu et al.,
1986; Rankin et al., 1986); the function of the pl0 protein is not known. However, using
immunogold staining techniques van der Wilk et al. (1987) elegantly demonstrated that the p 10
protein was associated with fibrous structures in the nucleus and cytoplasm of the infected cell.
It had previously been assumed that these structures were precondensation forms of the
occlusion bodies (Summers & Arnott, 1969; MacKinnon et al., 1974; Chung et al., 1980; Tanada
& Hess, 1984). The fibrous bodies were missing in cells infected with an AcNPV recombinant
expressing a pl0-fl-galactosidase fusion gene, emphasising their involvement in pl0 function
(Vlak et al., 1988). Furthermore, this study also demonstrated the potential of the p 10 promoter
0000-8568 © 1989 SGM
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 05:13:09
204
Short communication
as a system for expressing foreign genes in baculovirus-infected cells. The p 10 promoter has yet
to be fully characterized.
In a recent study (Weyer & Possee, 1988) we described experiments to investigate the
sequence requirements for high level activity of the AcNPV pl0 promoter. Deletions were made
in the 5' non-translated leader, which progressively removed nucleotides upstream from the
A T G translation initiation codon; the effect on pl0 promoter activity was determined using a
transient expression assay based on the chloramphenicol acetyltransferase (CAT) gene in the
pSVO-CAT construct (Gorman et al., 1982). These plasmids were transfected into AcNPVinfected Spodopterafrugiperda cells and CAT activity was measured at 52 h p.i. Expression of
CAT decreased as the 5' non-coding sequences were progressively removed. The level of CAT
expression found with a construct containing only 1 0 ~ of the 5' leader sequence was at least 50fold lower than that obtained with a construct containing the complete sequence. The results
indicated that the entire 5' leader sequence of the pl0 gene is necessary for high levels of gene
expression from the pl0 promoter, as was demonstrated for the polyhedrin promoter (Matsuura
et al., 1987). Investigations have been continued to define the whole pl0 transcription unit, and
in this report we describe the requirement for sequences upstream from the m R N A start site for
promoter function using the CAT transient system to monitor promoter activity.
Very high CAT expression was obtained with the construct pAcpl0 + 1.CAT which
contained pl0 sequences extending 230 nucleotides upstream from the first A of the pl0 ATG
translation initiation codon (Weyer & Possee, 1988). Therefore, the construct pAcpl0 + 1,
containing identical pl0 sequences to those present in pAcpl0 + 1. CAT but inserted in a
pUC18 derivative, was used to produce deletions in the pl0 sequences upstream from the
m R N A start site by digesting with SmaI (in the pUC 18 polylinker) and then incubating with Bal
31 exonuclease at 37 °C (Fig. 1 a). Samples were taken at intervals of 15 s up to 2 min and the
reaction was terminated by phenol extraction. The extent of deletions was determined by
digesting aliquots of the D N A with BgllI (at position + 1), radiolabelling with [32p]dATP using
Escherichia coli D N A polymerase Klenow fragment, followed by P A G E with suitable size
markers. D N A fragments of the desired length were treated with S1 nuclease and calf intestinal
phosphatase, recircularized by ligation to BgllI linkers, and used to transform E. coli HB101
cells. Fragments containing truncated pl0 promoter sequences and the entire 5' leader were
isolated and inserted into a modified pSVO-CAT construct containing a Bg/II site at the 5' end
of the CAT gene (Weyer & Possee, 1988). The orientation of the promoter relative to the CAT
gene and the exact endpoint of each deletion were determined by sequencing the junction
between the pl0 promoter and the CAT gene using the dideoxy method (Sanger et al., 1977).
These constructs were designated pP10.63CAT to pP10. 135CAT, where the number refers to
the endpoint of deletion relative to the A T G of p 10; the nucleotide sequences are shown in Fig.
1 (b). This figure also shows the pl0 nucleotide sequence from - 2 3 0 to + 1 present in construct
pAcpl0 + 1. CAT, described in Weyer & Possee (1988); for consistency, in this present report
we refer to this construct as pP10.230CAT.
Transfection of these constructs into AcNPV-infected S. frugiperda cells and assays for
transient CAT activity were performed as described in Weyer & Possee (1988). In this recent
report the following control experiments were described in detail. It was shown that pl0
promoter activity could not be detected after transfection of plasmids into uninfected cells. The
optimal time point for transfection was found to be at 4 h p.i., whereas the levels of transient
CAT expression were lower if transfections were carried out earlier or later than this time. In the
CAT enzyme assays an incubation time of 45 min was used in the experiments described here. It
was shown by S1 nuclease analysis that transcription during the transient expression of CAT
initiated at the authentic p 10 m R N A start site normally used in AcNPV-infected cells (Kuzio et
al., 1984).
The results obtained from transfection experiments with the recombinant plasmids
pP10. CAT into AcNPV-infected ceils are shown in Fig. 2. Under the conditions used in this
experiment the CAT expression obtained with constructs containing pl0 promoter sequences
from position + 1 to - 7 2 or further upstream was very high; the conversion of 14C-labelled
chloramphenicol (CAM) to acetylated CAM was almost 100K. Therefore, deletion of pl0
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 05:13:09
Short communication
205
(a)
p 10 promoter
-230
-63
Sinai
'~'
Bal 31
L
+1
T
Bglll
(b)
-230
-220
-210
-200
-190
-180
-170
-160
-150
- c a g a t c t gTCGAGCAAGAAAATAAAACGCCAAACGCGTTGGAGTCTTGTGTGCTATTTTACAAAGATTCAGAAATACGCATCACTTACA AcNPV
-140
-130
-120
-II0
-I00
-90
-80
-70
0
ACAAGGGGGACT~TGAAATTATGCATTTGAGGATGCC~GGA~C~T
iTAATTCAACCCAACACA~GTT~ATAAGAAT
IAT
lAAcNPV
pPl0.135CAT
ppI.0.112CAT
pP10.108CAT
pPl0.101CAT
pP10.88CAT
pPI0.72CAT
pPIO.69CAT
cagatctgGAATTAITA pPI0.68CAT
caqatctgAl TA pP10.63CAT
c a9 at c t 9GAAATTATGCATTTGAGGATGCCGGGACCTTTAATTCAACCCAACACAA~rATATTAT~GTIA~ATAAGAATTAI TA
cag at c t qGGGACCTTTAATTCAACCCAACACA~TATATTA1]AGTTA~ATAAGAATTAITA
c a9 at CtgCC TTTAATTCAACCCAACACA~TATATTA1]AGTTA~ATAAGAATTA1 TA
c a g a t c t qTTCAACCCAACACA~TATATTAI~AGTTA~ATAAGAATTA1 TA
c a 9 a t c t gAAITATATTAllAGTTAIAATAAGAATTA1 TA
cagatctqATAAGAATIA1 TA
~AGAATTAITA
-50
-40
-30
-20
-10
÷1
TCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATCAca9atc t 9
CAT
Fig. l. (a) Construction of plasmids with deletions in the pl0 promoter sequences. The putative pl0
promoter ( - 230 to + 1 relative to the A nucleotide of the ATG translation start codon, thick line)
inserted in a pUC18 derivative (thin line) is shown (pAcpl0 + 1; Weyer & Possee, 1988). The thick
horizontal arrows show the direction of Bal 31 digestion starting from a SmaI site within the pUC18
polylinker. The thin arrow and T indicate the position of the transcription initiation site. (b) The
nucleotide sequences of deletions in the putative pl0 promoter are shown. The two upper lines and
bottom line show the normal sequence of AcNPV 230 nucleotides upstream from the pl0 coding region
which were present in pP 10.230CAT. The intervening lines show the extent of deletions made in the
promoter. Each deletion is flanked by BgllI linkers (lower case letters, underlined) which were used to
insert the fragment into the pSVO-CAT BgllI construct (Weyer & Possee, 1988). The TATA-Iike motif
and consensus sequence for transcription initiation (Rohrmann, 1986) are partially boxed. The
transcription start site is marked by an arrow and T. The thick horizontal line represents the coding
sequences for CAT.
upstream sequences to - 72 did not apparently affect expression of CAT. However, deletion of
only a further three nucleotides, to position - 6 9 , resulted in a drastic reduction of C A T
expression, by at least 40-fold. C A T expression obtained with constructs p P 1 0 . 6 8 C A T and
pP 10.63CAT was also very low and comparable to the level obtained with pP 1 0 . 6 9 C A T (Fig.
2; less than 5 ~ ) . The results o f four independent experiments were quantified and are shown as
mean values with their standard deviations in Table 1.
To assess minor differences in promoter activity between constructs generating very high
levels of C A T the amount of cell extract used in C A T assays was reduced by 200-fold. Fig. 3
shows that there was no significant difference in C A T expression obtained with p P l 0 . 8 8 C A T
c o m p a r e d to p P 1 0 . 7 2 C A T . However, the retention of a further 13 nucleotides up to position
- 1 0 1 resulted in an increase in C A T activity by approximately threefold. The presence of
sequences further upstream from - 101 did not significantly further enhance C A T expression. If
the amount of cell extract used for C A T assays was reduced by only 50-fold c o m p a r e d to the
conditions used for the experiments shown in Fig. 2 and Table 1, the constructs pP 1 0 . 7 2 C A T to
pP 10.230CAT still gave nearly 100 ~o conversion of C A M to acetylated forms (data not shown).
By combining the data for levels of C A T activity from Fig. 2 with Fig. 3, it can be estimated that
the removal of the p l 0 promoter sequences to a point 69 nucleotides upstream from the A T G
resulted in a decrease in promoter activity of at least 6000-fold; C A T activity was barely
detectable after this deletion had been made.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 05:13:09
Short communication
206
230
135
112
108
101
88
72
69
68
63
98.0
99.1
98-6
97-7
99.1
98-1
98.6
2.4
2.2
4.6
Fig. 2. Transient expression of CAT in AcNPV-infected S. frugiperda cells transfected with
pP10.CAT constructs (construct number indicated above each lane). The pP10.CAT constructs
described in Fig. 1 were used to transfect AcNPV-infected cells(3.5 x 106cells, 10 p.f.u./cell) at 4hp.i.
CAT activity in cell extracts was monitored at 52 h p.i. by incubation with 14C-labelled CAM and acetyl
coenzyme A; the products were separated by chromatography on silica gel plates and detected by
autoradiography. The percentage of total 14C-labelled CAM converted to acetylated forms (indicated
below each lane) was calculated by excising the spots from the silica plate and counting in liquid
scintillant. The positions of the different acetylated forms are shown on the right-hand side of the gel (1,
CAM; 2, 1-acetyl CAM; 3, 3-acetyl CAM; 4, 1,3-diacetyl CAM).
T a b l e 1. Transient expression of CA T from pPlO. CA T constructs in A cNPV-infected
S. f r u g i p e r d a cells
pP 10. CAT constructs*
r"
Acetyl CAM (~)t
s.D.:~
h
230
135
112
108
101
88
72
69
68
63
97.7
1-1
97.5
1-5
97-2
1-8
97.1
1-0
97.5
2-1
96.3
2.2
97.3
1.4
3.8
1.9
3.5
1.8
6.3
1.7
* The results from four independent transfection experiments are presented as mean values for each plasmid.
t The percentage of total 14C-labelled CAM converted into acetylated forms was quantified to show the value
for each deletion mutant (230 to 63).
:~S.D., Sample standard deviation (n - 1).
F r o m these e x p e r i m e n t s we conclude t h a t the p r e s e n c e o f the 63 n u c l e o t i d e 5' leader s e q u e n c e
and b e t w e e n seven and nine nucleotides u p s t r e a m o f the m R N A start site are sufficient for h i g h
level activity of the p l 0 p r o m o t e r in this transient expression system. A further m o d e r a t e
increase in activity (three- to fourfold) was d e t e c t e d if 101 or m o r e nucleotides u p s t r e a m f r o m
the A T G translation c o d o n were present. T h e T A T A - l i k e m o t i f did not h a v e a significant effect
on the level o f transient C A T expression.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 05:13:09
207
Short communication
230
135
101
72
88
•
69
i• •
•••~••:•• •i••i¸I••• • •••••
/••••••
••••••i • :•:•
••••
•
v
• /•
•
•
••
}•
•
,y, ,,,
, ,
,,
98.9
0.4
69.8
80-0
72.7
21.1
23.6
0-3
Fig. 3. CAT assays with reduced amounts of cell extracts from AcNPV-infected cells transfected with
pP10.CAT constructs (construct number indicated above each lane). AcNPV-infected cells were
transfected with DNA and extracts were prepared for CAT assays as described in Fig. 2, but using 200fold less extract in each reaction. For a control, the CAT activity present in AcNPV-infected cells
transfected with pSVO-CAT was determined (lane 2) and the assay components were tested using
commercial CAT enzyme (lane 1) instead of cell extract. The percentage of total 14C-labelled CAM
converted to acetylated forms is indicated below each lane, and the positions of the different forms are
shown on the right-hand side of the gel (1 to 4, as in Fig. 2).
These data are very similar to results obtained from analysis of the polyhedrin promoter using
recombinant viruses containing promoter deletions (Possee & Howard, 1987). A sequence of
between seven and 20 nucleotides upstream from the m R N A start site was found to be required
for efficient functioning of the polyhedrin promoter, and removal of the TATA-like motif did
not affect the level of gene expression. It is conceivable that these two strong late promoters are
controlled in a similar way since most of the promoter element appears to reside in the 5' leader
regions of the two genes.
The importance of the 12 nucleotide transcription initiation sequence is also emphasized by
this study. This sequence spans the m R N A start site of all the polyhedrin, granulin and p l 0
genes so far analysed (Rohrmann, 1986), and is also associated with the late transcription start
sites of p39 (Guarino & Summers, 1986) and p 6 . 9 (the arginine-rich polypeptide) (Wilson et al.,
1987). Deletion of only one A residue at the 5' end of this sequence and its replacement with a G
nucleotide (pP 10.72CAT) did not reduce the level of transient expression when compared with
p P 1 0 . 8 8 C A T , which contained an additional 16 nucleotides; however deletion of four
nucleotides at the 5' end of the consensus sequence (pP 10.69CAT) abolished C A T expression
almost completely. A similar result was obtained in the study on the polyhedrin promoter
(Possee & Howard, 1987), in which removing most of the consensus sequence abolished
transcription in a recombinant virus. Therefore, this consensus sequence appears to be the
central feature in the regulation of baculovirus very late gene expression. It will be interesting to
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 05:13:09
208
Short communication
investigate the protein cofactors associated with transcription
determine whether these are also similar.
from both promoters
and
Ulrike Weyer was the recipient of a Research Fellowship of the European Molecular Biology Organization.
REFERENCES
CHUNG, K. L., BROWN,M. & FAULKNER,P. (1980). Studies on the morphogenesis of polyhedral inclusion bodies of a
baculovirus Autographa catifornica NPV. Journal of General Virology 46, 335-347.
GORMAN, C. M., MOFFAT, L. F. & HOWARD, B. H. (1982). Recombinant genomes which express chloramphenicol
acetyltransferase in mammalian cells. Molecular and Cellular Biology 2, 1044-1051.
GUARXNO,L. A. & SUMMERS,M. D. (1986). Functional mapping o f a trans-activating gene required for expression of a
baculovirus delayed-early gene. Journal of Virology 57, 563-571.
HOWARD, S. C., AYRES, M. D. & POSSEE, R. D. (1986). Mapping the 5' and 3' ends ofAutographa californica nuclear
polyhedrosis virus polyhedrin m R N A . Virus Research 5, 109 119.
KELLY, D. C. (1985). The structure and physical characteristics of baculoviruses. In Viral Insecticidesfor Biological
Control, pp. 469-488. Edited by K. E. Sherman & K. Maramorosch. New York & London: Academic Press.
KUZIO, J., ROHEL, D. Z., CURRY, C. J., KREBS, A., CARSTENS, E. B. & FAULKNER, P. (1984). Nucleotide sequence of the
pl0 polypeptide gene of Autographa californica nuclear polyhedrosis virus. Virology 139, 414-418.
LIU, A., QIN, J., RANKIN, C., HARDIN, S. E. & WEAVER, R. F. (1986). Nucleotide sequence of a portion of the Autographa
caliJbrnicanuclear polyhedrosis virus genome containing the EcoRI site-rich region (hr5) and an open reading
frame just 5' of the pl0 gene. Journal of General Virology 67, 2565-2570.
LUBBERT, H. & DOERFLER, W. (1984). Transcription of overlapping sets of R N A s from the genome of Autographa
californica nuclear polyhedrosis virus: a novel method for mapping RNAs. Journal of Virology 52, 255-265.
LUCKOW, V. A. & SUMMERS, M. D. (1988). Trends in the development of baculovirus expression vectors.
Bio/Technology 6, 47-55.
MAcKINNON, E. A., HENDERSON, J. F., STOLTZ, D. B. & FAULKNER, P. (1974). Morphogenesis of nuclear polyhedrosis
virus under conditions of prolonged passage in vitro. Journal of Ultrastructure Research 49, 419-435.
MATSUURA, Y., POSSEE, R. D., OVERTON, H. A. & BISHOP, D. H. L. (1987). Baculovirus expression vectors: the
requirements for high level expression of proteins, including glycoproteins. Journal of General Virology 68,
1233-1250.
VOSSEE, R. D. & nOW~d~D, S. C. (1987). Analysis of the polyhedrin gene promoter of the Autographa californica
nuclear polyhedrosis virus. Nucleic Acids Research 15, 10233-10248.
RANKIN, C., LADIN, B. F. & WEAVER,R. F. (1986). Physical mapping of temporally regulated, overlapping transcripts
in the region of the 10K protein in Autographa californica nuclear polyhedrosis virus. Journal of Virology 57,
18-27.
ROHEL, D. Z., COCHRAN, M. A. & FAULKNER, P. (1983). Characterization of two abundant m R N A s of Autographa
californica nuclear polyhedrosis virus present late in infection. Virology 124, 357-365.
ROHRMANN, G. F. (1986). Polyhedrin structure. Journal of General Virology 67, 1499-1513.
SANGER,r., NICKLEN,S. & COULSON,A. R. (1977). D N A sequencing with chain-terminating inhibitors. Proceedings
of the National Academy of Sciences, U.S.A. 74, 5463-5467.
SMITH, G. E., VLAK,J. M. & SUMMERS,M. D. (1982). In vitro translation ofAutographa californicanuclear polyhedrosis
virus early and late mRNAs. Journal of Virology 44, 199 208.
SMITH, G. E., FRASER, M. J. & SUMMERS, M. D. (1983a). Molecular engineering of the Autographa californica nuclear
polyhedrosis virus genome: deletion mutations within the polyhedrin gene. Journal of Virology 46, 584-593.
sMrrH, G. E., VLAK,J. M. & SUMMERS,U. D. (1983b). Physical analysis ofAutographa californicanuclear polyhedrosis
virus transcripts for polyhedrin and 10,000-molecular-weight protein. Journal of Virology 45, 215-225.
SUMMERS,M. D. & ARNoTr, H. J. (1969). Ultrastructural studies on occlusion formation and virus occlusion in nuclear
polyhedrosis and granulosis-infected cells of Trichoplusia ni (Hfibner). Journal of Ultrastructure Research 28,
462-480.
TANADA,Y. & HESS,R. T. (1984). The cytopathology of baculovirus infection in insects. In Insect Ultrastructure,vol.
2, pp. 517-556. Edited by R. C. Kung & H. Arai. New York & London: Plenum Press.
VAN DER WlLK, F., VAI~LENT, J. W. M. & VLAK,J. M. (1987). Immunogold detection of polyhedrin, pl0 and virion
antigens in Autographa californica nuclear polyhedrosis virus-infected Spodopterafrugiperda cells. Journal of
General Virology 68, 2615-2623.
VLAK,J. M. & ROrmMANN,G. F. (1985). The nature of polyhedrin. In Viral Insecticidesfor Biological Control, pp. 489542. Edited by K. E. Sherman & K. Maramorosch. New York & London: Academic Press.
VLAK, J. M., KLINKENBERG, F. A., ZAAL, K. J. M., USMANY, M., KLINGE-ROODE, E. C., GEERVLIET, J. B. F., ROOSIEN, J. &
VAN LENT, J. W. M. (1988). Functional studies on the p10 gene of Autographa californica nuclear polyhedrosis
virus using a recombinant expressing a pl0-fl-galactosidase fusion gene. Journal of General Virology 69,
765-776.
WEYER, U. & POSSEE, R. D. (1988). Functional analysis of the p l 0 gene 5' leader sequence of the Autographa
calilbrnica nuclear polyhedrosis virus. Nucleic Acids Research 16, 3635-3653.
WILSON, M. E., MAINPRIZE, T. H., FRIESEN, P. D. & MILLER, L K. (1987). Location, transcription and sequence of a
baculovirus gene encoding a small arginine-rich polypeptide. Journal of Virology 61, 661-666.
(Received 15 July 1988)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 05:13:09