Gammaherpesvirus Latency Reservoirs Associated with Changes in

This information is current as
of June 17, 2017.
Perturbation of B Cell Activation in
SLAM-Associated Protein-Deficient Mice Is
Associated with Changes in
Gammaherpesvirus Latency Reservoirs
In-Jeong Kim, Claire E. Burkum, Tres Cookenham, Pamela
L. Schwartzberg, David L. Woodland and Marcia A.
Blackman
References
Subscription
Permissions
Email Alerts
Errata
This article cites 69 articles, 46 of which you can access for free at:
http://www.jimmunol.org/content/178/3/1692.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
An erratum has been published regarding this article. Please see next page
or:
/content/178/11/7487.1.full.pdf
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2007 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
J Immunol 2007; 178:1692-1701; ;
doi: 10.4049/jimmunol.178.3.1692
http://www.jimmunol.org/content/178/3/1692
The Journal of Immunology
Perturbation of B Cell Activation in SLAM-Associated
Protein-Deficient Mice Is Associated with Changes in
Gammaherpesvirus Latency Reservoirs1
In-Jeong Kim,* Claire E. Burkum,* Tres Cookenham,* Pamela L. Schwartzberg,†
David L. Woodland,* and Marcia A. Blackman2*
T
he oncogenic human gammaherpesviruses, EBV, and
Kaposi’s sarcoma-associated herpesvirus (KSHV)3 are
widely disseminated in the population. The initial infection is usually asymptomatic and is followed by the establishment
of lifelong latency. Malignancies are largely associated with latent
infection, so it is important to understand mechanisms involved in
the establishment and long-term maintenance of viral latency (1).
The murine gammaherpesvirus, gammaherpesvirus 68 (␥HV68)
or MHV68, is emerging as an important in vivo experimental
model for elucidating virus/host interactions involved in the
establishment and immune control of latency during a natural
infection (2, 3).
A major reservoir of both EBV and ␥HV68 latency is the B cell
(4 –9). Our recent studies have shown that ␥HV68 latency is established in lung B cells as early as 24 h after intranasal inoculation, concurrent with the lytic phase of infection (10). Whereas
lytic virus is effectively cleared from the lung by virus-specific
CD8 T cells by 12 days postinfection (dpi), latently infected cells
escape immune elimination and are disseminated to the spleen and
*Trudeau Institute, Saranac Lake, NY 12983; and †Genetic Disease Research Branch,
National Human Genome Research Institute, National Institutes of Health, Bethesda,
MD 20892
Received for publication July 21, 2006. Accepted for publication November 15, 2006.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by National Institutes of Health Grants AI51602 and
AI42927 (to M.A.B.), intramural funds from National Human Genome Research Institute, National Institutes of Health Grant (to P.L.S.), and by the Trudeau Institute.
2
Address correspondence and reprint requests to Dr. Marcia A. Blackman, Trudeau
Institute, 154 Algonquin Avenue, Saranac Lake, NY 12983. E-mail address:
[email protected]
3
Abbreviations used in this paper: KSHV, Kaposi’s sarcoma-associated herpesvirus;
dpi, days postinfection; ␥HV68, gammaherpesvirus 68; LDA/PCR, limiting dilutionnested PCR assay; PNA, peanut lectin (agglutinin); SAP, SLAM-associated protein;
SLAM, signaling lymphocyte activation molecule; NP, nucleoprotein.
www.jimmunol.org
elsewhere (11). Latency peaks in the spleen at 14 –15 dpi, corresponding with the peak of polyclonal B cell activation and germinal center formation. There is a subsequent rapid decline in numbers of latently infected spleen cells corresponding with the
presence of CD8 T cells specific for a latency epitope, followed by
stabilization at low, but persistent lifelong levels (12, 13).
Accumulating data support the hypothesis that EBV and ␥HV68
exploit the life cycle of the B cell to establish and maintain latency
(4 –9, 14). We have shown that ␥HV68 preferentially establishes
latency in activated germinal center B cells (15). This strategy
provides access to the long-lived memory B cell compartment,
resulting in a stable reservoir of lifelong latency. As has been
described for EBV, memory B cells are a preferential reservoir of
long-term ␥HV68 latency (6, 8, 16). Genetically manipulated
mouse strains with defects in B cell activation and memory B cell
development thus provide valuable models for studying ␥HV68
latency (7, 17).
In the current studies, we have taken advantage of SAP-deficient
mice to further characterize the relationship between the life cycle
of the B cell and the establishment and maintenance of ␥HV68
latency. SAP is an adaptor protein that binds to SLAM family
proteins. The gene encoding SAP is altered in patients with Xlinked lymphoproliferative (XLP) disease. Key manifestations of
X-linked lymphoproliferative are hypogammaglobulinemia and an
inability to control EBV, as well as other infections (18, 19). Thus,
there has been much emphasis on the molecular characterization of
the SAP defect. SAP-deficient mice have been generated independently by three groups (20 –22). It has been shown that SAP-mediated signaling is involved in several stages of immune cell activation and effector function (reviewed in Ref. 23). SAP-deficient
mice have defective Th2 cell development and abnormal Ig classswitching (20, 21, 24 –27). In addition, they generate reduced numbers of germinal centers and memory B cells (20, 21, 27–29),
which may be due both to impaired CD4 T cell function as well as
intrinsic B cell defects (27–30). SAP-deficient mice have also been
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Signaling lymphocyte activation molecule (SLAM)-associated protein (SAP)) interactions with SLAM family proteins play important roles in immune function. SAP-deficient mice have defective B cell function, including impairment of germinal center
formation, production of class-switched Ig, and development of memory B cells. B cells are the major reservoir of latency for both
EBV and the homologous murine gammaherpesvirus, gammaherpesvirus 68. There is a strong association between the B cell life
cycle and viral latency in that the virus preferentially establishes latency in activated germinal center B cells, which provides access
to memory B cells, a major reservoir of long-term latency. In the current studies, we have analyzed the establishment and
maintenance of ␥HV68 latency in wild-type and SAP-deficient mice. The results show that, despite SAP-associated defects in
germinal center and memory B cell formation, latency was established and maintained in memory B cells at comparable frequencies to wild-type mice, although the paucity of memory B cells translated into a 10-fold reduction in latent load. Furthermore,
there were defects in normal latency reservoirs within the germinal center cells and IgDⴙ“naive” B cells in SAP-deficient mice,
showing a profound effect of the SAP mutation on latency reservoirs. The Journal of Immunology, 2007, 178: 1692–1701.
The Journal of Immunology
1693
reported to develop enhanced Th1 responses characterized by excessive IFN-␥ production, and exaggerated CTL activity (20, 21,
29, 31, 32). As a consequence of the complex effects on signaling,
SAP-deficient mice have been shown to have perturbations in both
cellular and humoral immunity in response to a variety of infections (20, 21, 27, 29, 33).
The current studies focused on the impact of SAP-associated
defects in T and B cell function and development on the establishment and maintenance of gammaherpesvirus latency. The data
show both quantitative and qualitative perturbation in gammaherpesvirus latency reservoirs in ␥HV68-infected SAP-deficient mice
that are associated with effects of the SAP mutation on B cell
rather than T cell function. First, there is no defect in the ability of
the virus to establish latency in memory B cells, although the reduced numbers of memory B cells in SAP-deficient mice translate
into a reduced latent load. Second, two additional reservoirs of
latency in wild type mice, germinal center and IgD⫹“naive” B
cells, are absent in SAP-deficient mice.
Animal procedures and virus infection
␥HV68, clone WUMS (Washington University School of Medicine) (34),
was propagated and titered on NIH-3T3 fibroblasts (ATCC CRL1568).
C57BL/6J mice were purchased from The Jackson Laboratory. SAP-deficient mice were generated as previously described (21), and mice backcrossed six generations to C57BL/6 mice were bred at Trudeau Institute.
Mice were anesthetized with 2,2,2-tribromoethanol and intranasally infected with 30 ␮l of HBSS containing 400 PFU of ␥HV68. All infected
mice were housed under specific pathogen-free conditions in ABSL3 annual biosafety level 3 containment. The Institutional Animal Care and Use
Committee at the Trudeau Institute approved all studies described.
Viral assays
Plaque assay. Preformed, infectious virus was tittered by a standard
plaque assay on NIH-3T3 fibroblasts, as described previously (35, 36).
Infectious center assay. To determine the number of latently infected
cells capable of spontaneous in vitro reactivation, a modification of the
infective center assay was used, as described previously (35, 36). Duplicates of spleen cell samples at 15 dpi were plated in triplicate onto monolayers of NIH-3T3 cells in serial 10-fold dilutions in 12-well plates. One
replica was left intact to determine total infected cells, and one was disrupted by freeze-thawing to determine lytically infected cells (virus can
only reactivate from live cells). The monolayers were overlaid and the
plaques quantitated as for the plaque assay (35, 36). The number of latently
infected cells was calculated as the difference between total and lytically
infected cells.
Limiting dilution-nested PCR (LDA/PCR). The frequency of lung or
spleen cells containing the ␥HV68 genome was determined by a combination of LDA and PCR, using primers specific for ␥HV68 ORF50, as
described previously (17, 37). Twelve replicates were assessed for viral
genome on each cell dilution. Linear regression analysis was performed to
determine the frequency (95% degree of confidence) of cells positive for
the ␥HV68 genome. As controls of nested PCR, multiple wells of 104
NIH-3T3 cells with and without plasmid DNA containing the ␥HV68
ORF50 gene were included in each 96-well plate.
B cell staining and purification
Cells from lung and spleens were depleted of erythrocytes with buffered
ammonium chloride. For mice ⬎12 mo of age, whole lungs and spleens
were incubated with collagenase D (5 mg/ml) for 45 min to generate single-cell suspensions. To isolate B cells, cells were incubated with a mixture
of biotin-conjugated Abs against CD4, CD8, CD11b, CD11c, Gr1, DX5,
and TER119 and subsequently incubated with streptavidin-conjugated microbeads (Miltenyi Biotec). The cells were added to magnetic columns and
flow-through was collected as negatively enriched B cells. Cells were incubated with peanut lectin (agglutinin) (PNA)-FITC, CD95-PE, CD19-PE/
Cy5, and CD38-biotin, followed by streptavidin-allophycocyanin. Rat-antimouse IgG was used as control. Activated B cells, including germinal
center B cells, were separated by FACS as PNAhigh/CD19⫹ cells on day 15
after infection. For later time points, B cells were further stained with IgD
(11-26c.2a)-FITC, CD38-PE, biotin-conjugated sIgG, including IgG1
(A85-1), IgG2ab (R2-40), and IgG3 (R40-82), followed by streptavidin-
FIGURE 1. Impact of the SAP deficiency on early establishment of
viral latency. CD19⫹ lung or splenic B cells were enriched to a purity of
⬎97% and analyzed for viral latency at 5 dpi (lung, A), 10 dpi (spleen, B),
and 15 dpi (spleen, C and D). The data in A–C show the mean ⫾ SD of
LDA/PCR analysis (percentage of wells positive for viral DNA by PCR
plotted against numbers of cells analyzed) of four individual wild-type
mice (SAP⫹/⫹, open symbols) and SAP-deficient mice (SAP⫺/⫺, closed
symbols). From these data, the reciprocal frequency of CD19⫹ B cells
harboring viral genome in wild-type and SAP-deficient mice, respectively,
was determined: lung at 5 dpi was 379 ⫾ 264 and 323 ⫾ 124; spleen at 10
dpi was 1016 ⫾ 634 and 471 ⫾ 155; and spleen at 15 dpi was 288 ⫾ 163
and 6882 ⫾ 4051. The data in D show analysis of latently infected cells
using the in vitro reactivation assay. Latent virus can only reactivate from
live cells, and cells harboring latent virus were determined by subtracting
the cells harboring preformed lytic virus (freeze-thaw samples) from the
cells harboring total virus (duplicate untreated samples). Statistical analysis
revealed a significant reduction in numbers of latently infected cells in
SAP-deficient mice, determined both by LDA/PCR analysis shown in C
(Mann-Whitney U test) and the viral reactivation assay shown in D (Student’s t test).
allophycocyanin. Memory B cells were sorted as IgD⫺/sIgG⫹/CD38high
using a FACS Vantage SE/Diva sorter (BD Biosciences). Staining was
done in the presence of Fc block, and the sort was conducted using a
doublet discriminator to reduce the possibility that nonspecific cells were
being carried along in the sort. In addition to PNA-FITC and CD19-PE/
Cy5, PE-conjugated Abs against CD25, CD40, CD69, CD80, CD86, or
CD95 (Fas) were used to further characterize B cell activation status. Abs
were obtained from BD Pharmingen and eBioscience. Flow cytometry data
were analyzed using FlowJo software (Tree Star).
Assays for virus-specific T cells
In vivo CTL assay. Targets were prepared by loading spleen cells from
naive C57BL/6J mice with peptides specific for influenza virus nucleoprotein (NP)366–374, ␥HV68 ORF61524–531, and ␥HV68 ORF6487–495 and labeling with 2, 1, or 0.5 nM CFSE (Molecular Probes), respectively. Targets
were mixed and 2 ⫻ 107 cells were injected i.v. into individual wild-type
(SAP⫹/⫹) and SAP-deficient (SAP⫺/⫺) mice 10 or 14 dpi. Four hours later,
spleen cells were analyzed for intensity of CFSE staining. Percent-specific
killing was calculated as previously described (31), according to the following formula: percent-specific killing ⫽ (number of Flu NP-pulsed targets ⫻ A ⫺ number of ORF6- or ORF61-pulsed targets/number of Flu
NP-pulsed targets ⫻ A) ⫻ 100, where A ⫽ (number of ORF6- or ORF61pulsed targets/number of Flu NP-pulsed targets) in uninfected recipient
mice.
T cell staining. Virus-specific CD8 T cells were analyzed at 14 dpi using
allophycocyanin-conjugated tetrameric reagents obtained from the Trudeau
Institute Molecular Core Facility (ORF6487–495/Db or ORF61524–531/Kb) in
association with CD8-PerCp, as described previously (17).
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Materials and Methods
1694
VIRAL LATENCY IN SAP-DEFICIENT MICE
Table I. Effect of the SAP mutation on the establishment of ␥HV68 latency in B cellsa
CD19⫹ B Cellsb
Day 14
SAP⫹/⫹
SAP⫺/⫺
Days 27–42
SAP⫹/⫹
SAP⫺/⫺
PNAhigh B Cellsc
Reciprocal
frequency ⫾ SDd
No. of CD19⫹
cells (⫻10⫺6)
No. of virus genome⫹
cells (⫻10⫺4)e
Reciprocal
frequency ⫾ SDd
No. of PNAhigh
cells (⫻10⫺6)
No. of virus genome⫹
cells (⫻10⫺4)e
288 ⫾ 163
6881 ⫾ 4051
68.5 ⫾ 39.6
51.5 ⫾ 16.2
30.2 ⫾ 26.6
0.94 ⫾ 0.6
33 ⫾ 9.5
53 ⫾ 9.0
6.88 ⫾ 5
2.14 ⫾ 1.3
27.9 ⫾ 24.8
4.48 ⫾ 3.2
2686 ⫾ 2592
8141 ⫾ 7347
80.6 ⫾ 47.7
36.6 ⫾ 12.1
6.2 ⫾ 5.0
0.83 ⫾ 0.8
NDf
ND
ND
ND
ND
ND
Data shown are the mean ⫾ SD of three to four independent experiments, each analyzing pooled spleens from three to five mice.
CD19⫹ cells were sorted with 99% purity.
PNAhighCD19⫹ cells were sorted with ⬎99% purity.
d
Reciprocal frequency of virus genome-positive cells was determined by linear regression analysis of LDA/PCR.
e
Number of virus-infected cells was based on the frequency of viral genome-positive cells within each cell type, and the estimated total number of cells of each type per
spleen determined by cell counts and FACS analysis.
f
ND, Not determined. B cells do not maintain PNA binding this late after infection.
a
b
c
Statistical analyses
Student’s t test was used to determine significant differences in the percentage of immune cell populations, CTL activity, and IFN-␥ production,
and the Mann-Whitney U test was used for statistical analysis of frequencies of virus genome-positive cells.
Results
Peak levels of ␥HV68 latency in B cells are reduced in
SAP-deficient compared with wild-type mice
The key focus of these studies was to determine the impact of the
SAP mutation on viral latency in B cells following infection with
FIGURE 2. Cytotoxicity against
viral epitopes was comparable in
wild-type and SAP-deficient mice at
10 and 14 dpi. Cytotoxicity was assessed by an in vivo CTL assay.
Splenic B cells from naive C57BL/6
mice were loaded with peptides specific for Flu NP, ␥HV68 ORF61,
and ␥HV68 ORF 6 and respectively
labeled with 2, 1, or 0.5 nM CFSE
before being injected into uninfected C57BL/6 (naive control),
wild-type (SAP⫹/⫹), or SAP-deficient (SAP⫺/⫺) mice 10 or 14 dpi
with ␥HV68. Killing was calculated
4 h later, as described in Materials
and Methods. A, Representative data
from analysis of individual mice. B,
Compiled data (mean ⫾ SD) from
analysis of a minimum of three
individual mice in each of two
independent experiments. Statistical
analysis (Student’s t test) revealed
no differences in killing in wildtype and SAP-deficient mice.
␥HV68. Viral latency is first established in lung B cells as early as
24 h after the initial intranasal infection. Latently infected cells can
subsequently be detected in the spleen several days after infection,
attain peak levels at 14 –15 dpi, and then rapidly decline over the
next several weeks. Therefore, latency was assessed following
␥HV68 infection of SAP-deficient and wild-type (C57BL/6) mice
in lung B cells at 5 dpi, and in splenic B cells at 10 and 15 dpi,
using LDA/PCR to identify latently infected cells carrying viral
genome. Samples from 15 dpi were also assayed for latency by an
in vitro reactivation assay. The LDA/PCR showed that the frequency of latently infected cells in the lung and spleen was entirely
comparable between wild-type and SAP-deficient mice at 5 and 10
dpi (Fig. 1, A and B). As the total numbers of B cells in the lung
and spleen of SAP-deficient and wild-type mice was similar
at these time points (data not shown), there were comparable
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
ELISPOT assay for IFN-␥. IFN-␥ secretion by CD4 and CD8 T cells
was assessed in response to APCs pulsed with purified virus or virusspecific peptides (ORF6, ORF61, or gp15057–83), as described previously (17, 38, 39).
The Journal of Immunology
numbers of latently infected B cells in SAP-deficient and wild-type
mice. However, there was a striking decrease in the frequency of
latently infected splenic B cells in SAP-deficient compared with
wild-type mice at 15 dpi, the normal peak of splenic latency (Fig.
1C). Analysis of several independent experiments showed the reduced frequency of latency among B cells at this time point to be
consistent, averaging 24-fold (Table I). As the total numbers of B
cells in wild-type and SAP-deficient mice were also comparable at
this time point, the reduction in latency frequency translated into a
reduced latent load (Table I). This reduced latency in SAP-deficient compared with wild-type mice at 15 dpi as assessed by frequency of cells harboring viral genome was also reflected in latency as assessed by the in vitro reactivation assay (Fig. 1D).
Peak levels of latency at 15 dpi declined rapidly in wild-type
mice, as expected, with little decline in SAP-deficient mice, such
that by 27– 42 dpi the mean frequencies of latency among total B
cells in wild-type and SAP-deficient mice varied only 3-fold (Table I). Thus, there was a dramatic effect of the SAP mutation on B
cell latency at 14 –15 dpi, the normal peak of latency in the spleen,
but the differences compared with wild-type mice were minimal at
earlier and later time points.
Lack of an effect of the SAP mutation on numbers and function
of virus-specific CD8 T cells
The SAP mutation is associated with both T and B cell defects
(40). The normal peak of splenic ␥HV68 latency in C57BL6 mice
at days 14 –15 dpi correlates both with the maximal B cell germinal center response and also the maximal virus-specific CD8 T cell
response in the spleen (15, 41, 42). Thus, it is possible that the
FIGURE 4. Numbers of virus-specific IFN-␥-secreting T cells in the
spleen are comparable in wild-type and SAP-deficient mice. Virus-specific IFN-␥-secreting effector T cells in the spleen were quantitated by
ELISPOT assay at the indicated dpi. CD4 or CD8 T cells were enriched
and cocultured with APC pulsed with virus or peptides for 48 h. The
number of CD4 T cells per spleen producing IFN-␥ in response to
whole virus (A) or gp15057– 88/I-Ab (B) and CD8 T cells per spleen
producing IFN-␥ in response to ORF6487– 495/Db (C) or ORF61524 –531/Kb (D)
are shown. The percentage of CD4 or CD8 splenic T cells is shown in E and
F, respectively. Each bar graph indicates the mean of three individual mice ⫾
SD. Asterisks indicate significant differences between groups assessed by the
Student t test.
reduced latent load at 14 –15 dpi in SAP-deficient mice is a consequence of hyperactive effector T cell activity resulting in enhanced elimination of virally infected target cells, or is a consequence of reductions in the optimal germinal center reservoir for
the establishment of latency. It was recently suggested that reduced
latency in SAP-deficient mice correlated with increased numbers
of virus-specific CD8 T cells and hyperactive CTL activity (31).
FIGURE 5. Splenomegaly associated with ␥HV68 infection is unaffected by the SAP mutation. The data show numbers of spleen cells from
naive and infected wild-type (SAP⫹/⫹) and SAP-deficient (SAP⫺/⫺) mice
at 15 dpi (A), percentage of CD4, CD8, and B cells isolated from the
spleens of wild-type (SAP⫹/⫹) and SAP deficient (SAP⫺/⫺) at 15 dpi (B),
and percentage of CD4 and CD8 T cells from wild-type (SAP⫹/⫹) and
SAP-deficient (SAP⫺/⫺) expressing CD25 at 15 dpi (C). Data are the mean
(⫾SD) of four to five infected mice analyzed at each time point. Statistical
significance was determined by the Student t test.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 3. Comparable numbers of virus-specific CD8 T cells are generated following ␥HV68 infection of wild-type and SAP-deficient mice.
Spleen cells were analyzed by tetramer staining at 14 dpi for either for
allophycocyanin-conjugated ORF6487– 495/Db or ORF61524 –531/Kb and
CD8-PerCP. Representative flow cytometry analysis is shown in A. The
numbers in the gated area indicate the percent of virus-specific T cells
among the CD8 T cells. The mean percentage of virus-specific T cells ⫾
SD of five mice per group is shown in B. The mean absolute numbers of
virus-specific T cells ⫾ SD of five mice per group is shown in C. No
statistical difference was detected between wild-type and SAP-deficient
mice (Student’s t test).
1695
1696
VIRAL LATENCY IN SAP-DEFICIENT MICE
FIGURE 6. B cell activation after ␥HV68 infection
of wild-type and SAP-deficient mice. B cells were analyzed from wild-type and SAP-deficient mice at 15 dpi.
Representative FACS profiles for a series of phenotypic
markers within gated PNAhigh and PNAlow B cells from
wild-type (SAP⫹/⫹, dotted line) and SAP-deficient
(SAP⫺/⫺, solid line) mice are shown.
type, and development of germinal center cells in SAP-deficient
compared with wild-type mice following ␥HV68 infection.
First, we examined the effect of the SAP mutation on the splenomegaly and polyclonal B cell activation associated with ␥HV68
infection. Comparative analysis of numbers of splenocytes in naive
and infected SAP-deficient and wild-type mice (Fig. 5A) and the
distribution of CD4 T cells, CD8 T cells, and B cells within the
spleen at 15 dpi (Fig. 5B) showed no effect of the SAP mutation on
the characteristic splenomegaly associated with the establishment
of splenic latency. There was, however, a decrease in generalized
activation of CD4 cells and an increase in generalized activation of
CD8 T cells assessed by CD25 expression (Fig. 5C). In addition,
analysis of B cell phenotype at 15 dpi (Fig. 6) showed activation
among PNAhigh (activated) B cells to be entirely comparable in
␥HV68-infected SAP-deficient and wild-type mice, in that expression of cell surface molecules associated with B cell activation,
including CD40, CD80, CD86, and the MHC class II molecule,
I-Ab, was up-regulated to the same extent in SAP⫹/⫹ and SAP⫺/⫺
B cells. Up-regulation of early activation markers CD25 and CD69
in SAP⫹/⫹ and SAP⫺/⫺ B cells was also comparable.
␥HV68-induced polyclonal activation fails to bypass
SAP-associated defects in germinal center formation
and class-switched Ab production
Next, we determined whether reduced latency in SAP-deficient
mice correlated with SAP-associated B cell defects. B cell activation and function have been shown to be impaired in SAP-deficient
mice, manifest by reduced numbers of germinal centers and failure
to generate class-switched Abs and memory B cells following infection with a variety of pathogens (20 –22, 28, 29, 33). There is
evidence to suggest that both inherent B cell defects and defects in
CD4 T cells contribute to the impaired B cell function (27–30).
Infection with ␥HV68 induces a striking splenomegaly, due to
concordant increases in splenic B and T cells (44), and a strong
CD4-dependent polyclonal B cell response (45). Thus, it was important to determine whether viral infection was able to bypass the
characteristic SAP-associated B cell defects. To assess the impact
of the SAP mutation on B cell activation and function following
␥HV68 infection, we examined B cell numbers, activation pheno-
FIGURE 7. SAP-deficient mice fail to generate germinal center B cells
following ␥HV68 infection. Spleen cells from wild-type (SAP⫹/⫹) and
SAP-deficient (SAP⫺/⫺) mice were assessed for their ability to bind PNA
and stained with Abs against CD19, CD38, and CD95 on 15 dpi. Left
panels show representative FACS data, and the right panels show bar
graphs depicting the mean of four individual mice (⫾SD) in each group.
A, CD19⫹ B cells were analyzed for their activation status assessed by
up-regulation of PNA binding. The percentage of PNAhigh B cells from
wild-type and SAP-deficient mice is directly compared in the right panel.
B, CD38 and CD95 expression by cells in the PNAhigh B cell gate was
quantitated by FACS analysis. The percentage of CD38lowCD95high B cells
within the PNAhigh gate from wild-type and SAP-deficient mice is directly
compared in the right panel. The difference in the percentage of
CD38lowCD95high cells among PNAhigh B cells in SAP-deficient and wildtype mice was statistically significant, as determined by Student’s t test.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
To independently assess ␥HV68 T cell function in SAP-deficient
mice, we examined virus-specific CTL activity and IFN-␥ secretion and also assessed numbers of total and virus-specific T cells.
First, we measured CTL activity against two well-characterized
immunodominant lytic epitopes, ORF6 and ORF61, in an in vivo
CTL assay at both 10 and 14 dpi. Fig. 2A shows representative data
from individual wild-type and SAP-deficient mice, and Fig. 2B
shows mean values obtained from the analysis of multiple individual mice in two separate assays. The data show comparable
CTL activity in wild-type and SAP-deficient mice at both time
points, arguing against a role for enhanced CTL activity at 14 –15
dpi in mediating reduced viral latency.
Second, we assessed numbers of virus-specific cells, using tetrameric reagents for two lytic epitopes, ORF6 and ORF61. The
data in Fig. 3 show no statistically significant differences in numbers of tetramer-positive CD8 T cells in SAP-deficient compared
with wild-type mice at 14 dpi.
Finally, we assessed IFN-␥ secretion of virus-specific CD4 and
CD8 T cells at three time points after infection. Analysis of numbers of IFN-␥-secreting CD4 cells following in vitro restimulation
with whole virus (Fig. 4A) or an I-Ab epitope, gp15057– 83 (Fig. 4B)
(38, 43), and CD8 cells following in vitro restimulation with ORF6
(Fig. 4C) and ORF61 (Fig. 4D) epitopes, showed no statistically
significant differences in the response of SAP-deficient compared
with wild-type mice at any time point measured.
Despite the lack of an effect on the virus-specific T cell response, there were statistically significant differences in numbers
of total CD4 and CD8 T cells following ␥HV68 infection of SAPdeficient and wild-type mice. The analysis revealed a generalized
reduction in percentage of total CD4 T cells (Fig. 4E) and an
increase in percent of total CD8 T cells (Fig. 4F).
The Journal of Immunology
1697
FIGURE 8. Frequency of latency among splenic B cells at various times
postinfection. CD19⫹ B cells (circles) and class-switched sIgG⫹ B cells
(squares) sorted from wild-type (SAP⫹/⫹, open symbols) and SAP-deficient (SAP⫺/⫺, closed symbols) mice were analyzed for the frequency of
virus genome-positive cells at various dpi using LDA/PCR. Each symbol
represents analysis of a pool of four to eight mice. The data for 10 and 15
dpi are the same as shown in Fig. 1. The difference in latency between the
wild-type and SAP-deficient mice at day 15 was statistically significant, as
determined by the Mann-Whitney U test (p ⫽ 0.0286).
The frequency of viral latency in activated PNAhigh B cells is
comparable in SAP-deficient and wild-type mice despite reduced
numbers of germinal center B cells
The dramatic reduction in peak levels of latently infected B cells
in SAP-deficient mice (Table I and Fig. 1, C and D), which failed
Quantitative impact of the SAP mutation on long-term latency
in memory B cells
We next addressed the impact of the SAP mutation on cellular
reservoirs of long-term latency. Because of the paucity of germinal
center and memory B cells in SAP-deficient mice (29, 32, 48), both
of which are preferential reservoirs of long-term latency (6), we
anticipated that maintenance of long-term latency would be defective, as we had previously shown for CD40⫺/⫺ B cells within
CD40⫹/CD40⫺ chimeric mice (7). However, unexpectedly, the
frequencies of latency in CD19⫹ B cells from SAP-deficient and
wild-type mice between 90 and 210 dpi were remarkably comparable, with the SAP-deficient mice showing only modest reductions ranging between 1.4- and 4-fold (circles in Fig. 8). To identify SAP-associated effects on preferential long term reservoirs of
latency, we measured latency frequencies in class-switched splenic
B cells (containing both memory and germinal center subsets)
from mice between 90 and 210 dpi (squares in Fig. 8). The results
Table II. Number of cells in the spleen of ␥HV68-infected wild-type and SAP-deficient micea
Days Postinfection
Group
No. of Spleen Cells
(⫻10⫺6/spleen)
No. of B Cellsb
(⫻10⫺6/spleen)
No. of Memory B Cellsc
(⫻10⫺3/spleen)
90
SAP⫺/⫺
150
SAP⫺/⫺
210
SAP⫺/⫺
420d
SAP⫺/⫺
540d
SAP⫺/⫺
SAP⫹/⫹
44.4
SAP⫹/⫹
29.6
SAP⫹/⫹
6.21
SAP⫹/⫹
52.8 ⫾ 23.1e
SAP⫹/⫹
3.1
80.0
6.2
104.0
3.2
69.7
1.2
89.6 ⫾ 21.4e
26.1 ⫾ 9.9
58.8
9.9
10.5
4.6
23.2
13.3
8.2
1.2
37.7 ⫾ 8.9
NDf
20.1
18.2
49.4
371.0
41.8
NDf
147.0
a
Three to eight spleens were pooled and counted after red blood cell lysis. Total pooled spleen cells were divided by the
number of mice pooled to calculated number of cells per spleen. CD19⫹ B cells and memory B cells were analyzed and
calculated based on percentage of positive cells by FACS analysis. A representative experiment at each time point is shown.
b
CD19⫹ cells were gated, and number of CD19⫹ B cells was calculated based on the frequency of CD19⫹ cells by FACS
analysis within the total spleen cells number.
c
Memory B cells are isotype-switched sIgG⫹CD38high cells.
d
Spleen cells were dissociated with collagenase D to improve cell yield.
e
Data shown are the mean ⫹ SD of five individual mice per group.
f
ND, Not done.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Next, we examined the ability of SAP-deficient mice to generate
germinal center B cells following ␥HV68 infection. Germinal center B cells characteristically bind high levels of PNA, down-regulate CD38 expression, and up-regulate CD95 (Fas) expression
(46, 47). Phenotypic analysis at 15 dpi show that the percentage of
PNAhigh B cells was generally reduced, but not statistically significantly different in SAP-deficient and wild-type mice (Fig. 7).
However, there was a 10-fold reduction in the subset of PNAhigh
B cells that expressed a germinal center phenotype (CD95 (Fas)⫹
and CD38low) in SAP-deficient mice (Fig. 7B).
Thus, polyclonal B cell activation associated with ␥HV68 infection was intact in SAP-deficient mice, as indicated by generalized expansion of B cell numbers and by B cell activation phenotype within PNAhigh B cells. However, viral infection failed to
bypass the well-characterized defect in the ability of SAP-deficient
mice to develop germinal center cells. In addition, we confirmed
the previous observation of others (22, 28) that Ig class switching
fails to occur following ␥HV68 infection (data not shown).
to correlate with significant enhancement of virus-specific T cell
numbers or effector function (Figs. 2– 4) raised the possibility that
SAP-associated effects on B cell activation caused a deficiency in
the normal reservoir for the establishment of latency. We have
previously shown that B cell latency is established preferentially in
activated germinal center B cells (15). However, full maturation to
germinal center cells is apparently not required, as we have also
previously reported that latency can be efficiently established in
PNAhigh activated B cells from CD28-deficient mice, which, like
SAP-deficient mice, have a deficiency in germinal center development (17). To determine whether the activated B cells in SAPdeficient mice provided an adequate reservoir for the establishment
of latency, we analyzed latency frequencies in highly purified populations of PNAhigh B cells from SAP-deficient and wild-type mice
at 14 –15 dpi. In contrast to the ⬃24-fold reduction in latency
frequency among total CD19⫹ B cells from SAP-deficient compared with wild-type mice, the latency frequencies were comparable (within 2-fold) among the subset of highly activated, PNAhigh B
cells analyzed at the same time point (Table I). Thus, latency
was established efficiently within the subset of activated cells, with
little effect of the SAP mutation on frequencies of peak levels of
latency and only a modest (⬃6-fold) reduction in numbers of latently infected cells in SAP-deficient compared with wild-type
mice (Table I), which is consistent with the general reduction in
PNAhigh cells in SAP-deficient mice (Fig. 7A).
1698
VIRAL LATENCY IN SAP-DEFICIENT MICE
showed comparable frequencies of latency in class-switched B
cells from both SAP-deficient and wild type mice that varied less
than 2-fold. In addition, in both strains of mice, the latency frequency in class-switched B cells was ⬃100-fold higher than in
total (CD19⫹) B cells, confirming the class-switched B cells as a
preferential latency reservoir.
Absolute numbers of CD19⫹ splenic B cells in SAP-deficient
mice were variable, largely due to variation in spleen size and
cellularity in SAP-deficient mice (Table II). Initially, it appeared
that numbers in SAP deficient were progressively declining with
the age of the mouse and/or time after infection. However, when
more care was taken to dissociate spleen cells with collagenase D
to maximize recovery, the large differences in cell numbers between SAP-deficient and wild-type mice noted at 150 and 210 dpi
were reduced, and at 420 and 540 dpi, absolute numbers of B cells
between SAP-deficient and wild-type mice were within 2-fold. Despite relatively comparable numbers of CD19⫹ B cells and consistent with the previously characterized deficit in memory B cells
in SAP-deficient mice, the reduction in memory B cell numbers in
SAP-deficient compared with wild-type mice at various times following ␥HV68 infection ranged between ⬃10- and 35-fold. In
summary, the frequencies of latency from 90 to 210 dpi were re-
Qualititative impact of the SAP mutation on long-term latency
reservoirs
Another important reservoir of long-term latency is germinal center B cells (6). Unfortunately, we were unable to accurately assess
latency in the germinal center cells at late times after infection
because there were insufficient germinal center B cells (classswitched surface Ig⫹, CD38low) from SAP-deficient mice to sort
(Fig. 7). Thus, due to paucity of germinal center cells, this reservoir of latency is deficient in SAP-deficient mice.
A third reservoir of long-term latency is IgD⫹ naive B cells (6).
Although IgD⫹ B cells express a low frequency of latency, because
they are the most abundant B cell subset in the spleen, they constitute
an important reservoir of latently infected cells (6). Unexpectedly,
although we were able to sort sufficient numbers of IgD⫹ B cells from
both strains of mice, the frequency of latency in naive B cells was
Table III. Maintenance of ␥HV68 latency in B cell subsetsa
Memory B Cellsb
Day 150
SAP⫹/⫹
SAP⫺/⫺
Day 210
SAP⫹/⫹
SAP⫺/⫺
a
Germinal Center Cellsc
Naive B Cellsd
Reciprocal frequencye
No. of virus
genome⫹ cellsf
Reciprocal frequencye
No. of virus
genome⫹ cellsf
Reciprocal frequencye
No. of virus
genome⫹ cellsf
355 (175–593)
399 (101–504)
850
30
239 (141–1,963)
No cellsh
261
0
1.3 ⫻ 105 (10,915- ⬃)g
No virusi
146
0
1,481 (474–2,517)
1,002 (491–1,787)
83
7
188 (113–280)
No cellsh
110
0
1.9 ⫻ 105 (46,624- ⬃)f
No virusi
81
0
Cells were sorted from three to seven pooled spleens per group. Data shown are from representative experiments at each time point.
Memory B cells were sorted as isotype-switched (IgG1, IgG2a ⫹ 2b, IgG3)⫹CD38high, with 98.9% purity for wild-type mice and 87.6% purity for SAP-deficient mice.
Germinal center B cells were sorted as isotype-switched (IgG1, IgG2a ⫹ 2b, IgG3)⫹CD38low, with 99% purity.
d
Naive B cells were sorted as IgD⫹sIg⫺ with ⬎99% purity.
e
Frequency of virus genome-positive cells (⫾95% confidence limits) was determined by linear regression analysis of LDA/PCR data.
f
Number of virus genome cells was based on the frequency of virus genome† cells and the calculated total number of each cell type per spleen.
g
The upper confidence interval is out of range.
h
No cells of this phenotype could be sorted from the spleen of SAP-deficient mice.
i
No genome-positive cells were detected in a total of 2 ⫻ 106 cells examined by LDA/PCR at the highest dilution of cells (50,000).
b
c
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 9. Flow cytometry analysis and sorting of spleen cells from wildtype and SAP-deficient mice 7 mo postinfection. Spleen cells from wild-type
(SAP⫹/⫹) and SAP-deficient (SAP⫺/⫺) mice obtained 7 mo postinfection were
enriched for B cells, and gated CD19⫹ B cells were sorted on the basis of
CD38, IgD, and a mixture of class-switched Igs (IgG1⫹IgG2a/b⫹IgG3). A,
Presort analysis of CD19⫹ B cells, IgD⫹sIgG⫺, and IgD⫺sIgG⫹ B cells. B,
Postsort analysis of isotype switched (IgD⫺sIgG⫹) germinal center (CD38low)
and memory (CD38high) B cells from wild-type mice and memory (CD38high)
B cells from SAP-deficient mice.
markably comparable among both total B cells and class-switched
B cells (Fig. 8), but the long-term latent load was reduced in SAPdeficient mice because of the reduction in numbers of memory B
cells (Table II), a preferential reservoir of long-term latency.
The data in Fig. 8 show analysis of long-term latency in total
CD19⫹ B cells and IgG class-switched B cells. Class-switched B
cells consist of memory and germinal center cells, both of which
are preferential long-term reservoirs of ␥HV68 latency (6). To
more precisely define the reservoir of long-term latency in SAPdeficient mice, we further sorted splenic B cells from mice at 150
and 210 dpi into class-switched CD38high (memory phenotype),
class-switched CD38low (germinal center phenotype), and IgD⫹
(mostly naive phenotype) subsets, as reported previously (6, 46,
47, 49) (Fig. 9). It can be seen that, although the frequency of
class-switched B cells was 10-fold lower in SAP-deficient mice
compared with wild-type mice (Fig. 9A), we were able to sort a
highly enriched population of class-switched CD38 high (memory)
B cells from SAP-deficient mice (Fig. 9B). The frequencies of latency among class-switched, CD38high (memory phenotype) B cells
from SAP-deficient and wild-type mice were entirely comparable (1/
355 compared with 1/399, and 1/1481 compared with 1/1002 for
wild-type and SAP-deficient mice, respectively), at 5 and 7 mo postinfection (Table III). However, the absolute numbers of memory phenotype B cells were reduced 10- to 30-fold in SAP-deficient compared with wild-type mice (Table II). Thus, despite comparable
frequencies, absolute numbers of latently infected memory B cells
were severely impacted by the SAP deficiency (Table III).
The Journal of Immunology
below the level of detection in SAP-deficient mice, whereas this subset made a substantial contribution to the latent reservoir in wild type
mice (Table III). Thus, unexpectedly, this reservoir of long-term latency is also deficient in SAP-deficient mice.
Taken together, there are both quantitative and qualitative changes
in long-term ␥HV68 latency reservoirs in SAP-deficient mice. Despite defects in germinal center and memory B cell formation in SAPdeficient mice, the virus is able to access the memory B cell reservoir
and establish latency in memory B cells with comparable frequency to
wild-type mice, although the reduced numbers of memory B cells in
SAP-deficient mice translate into a significantly reduced long-term
latent load. In addition, SAP-deficient mice lack two other important
reservoirs of long-term latency, germinal center and IgD⫹ B cells,
reflecting both a qualitative impact on latency reservoirs and also
quantitative effects as a consequence of further reduction in the overall
long-term latent load.
Discussion
highly activated B cells was efficient and sufficient to allow viral access to and establishment of latency in the memory B cell pool (Table
III). This reflects a quantitative, but not qualitative, impact of SAP on
the establishment of latency in memory B cells.
Although hyperactive CTL activity has been proposed as an
explanation for reduced latency in ␥HV68-infected SAP-deficient
mice in an independent study (31), our data are more consistent
with a SAP-mediated effect on B cells. First, we were unable to
reproduce data from Chen et al. (31), showing elevated numbers,
increased IFN-␥ secretion, and enhanced cytolytic activity of CD8
T cells specific for two lytic viral epitopes (Figs. 2– 4). There was,
however, an increased overall activation status of CD8⫹ T cells
from SAP-deficient mice compared with wild-type mice (Fig. 5C).
Although we cannot explain the discrepancy in the experimental
results, it is difficult to assess precisely the biological significance
of the statistical difference in quantitative CTL activity reported
previously (31). It is not clear that the less than 2-fold differences in
the levels of cytolysis of cells expressing a particular epitope have
physiological relevance in terms of viral control and the establishment
of latency. In addition, ␥HV68-specific CTL activity is complex in
that we and others (41, 54, 55) have shown that peak levels of CD8
T cells specific for ORF6 and ORF61 vary differentially during the
infection, corresponding to kinetic differences in levels of expression
of the two lytic epitopes, and presentation of the epitopes by different
cell types. Our observation that latency in total B cells at 5 and 10 dpi
is unaffected by the SAP mutation, but is dramatically reduced in
SAP-deficient mice at 15 dpi (Fig. 1), does not correlate with these
previously described kinetic differences in epitope-specific CTL activity or viral epitope expression.
One puzzling aspect of the data is the selective deficiency in
peak latency levels among total (CD19⫹) B cells in SAP-deficient
mice, despite comparable levels among activated PNAhigh B cells
at the same time point (Table I). This could be explained by either
SAP-associated B cell or CD8 T cell defects and remains unresolved by our current studies. On the one hand, it is possible that
a particular stage of B cell development strongly affected by the
SAP mutation provides an important, as yet unidentified, early
reservoir for latency. In contrast, it is possible that an early stage
of latency is uniquely susceptible to enhanced CTL killing in SAPdeficient mice. As discussed above, our in vivo CTL data did not
show evidence for generalized enhancement of CTL activity in the
spleens of SAP-deficient mice (Fig. 2). However, it is possible that
there is differential expression of virus-specific T cell epitopes on
cells in early and peak stages of latency, leading to differential
susceptibility to CTL control. This would be consistent with the
proposal that there are distinct forms of latency in the spleen associated with differential viral gene expression at specific time
points after infection (12, 13, 16, 56, 57). Unfortunately, this possibility cannot currently be experimentally addressed because lytic
and latent T cell epitopes expressed by different subsets of B cells
during the establishment of latency have not been defined.
Analysis of long-term latency in SAP-deficient mice gave unexpected results. Our initial hypothesis was that SAP-deficient
mice would be compromised in their long-term maintenance of
latency, because of the well-characterized SAP-associated defect
in the development of memory B cells, a major reservoir of longterm latency (6, 8). Surprisingly, we found that long-term latency
frequencies among class-switched B cells were remarkably comparable between wild-type and SAP-deficient mice as late as 210
dpi, although the numbers of latently infected cells was consistently 10- to 20-fold lower in SAP-deficient mice (Table III), due
to reduced numbers of memory B cells (Table II). Thus, latency
frequencies are maintained in memory B cells in SAP-deficient mice,
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
In this study, we have kinetically analyzed the establishment and
maintenance of ␥HV68 latency in B cell reservoirs of SAP-deficient and wild-type mice. We have defined both quantitative (reduced latent load) and qualitative (altered reservoirs of latency)
effects of the SAP mutation on long-term latency. First, there are
reduced numbers of latently infected memory B cells in SAP-deficient mice and, second, two substantial reservoirs of long-term
latency in wild-type mice, germinal center and IgD⫹ naive B cells,
are not detected in SAP-deficient mice. We have interpreted the
data in light of our current understanding of the association between the virus and the B cell. It has been proposed that the virus
exploits the life cycle of the B cell by establishing latency preferentially in highly activated germinal center B cells, allowing efficient entry into the pool of memory B cells (5, 14, 50 –52). Because they are long-lived and are maintained homeostatically by
cellular mechanisms (53), memory B cells potentially can provide
a stable reservoir of latency without an absolute requirement for
viral reactivation and re-infection.
Early latency frequencies in CD19⫹ B cells in the lung (5 dpi)
and spleen (10 dpi) were remarkably unaffected by the SAP mutation. In striking contrast, at the peak of latency at 14 –15 dpi,
there was a greater than 20-fold decrease in the frequency of latently infected CD19⫹ B cells in SAP-deficient compared with
wild-type mice (Fig. 1). Despite this, analysis of latency at the same
time within the subset of activated PNAhigh B cells showed only a
2-fold decrease in latency frequency (Table I). This was not explained
by the ability to bypass the SAP-associated defect in B cell activation
as a consequence of virus-induced polyclonal B cell activation, as
␥HV68-infected SAP-deficient mice developed only 10% of the number of germinal center B cells induced in wild-type mice (Fig. 7),
which is consistent with the previous histological (29) and phenotypic
(32) analysis of lymphocytic choriomeningitis virus-infected SAPdeficient mice. However, despite the defect in germinal center cell
development, B cells in SAP-deficient mice expanded (Fig. 5) and
become activated (Fig. 6) sufficiently to provide an adequate reservoir
for the establishment of latency. Although germinal center cells are
the preferential reservoir for the establishment of latency in wild-type
mice (15), they are apparently not an absolute requirement, and latency can be efficiently established in highly activated B cells. For
example, we previously showed that latency was efficiently established in CD28-deficient mice, which are defective in the ability to
form germinal centers (15, 17). In addition, in mixed bone marrow
chimeric mice, latency was established comparably in CD40⫹ and
CD40⫺ B cells, despite the inability of CD40⫺ B cells to localize into
germinal centers (7). Thus, despite the reduced numbers of germinal
center B cells in SAP-deficient mice, the establishment of latency in
1699
1700
that the virus exploits the life cycle of the B cell, in that latency is
preferentially established in highly activated, germinal center B cells,
allowing the virus to gain access to the long-lived memory B cell
compartment.
In conclusion, despite quantitative effects of the SAP mutation
on memory B cells, the virus was able to access the population of
activated B cells and effectively establish and maintain latency in
the memory B cell pool in SAP-deficient mice. Two additional key
findings of the current study—that SAP-deficient mice are deficient in two understudied reservoirs of long-term virus latency,
germinal center, and naive IgD⫹ B cells—support the possibility
that latently infected memory B cells can be induced to reactivate
virus, resulting in reinfection of naive B cells. The current analysis
of ␥HV68 latency in SAP-deficient mice thus makes fundamental
contributions to our understanding of mechanisms involved in
maintaining long-term gammaherpesvirus latency.
Acknowledgments
We thank Drs. Fran Lund, Troy Randall, and Larry Johnson for helpful
discussions and Simon Monard and Branden Sells for FACS sorting.
Disclosures
The authors have no financial conflict of interest.
References
1. Rickinson, A. B., and E. Kieff. 2001. Epstein-Barr Virus. In Fields Virology.
P. M. Howley and D. M. Knipe, ed. Lippincott Williams and Wilkins, Philadelphia, pp. 2575–2627.
2. Blackman, M. A., and E. Flaño. 2002. Persistent gammaherpesvirus infections:
what can we learn from an experimental mouse model? J. Exp. Med. 195:
F29 –F32.
3. Stevenson, P. G., and S. Efstathiou. 2005. Immune mechanisms in murine gammaherpesvirus-68 infection. Viral Immunol. 18: 445– 456.
4. Thorley-Lawson, D. A., and G. J. Babcock. 1999. A model for persistent infection with Epstein-Barr virus: the stealth virus of human B cells. Life Sci. 65:
1433–1453.
5. Rickinson, A. B., and P. J. L. Lane. 2000. Epstein-Barr virus: co-opting B cell
memory and migration. Curr. Biol. 10: R120 –R123.
6. Flaño, E., I. J. Kim, D. L. Woodland, and M. A. Blackman. 2002. ␥-Herpesvirus
latency is preferentially maintained in splenic germinal center and memory B
cells. J. Exp. Med. 196: 1363–1372.
7. Kim, I. J., E. Flaño, D. L. Woodland, F. E. Lund, T. D. Randall, and M. A.
Blackman. 2003. Maintenance of long term gammaherpesvirus B cell latency is
dependent on CD40-mediated development of memory B cells. J. Immunol. 171:
886 – 892.
8. Willer, D. O., and S. H. Speck. 2003. Long-term latent murine gammaherpesvirus
68 infection is preferentially found within the surface immunoglobulin D-negative subset of splenic B cells in vivo. J. Virol. 77: 8310 – 8321.
9. Sunil-Chandra, N. P., S. Efstathiou, and A. A. Nash. 1992. Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo. J. Gen.
Virol. 73: 3275–3279.
10. Flaño, E., Q. Jia, J. Moore, D. L. Woodland, R. Sun, and M. A. Blackman. 2005.
Early establishment of ␥-herpesvirus latency: implications for immune control.
J. Immunol. 174: 4972– 4978.
11. Stewart, J. P., E. J. Usherwood, A. Ross, H. Dyson, and T. Nash. 1998. Lung
epithelial cells are a major site of murine gammaherpesvirus persistence. J. Exp.
Med. 187: 1941–1951.
12. Husain, S. M., E. J. Usherwood, H. Dyson, C. Coleclough, M. A. Coppola,
D. L. Woodland, M. A. Blackman, J. P. Stewart, and J. T. Sample. 1999. Murine
gammaherpesvirus M2 gene is latency-associated and its protein a target for
CD8⫹ T lymphocytes. Proc. Natl. Acad. Sci. USA 96: 7508 –7513.
13. Usherwood, E. J., D. J. Roy, K. Ward, S. L. Surman, B. M. Dutia, M. A.
Blackman, J. P. Stewart, and D. L. Woodland. 2000. Control of gammaherpesvirus latency by latent antigen-specific CD8⫹ T cells. J. Exp. Med. 192: 943–952.
14. Thorley-Lawson, D. A., E. M. Miyashita, and G. Khan. 1996. Epstein-Barr virus
and the B cell: that’s all it takes. Trends Microbiol. 4: 204 –208.
15. Flaño, E., S. M. Husain, J. T. Sample, D. L. Woodland, and M. A. Blackman.
2000. Latent murine gamma-herpesvirus infection is established in activated B
cells, dendritic cells, and macrophages. J. Immunol. 165: 1074 –1081.
16. Marques, S., S. Efstathiou, K. G. Smith, M. Haury, and J. P. Simas. 2003. Selective gene expression of latent murine gammaherpesvirus 68 in B lymphocytes.
J. Virol. 77: 7308 –7318.
17. Kim, I. J., E. Flaño, D. L. Woodland, and M. A. Blackman. 2002. Antibodymediated control of persistent gammaherpesvirus infection. J. Immunol. 168:
3958 –3964.
18. Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van Schaik,
L. Notarangelo, R. Geha, M. G. Roncarolo, et al. 1998. The X-linked lymphoproliferative-disease gene product SAP regulates signals induced through the
co-receptor SLAM. Nature 395: 462– 469.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
indicating preservation of this important reservoir of latency, but there
are quantitative effects due to reduced numbers of memory B cells.
Detailed analysis of long-term latency in other B cell subsets,
however, revealed qualitative effects of the SAP mutation on latency reservoirs (Table III). First, the germinal center latency reservoir was deficient due to the paucity of germinal center cells in
SAP-deficient mice. Second, despite adequate numbers of IgD⫹ B
cells, latent virus was below the limits of detection in this population in SAP-deficient mice. Taken together with reduced numbers of latently infected memory B cells in SAP-deficient mice,
these differences translate into a 25- to 50-fold reduction in total
numbers of latently infected B cells in SAP-deficient mice between
5 and 7 mo postinfection. The significance of long-term latency in
germinal center and IgD⫹ naive B cells is unknown, but the data
are consistent with the possibility that viral reactivation and reinfection make an important contribution to maintenance of longterm latency.
The role of viral reactivation and reinfection in the maintenance
of gammaherpesvirus latency is unknown. Whereas it is well-established that EBV reactivation occurs at low levels in the tonsil
and is essential for viral transmission, the significance of this for
maintenance of long-term viral latency is unclear (1). The role of
reactivation and reinfection in the maintenance of ␥HV68 latency has
only been studied in B cell-deficient mice and is poorly understood
(58, 59). Recently, however, an essential role for lytic viral replication
for the maintenance of KSHV latency was demonstrated (60). It is
clear that this important issue merits further investigation.
The identification of germinal center and IgD⫹ naive B cells as
additional long-term reservoirs of latency (6) support the possibility that activation of memory B cells, through cognate Ag or nonspecific mechanisms, leads to the generation of plasma cells via
secondary germinal center reactions and consequent viral reactivation. In support of this, differentiation into plasma cells has been
associated with reactivation of EBV (61, 62). We propose that
viral reactivation results in de novo infection of a subset of IgD⫹
naive B cells, providing a mechanism for maintaining the longterm viral reservoir in wild-type mice. This possibility is supported
by the observation that EBV infection of naive tonsillar B cells
correlated with active viral replication in the tonsils (63). We hypothesize that memory B cell triggering fails to occur in SAPdeficient mice because of SAP-associated defects in B cell activation, resulting in the absence of virally infected naive B cells. The
absence of viral genome in B cells with a naive phenotype in
SAP-deficient mice was an unexpected result that may lead to
important insight into mechanisms for the maintenance of longterm gammaherpesvirus latency. Further studies to test the significance of this reservoir for long-term latency maintenance in wildtype mice are in progress.
Although much can be learned from the experimental mouse
model about gammaherpesvirus latency in general, it is important
to bear in mind that each of the gammaherpesviruses has coevolved intimately and uniquely with its host. Sequence analysis of
the EBV, KSHV, and ␥HV68 genomes reveals large colinear gene
blocks, but the genes controlling latency and transformation lie
outside of these regions of homology and are virus-specific (34). In
many cases, however, the viruses exploit the same basic strategies
via different mechanisms. For example, both ␥HV68 and EBV induce B cell activation, but they do it in different ways. EBV accomplishes this directly through the expression of several viral genes,
including latent membrane protein 1, LMP2a, and EBV-encoded nuclear Ag 2 (64 – 68), whereas ␥HV68-driven B cell activation appears
to rely on normal Ag and CD4 T cell signaling mechanisms (7, 45, 69,
70). However, despite using a different mechanism for B cell activation, ␥HV68 latency fits the original model proposed for EBV (14)
VIRAL LATENCY IN SAP-DEFICIENT MICE
The Journal of Immunology
43. Liu, L., E. J. Usherwood, M. A. Blackman, and D. L. Woodland. 1999. T cell
vaccination alters the course of murine herpesvirus 68 infection and the establishment of viral latency in mice. J. Virol. 73: 9849 –9857.
44. Tripp, R. A., A. M. Hamilton-Easton, R. D. Cardin, P. Nguyen, F. G. Behm,
D. L. Woodland, P. C. Doherty, and M. A. Blackman. 1997. Pathogenesis of an
infectious mononucleosis-like disease induced by a murine gammaherpesvirus:
role for a viral superantigen? J. Exp. Med. 185: 1641–1650.
45. Stevenson, P. G., and P. C. Doherty. 1999. Non-antigen-specific B-cell activation
following murine gammaherpesvirus infection is CD4 independent in vitro but
CD4 dependent in vivo. J. Virol. 73: 1075–1079.
46. Oliver, A. M., F. Martin, and J. F. Kearney. 1997. Mouse CD38 is down-regulated on germinal center B cells and mature plasma cells. J. Immunol. 158:
1108 –1115.
47. Takahashi, Y., H. Ohta, and T. Takemori. 2001. Fas is required for clonal selection in germinal centers and the subsequent establishment of the memory B cell
repertoire. Immunity 14: 181–192.
48. Malbran, A., L. Belmonte, B. Ruibal-Ares, P. Bare, I. Massud, C. Parodi,
M. Felippo, R. Hodinka, K. Haines, K. E. Nichols, and M. M. de Bracco. 2004.
Loss of circulating CD27⫹ memory B cells and CCR4⫹ T cells occurring in
association with elevated EBV loads in XLP patients surviving primary EBV
infection. Blood 103: 1625–1631.
49. Ridderstad, A., and D. M. Tarlinton. 1998. Kinetics of establishing the memory
B cell population as revealed by CD38 expression. J. Immunol. 160: 4688 – 4695.
50. Babcock, G. J., L. L. Decker, M. Volk, and D. A. Thorley-Lawson. 1998. EBV
persistence in memory B cells in vivo. Immunity 9: 395– 404.
51. Thorley-Lawson, D. A. 2001. Epstein-Barr virus: exploiting the immune system.
Nat. Rev. Immunol. 1: 75– 82.
52. Joseph, A. M., G. J. Babcock, and D. A. Thorley-Lawson. 2000. EBV persistence
involves strict selection of latently infected B cells. J. Immunol. 165: 2975–2981.
53. Bernasconi, N. L., E. Traggiai, and A. Lanzavecchia. 2002. Maintenance of serological memory by polyclonal activation of human memory B cells. Science
298: 2199 –2202.
54. Liu, L., E. Flaño, E. J. Usherwood, S. Surman, M. A. Blackman, and D. L.
Woodland. 1999. Lytic cycle T cell epitopes are expressed in two distinct phases
during MHV-68 infection. J. Immunol. 163: 868 – 874.
55. Woodland, D. L., E. J. Usherwood, L. Liu, E. Flaño, I. J. Kim, and M. A.
Blackman. 2001. Vaccination against murine ␥-herpesvirus infection. Viral Immunol. 14: 217–226.
56. Tibbetts, S. A., J. S. McClellan, S. Gangappa, S. H. Speck, and H. W. Virgin.
2003. Effective vaccination against long-term gammaherpesvirus latency. J. Virol. 77: 2522–2529.
57. Usherwood, E. J., K. A. Ward, M. A. Blackman, J. P. Stewart, and D. L.
Woodland. 2001. Latent antigen vaccination in a model gammaherpesvirus infection. J. Virol. 75: 8283– 8288.
58. van Dyk, L. F., H. W. Virgin, and S. H. Speck. 2003. Maintenance of gammaherpesvirus latency requires viral cyclin in the absence of B lymphocytes. J. Virol. 77: 5118 –5126.
59. Gangappa, S., S. B. Kapadia, S. H. Speck, and H. W. Virgin. 2002. Antibody to
a lytic cycle viral protein decreases gammaherpesvirus latency in B cell-deficient
mice. J. Virol. 76: 11460 –11468.
60. Grundhoff, A., and D. Ganem. 2004. Inefficient establishment of KSHV latency
suggests an additional role for continued lytic replication in Kaposi sarcoma
pathogenesis. J. Clin. Invest. 113: 124 –136.
61. Crawford, D. H., and I. Ando. 1986. EB virus induction is associated with B cell
maturation. Immunology 59: 405– 409.
62. Laichalk, L. L., and D. A. Thorley-Lawson. 2005. Terminal differentiation into
plasma cells initiates the replicative cycle of Epstein-Barr virus in vivo. J. Virol.
79: 1296 –1307.
63. Joseph, A. M., G. J. Babcock, and D. A. Thorley-Lawson. 2000. Cells expressing
the Epstein-Barr virus growth program are present in and restricted to the naive
B cell subset of healthy tonsils. J. Virol. 74: 9964 –9971.
64. Uchida, J., T. Yasui, Y. Takaoka-Shichijo, M. Muraoka, W. Kulwichit, N. RaabTraub, and H. Kikutani. 1999. Mimicry of CD40 signals by Epstein-Barr virus
LMP1 in B lymphocyte responses. Science 286: 300 –303.
65. Eliopoulos, A. G., and A. B. Rickinson. 1998. Epstein-Barr virus: LMP1 masquerades as an active receptor. Curr. Biol. 8: R196 –R198.
66. Caldwell, R. G., J. B. Wilson, S. J. Anderson, and R. Longnecker. 1998. EpsteinBarr virus LMP2A drives B cell development and survival in the absence of
normal B cell receptor signals. Immunity 9: 405– 411.
67. Ling, P. D., J. J. Hsieh, I. K. Ruf, D. R. Rawlins, and S. D. Hayward. 1994.
EBNA-2 upregulation of Epstein-Barr virus latency promoters and the cellular
CD23 promoter utilizes a common targeting intermediate, CBF1. J. Virol. 68:
5375–5383.
68. Hofelmayr, H., L. J. Strobl, G. Marschall, G. W. Bornkamm, and U. ZimberStrobl. 2001. Activated Notch1 can transiently substitute for EBNA2 in the maintenance of proliferation of LMP1-expressing immortalized B cells. J. Virol. 75:
2033–2040.
69. Flaño, E., D. L. Woodland, and M. A. Blackman. 1999. Requirement for CD4⫹
T cells in V␤4⫹CD8⫹ T cell activation associated with latent murine gammaherpesvirus infection. J. Immunol. 163: 3403–3408.
70. Brooks, J. W., A. M. Hamilton-Easton, J. P. Christensen, R. D. Cardin, C. L.
Hardy, and P. C. Doherty. 1999. Requirement for CD40 ligand, CD4⫹ T cells,
and B cells in an infectious mononucleosis-like syndrome. J. Virol. 73:
9650 –9654.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
19. Coffey, A. J., R. A. Brooksbank, O. Brandau, T. Oohashi, G. R. Howell, J. M.
Bye, A. P. Cahn, J. Durham, P. Heath, P. Wray, et al. 1998. Host response to EBV
infection in X-linked lymphoproliferative disease results from mutations in an
SH2-domain encoding gene. Nat. Genet. 20: 129 –135.
20. Wu, C., K. B. Nguyen, G. C. Pien, N. Wang, C. Gullo, D. Howie, M. R. Sosa,
M. J. Edwards, P. Borrow, A. R. Satoskar, et al. 2001. SAP controls T cell
responses to virus and terminal differentiation of Th2 cells. Nat. Immunol. 2:
410 – 414.
21. Czar, M. J., E. N. Kersh, L. A. Mijares, G. Lanier, J. Lewis, G. Yap, A. Chen,
A. Sher, C. S. Duckett, R. Ahmed, and P. L. Schwartzberg. 2001. Altered lymphocyte responses and cytokine production in mice deficient in the X-linked
lymphoproliferative disease gene SH2D1A/DSHP/SAP. Proc. Natl. Acad. Sci.
USA 98: 7449 –7454.
22. Yin, L., U. Al-Alem, J. Liang, W. M. Tong, C. Li, M. Badiali, J. J. Medard,
J. Sumegi, Z. Q. Wang, and G. Romeo. 2003. Mice deficient in the X-linked
lymphoproliferative disease gene sap exhibit increased susceptibility to murine
gammaherpesvirus-68 and hypogammaglobulinemia. J Med Virol. 71: 446 – 455.
23. Veillette, A. 2006. Immune regulation by SLAM family receptors and SAPrelated adaptors. Nat. Rev. Immunol. 6: 56 – 66.
24. Davidson, D., X. Shi, S. Zhang, H. Wang, M. Nemer, N. Ono, S. Ohno, Y.
Yanagi, and A. Veillette. 2004. Genetic evidence linking SAP, the X-linked lymphoproliferative gene product, to Src-related kinase FynT in Th2 cytokine regulation. Immunity 21: 707–717.
25. Cannons, J. L., L. J. Yu, B. Hill, L. A. Mijares, D. Dombroski, K. E. Nichols,
A. Antonellis, G. A. Koretzky, K. Gardner, and P. L. Schwartzberg. 2004. SAP
regulates Th2 differentiation and PKC-␪-mediated activation of NF-␬B1. Immunity 21: 693–706.
26. Hron, J. D., L. Caplan, A. J. Gerth, P. L. Schwartzberg, and S. L. Peng. 2004.
SH2D1A regulates T-dependent humoral autoimmunity. J. Exp. Med. 200:
261–266.
27. Cannons, J. L., L. J. Yu, D. Jankovic, S. Crotty, R. Horai, M. Kirby, S. Anderson,
A. W. Cheever, A. Sher, and P. L. Schwartzberg. 2006. SAP regulates T cellmediated help for humoral immunity by a mechanism distinct from cytokine
regulation. J. Exp. Med. 203: 1551–1565.
28. Morra, M., R. A. Barrington, A. C. Abadia-Molina, S. Okamoto, A. Julien,
C. Gullo, A. Kalsy, M. J. Edwards, G. Chen, R. Spolski, et al. 2005. Defective B
cell responses in the absence of SH2D1A. Proc. Natl. Acad. Sci. USA 102:
4819 – 4823.
29. Crotty, S., E. N. Kersh, J. Cannons, P. L. Schwartzberg, and R. Ahmed. 2003.
SAP is required for generating long-term humoral immunity. Nature 421:
282–287.
30. Al-Alem, U., C. Li, N. Forey, F. Relouzat, M. C. Fondaneche, S. V. Tavtigian,
Z. Q. Wang, S. Latour, and L. Yin. 2005. Impaired Ig class switch in mice
deficient for the X-linked lymphoproliferative disease gene Sap. Blood 106:
2069 –2075.
31. Chen, G., A. K. Tai, M. Lin, F. Chang, C. Terhorst, and B. T. Huber. 2005.
Signaling lymphocyte activation molecule-associated protein is a negative regulator of the CD8 T cell response in mice. J. Immunol. 175: 2212–2218.
32. Crotty, S., M. M. McCausland, R. D. Aubert, E. J. Wherry, and R. Ahmed. 2006.
Hypogammaglobulinemia and exacerbated CD8 T cell mediated immunopathology in SAP-deficient mice with chronic LCMV infection mimics human XLP
disease. Blood 108: 3085–3093.
33. Sayos, J., K. B. Nguyen, C. Wu, S. E. Stepp, D. Howie, J. D. Schatzle, V. Kumar,
C. A. Biron, and C. Terhorst. 2000. Potential pathways for regulation of NK and
T cell responses: differential X-linked lymphoproliferative syndrome gene product SAP interactions with SLAM and 2B4. Int. Immunol. 12: 1749 –1757.
34. Virgin, H. W., P. Latreille, P. Wamsley, K. Hallsworth, K. E. Weck, A. J.
Dal Canto, and S. H. Speck. 1997. Complete sequence and genomic analysis of
murine gammaherpesvirus 68. J. Virol. 71: 5894 –5904.
35. Cardin, R. D., J. W. Brooks, S. R. Sarawar, and P. C. Doherty. 1996. Progressive
loss of CD8⫹ T cell-mediated control of a gammaherpesvirus in the absence of
CD4⫹ T cells. J. Exp. Med. 184: 863– 871.
36. Flaño, E., I. J. Kim, J. Moore, D. L. Woodland, and M. A. Blackman. 2003.
Differential gammaherpesvirus distribution in distinct anatomical locations and
cell subsets during persistent infection in mice. J. Immunol. 170: 3828 –3834.
37. Weck, K. E., S. S. Kim, H. W. Virgin, and S. H. Speck. 1999. B cells regulate
murine gammaherpesvirus 68 latency. J. Virol. 73: 4651– 4661.
38. Christensen, J. P., and P. C. Doherty. 1999. Quantitative analysis of the acute and
long-term CD4⫹ T cell response to a persistent gammaherpesvirus. J. Virol. 73:
4279 – 4283.
39. Flaño, E., D. L. Woodland, M. A. Blackman, and P. C. Doherty. 2001. Analysis
of virus-specific CD4⫹ T cells during long-term gammaherpesvirus infection.
J. Virol. 75: 7744 –7748.
40. Nichols, K. E., C. S. Ma, J. L. Cannons, P. L. Schwartzberg, and S. G. Tangye.
2005. Molecular and cellular pathogenesis of X-linked lymphoproliferative disease. Immunol. Rev. 203: 180 –199.
41. Stevenson, P. G., G. T. Belz, J. D. Altman, and P. C. Doherty. 1999. Changing
patterns of dominance in the CD8⫹ T cell response during acute and persistent
murine gammaherpesvirus infection. Eur. J. Immunol. 29: 1059 –1067.
42. Obar, J. J., S. G. Crist, D. C. Gondek, and E. J. Usherwood. 2004. Different
functional capacities of latent and lytic antigen-specific CD8 T cells in murine
gammaherpesvirus infection. J. Immunol. 172: 1213–1219.
1701
The Journal of Immunology
CORRECTIONS
Pier, G. B., D. Boyer, M. Preston, F. T. Coleman, N. Llosa, S. Mueschenborn-Koglin, C. Theilacker, H. Goldenberg, J.
Uchin, G. P. Priebe, M. Grout, M. Posner, and L. Cavacini. 2004. Human mAbs to Pseudomonas aeruginosa alginate that
protect against infection by both mucoid and nonmucoid strains. J. Immunol. 173: 5671–5678.
In Results, in the third sentence of the first paragraph under the heading Characteristics of the initial hybridomas and
their variable region genes, the first, third, and fourth GenBank accession numbers are incorrect. The corrected sentence
is shown below.
Analysis of the nucleotide and amino acid sequences indicated that clones F428 and F429 contained the same H chain
V region but different L chain V region, whereas clone F431 had a distinct H chain V region but shared the L chain V
region of clone F428 (GenBank accession numbers: AY626661, IGLV-J of mAbs F428 and F431; AY626662, IGLV-J of
mAb F429; AY626664, IGHV-D-J of mAbs F428 and F429; and AY626663, IGHV-D-J of mAb F431).
Brown, H. J., H. R. Lock, S. H. Sacks, and M. G. Robson. 2006. TLR2 stimulation of intrinsic renal cells in the induction
of immune-mediated glomerulonephritis. J. Immunol. 177: 1925–1931.
Sentence seven of the Abstract is incorrect. The corrected sentence is shown below.
Nephrotoxic Ab and TLR2 ligation caused a neutrophil influx in both types of chimera above that seen in the sham
chimeras totally TLR2 deficient.
In Fig. 3, the statistics presented represent p values from t tests performed on data that should have been transformed,
as stated in Materials and Methods. In addition, p values were not given for several comparisons that are relevant. The
figure below shows new p values on transformed data. The revised p values do not change the message of the paper, since
the same comparisons are still significant when performed on the transformed data. The corrected figure and legend are
shown below.
FIGURE 3. A, Glomerular neutrophil influx at 2 h. B, Albuminuria in 24 h following i.v. Pam3CysSK4 and
NTS in chimeric and sham chimeric animals. The graphs show results from all statistical analyses.
www.jimmunol.org
7486
CORRECTIONS
Collins, J. T., J. Shi, B. E. Burrell, D. K. Bishop, and W. A. Dunnick. 2006. Induced expression of murine ␥ 2a by CD40
ligation independently of IFN-␥. J. Immunol. 177: 5414 –5419.
As a part of other studies, the authors found that the I␥2a primer used to amplify I␥2aC␮ products in one panel of Fig.
4 was contaminated with a C␥2a primer. Therefore, the products designated as “I␥2aC␮” in the second from the top panel
of Fig. 4 are actually I␥2aC␥2a germline transcripts. The authors have prepared new I␥2a and new C␮ primers and redone
the RT-PCR for I␥2aC␮ transcripts. As this required new cDNA, the authors also repeated the RT-PCR for hypoxanthine
phosphoribosyltransferase (HPRT) of the same samples.
The original version of the second from the top panel of Fig. 4 is incorrect in that only one authentic RT-PCR product
is detected for I␥2aC␮ RNA (see revised Fig. 4); the original Fig. 4 showed the two products that the authors now know
derive from the two splice variants of ␥2a germline transcripts (Ref. 43 in original article). As expected, revised Fig. 4
demonstrates that the expression of authentic I␥2aC␮ RNA (a postswitch RNA) lags behind that of germline transcripts;
the expression of CD40L-induced I␥2aC␮ transcripts cannot be detected at day 2 of induction and does not peak until day
3 (or even later, not tested). Nevertheless, the major point of this figure remains correct. CD40 ligation of B cells results
in switch recombination to ␥2a. Postswitch I␥2aC␮ transcripts do not pre-exist in the B cell population (they cannot be
detected at 5 h or 1 day of culture), but ␥2a postswitch transcripts do appear at day 3, after germline transcription. This
correction does not alter any major conclusion of the publication. The corrected figure and legend are shown below.
FIGURE 4. T-depleted splenic lymphocytes from IFN-␥⫺/⫺ mice
were cultured in LPS, CD40L, or LPS plus IFN-␥ for 5 h, 1 d, 2 d, or
3 d. Transcripts, as indicated on the left side of the figure, were detected
in RNA from these cells by RT-PCR with incorporation of 32P-dATP.
The primers for amplification (35 cycles) of I␥2aC␮ were GCTGATGTACCTACCTGAGAG (I␥2a) and CCAGGTGAAGGAAATGGAGC (C␮), and annealing was at 67°C. Other aspects of the RT-PCR
reaction, including HPRT amplification, were as described (28). Other
RT-PCR products, none of which was the correct size, were inconsistently amplified in the I␥2aC␮ reaction. To verify that the designated
294-bp fragment is indeed an authentic I␥2aC␮ product, we cloned and
sequenced it from RNA of both C57BL/6 and BALB/c cells cultured in
CD40L plus IFN-␥. DNA sequence verified that the 294-bp product is
the authentic I␥2aC␮ product with 169 bp of I␥2a sequence joined to
125 bp of C␮ product, using the expected splice site (43).
The Journal of Immunology
7487
Kim, I.-J., C. E. Burkum, T. Cookenham, P. L. Schwartzberg, D. L. Woodland, and M. A. Blackman. 2007. Perturbation
of B cell activation in SLAM-associated protein-deficient mice is associated with changes in gammaherpesvirus latency
reservoirs. J. Immunol. 178: 1692–1701.
In Table II, the SAP⫺/⫺ rows were shifted to the left. The corrected Table is shown below.
Table II. Number of cells in the spleen of ␥HV68-infected wild-type and SAP-deficient micea
Days
Postinfection
90
150
210
420d
540d
Group
No. of Spleen Cells
(⫻10⫺6/spleen)
No. of B Cellsb
(⫻10⫺6/spleen)
No. of Memory B Cells
(⫻10⫺3/spleen)
SAP⫹/⫹
SAP⫺/⫺
SAP⫹/⫹
SAP⫺/⫺
SAP⫹/⫹
SAP⫺/⫺
SAP⫹/⫹
SAP⫺/⫺
SAP⫹/⫹
SAP⫺/⫺
80.0
44.4
104.0
29.6
69.7
6.21
89.6 ⫾ 34.1e
52.8 ⫾ 23.1e
58.8
3.1
10.5
6.2
23.2
3.2
8.2
1.2
37.7 ⫾ 8.9
26.1 ⫾ 9.9
20.1
9.9
49.4
4.6
371.0
13.3
41.8
1.2
NDf
NDf
147.0
18.2
a
Three to eight spleens were pooled and counted after RBC lysis. Total pooled spleen cells were divided by the number of
mice pooled to calculate number of cells per spleen. CD19⫹ B cells and memory B cells were analyzed and calculated based
on percent positive cells by FACS analysis. A representative experiment at each timepoint is shown.
b
CD19⫹ cells were gated and number of CD19⫹ B cells was calculated based on the frequency of CD19⫹ cells by FACS
analysis within the total spleen cell number.
c
Memory B cells are isotype switched sIgG⫹ CD38high cells.
d
Spleen cells were dissociated with collagenase D to improve cell yield.
e
Data shown are the mean ⫹ SD of five individual mice per group.
f
ND, Not done.
Sa, S. M., P. A. Valdez, J. Wu, K. Jung, F. Zhong, L. Hall, I. Kasman, J. Winer, Z. Modrusan, D. M. Danilenko, and W.
Ouyang. 2007. The effects of IL-20 subfamily cytokines on reconstituted human epidermis suggest potential roles in
cutaneous innate defense and pathogenic adaptive immunity in psoriasis. J. Immunol. 178: 2229 –2240.
In Materials and Methods, under the heading Microarray analysis and real-time RT-PCR, the accession number
should have been included as the last sentence in the second paragraph. The omitted sentence is shown below.
The microarray data were deposited in the public Gene Expression Omnibus (GEO) database (www.ncbi.nlm.nih.gov/
geo/) under accession number GSE7216.
7488
CORRECTIONS
Xu, Q., J. Lee, E. Jankowska-Gan, J. Schultz, D. A. Roennburg, L. D. Haynes, S. Kusaka, H. W. Sollinger, S. J. Knechtle,
A. M. VanBuskirk, J. R. Torrealba, and W. J. Burlingham. 2007. Human CD4⫹CD25low adaptive T regulatory cells
suppress delayed-type hypersensitivity during transplant tolerance. J. Immunol. 178: 3983–3995.
The last name of the fifth author was misspelled. The correct name is Drew A. Roenneburg.
In Table I, “off insulin” in footnote b and “ceased insulin” in footnote f should be “off immunosuppression.” The
corrected footnotes are shown below.
b
Kidney transplant from a deceased donor in 1993 for reflux nephropathy. Off immunosuppression 1995; clinical
course described as patient DS elsewhere (25) and in Fig. 3.
f
Kidney transplant from a deceased donor in 1986 for chronic glomerulonephritis; off immunosuppression in 2003 due
to renal carcinoma in native kidney that was removed in 2004. Current serum creatinine is 1.1 mg/dl.
In Table II, under “Peptide” in the middle column, the labels to the peptides “allo” and “self” are transposed. The
corrected table is shown below.
Table II. HLA-B peptide sequences
HLA-B Ag
Peptide
Amino Acid Sequences
B*1501
p106 (p106 –123) allo
NH2-DGRLLRGHDQSAYDGKDY-COOH
B*1501
p149 (p149 –166) allo
NH2-AAREAEQWRAYLEGLCVE-COOH
B*1501; B*5701
p37-MA (p37–54)a allo
p37-TE (p37–54) self
NH2-DSDAASPRMAPRAPWIEQ-COOH
NH2-DSDAASPRTEPRAPWIEQ-COOH
B*0801
p61-F (p61–77)b allo
p61-C (p61–77) self
NH2-DRNTQIFKTNTQTDRES-COOH
NH2-DRNTQICKTNTQTDRES-COOH
a
For the peptide defined by the region from aa 37 to aa 54 we designated the donor allopeptide p37-MA where ⬙MA⬙ refers
to the polymorphic residues methionine and alanine at positions 44 and 45 (in boldface type), while the corresponding ⬙self⬙
peptide p37-TE has threonine and glutamic acid. The MA polymorphism is found predominantly in only two common Caucasian
HLA-B antigens, HLA-B*1501 and HLA-B57, a mismatched HLA-B antigen for patient K2.
b
The polymorphic phenylalanine (F) amino acid is present at position 67 (in boldface type) in all HLA-B8 family members,
while the cysteine (C) amino acid (boldface type) is present in the HLA-B14 of patient K2
In Results, there are several errors as follows. In the last sentence of the paragraph under the heading Nonregulated
and regulated PBMC samples contain different proportions of IFN-␥- vs TGF-␤1-inducible T cells, “TGF-␤1” is missing
from “anti-TGF-␤1 Ab.” The corrected sentence is shown below.
DTH responses to the control peptide, p37-TE, were negative with or without anti-TGF-␤1 Ab (Fig. 5C).
In the first sentence of the first paragraph under the heading CD4⫹CD25low T cells show variable CD25 expression but
retain allopeptide-specific TGF-␤1 responsiveness after flow sorting and short-term culture, “CD25low T cells” should be
“CD25low TR cells” and “TGF-␤1” is missing. In the last sentence of the same paragraph, the word “retained” should be
“remained.” The corrected sentences are shown below.
The adoptive transfer data, coupled with the finding that mainly CD25low TR cells were induced to express surface
TGF-␤1 by allopeptide stimulation in vitro (Fig. 4C), raised the possibility that adaptive TR cells are among the
CD4⫹TGF-␤1⫹ T cells in the graft that showed variable CD25 expression by immunostaining.
However, in cultures with medium alone or peptides, ⬎85% remained negative for CD25 and there was no induction
of surface TGF-␤1 expression by p37-MA relative to p37-TE.
Salagianni, M., W. K. Loon, M. J. Thomas, A. Noble, and D. M. Kemeny. 2007. An essential role for IL-18 in CD8 T
cell-mediated suppression of IgE responses. J. Immunol. 178: 4771– 4778.
The second author’s name is incorrect. The correct name is Kok Loon Wong.