8 Phage λ and Lysogeny FIND CHAP TOC Table 8.1 ��������� ���� � �������������������������������� ������������ �������� � ����������������������������������� ��� � ��������� �� ���� � ��������������� ��������������� ����������������������������������� �� �� ���������������������������������������������� ���� � � ��� � � ��� ���� ��� ���������������������������������������� ����������������� ��������������������������������� ��� ��� ����������������������������������������������� ���������������������� ������������� ��� ��������������������������������������������� ����������������������������� ��������������������������������������������� ��������������������������������� ��� 8 Phage λ and Lysogeny FIND CHAP TOC Table 8.2 ��������� ����� �������� �� ������������� � �� � �� �� ��������������� ������������������������������������������������������� ��������������������� �� ���������������������������������������������������� ������������������������� � ��� � �� � ��� � ������������������������������ ������������������������������ � ��� ������������������������������������������� � �� �������������������������������������������� ���� ����������������������������������������������������� �������������������������������������������� ���� ��� ����������������������������������������������������� ������������������������������������������� �� � �� ������������������������������������������������ ������ � �� ��������������������������������������������������� �� ���� ���������������� ������������������������������� ���������������������� ��� ������������������ ������������������������������ ���������������������������������������������� ����������������������� �� ������������������������������������������������������������������������������ �������������������������������� Phage λ and Lysogeny 8 FIND CHAP TOC Left end Head Late regulation Immunity Recombination Early regulation Tail DNA replication Lysis Right end Figure 8.1 Function pRE pI pL Leftward transcripts pRM p′R 0 Rightward transcripts 30 RZ S R Q 204 221 N rexB rexA cI cro cII O P ren 146 290 cIII git ssb ral kil 20 exo bet gam int xis Ea8.5 Ea22 att Ea59 Ea31 Ea47 314 194 401 Iom J I M L K T 10 H FI FII Z U V G E C B A W Nu3 D 57 60 56 68 pR Genes 40 cos ori att cos kb 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.2 A tL1 N pL cro nutR tR1 pR B N int xis red gam tL1 nutL pL cro nutR pR tR1 O P tR2 Q C RNA Pol pR Without N nutR nutR tR1 mRNA RNA Pol D pR With N nutR n utR RNA Pol tR1 N mRNA pR nutR tR1 RNA Pol N 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.3 λnutL Box A Box B Box C A TGAAGGTGACGCT CT TAAAAAT TAAGCCCTGAAGAAGGGCAGCAT TCAAAGCAGAAGGCT T TGGGGTGTGTGATAC λnutR T AAATAACCCCGCTCT TACACAT TCCAGCCCTGAAAAAGGGCATCAAAT TAAACCACACCTATGGTGTATGCAT T TAT 21nutR T AAGCAAAT TGCTCT T TAACAGT TCTGGCCT T TCACCTCTAACCGGGTGAGCAAACATCAGCGGCAAATCCAT TGGGTGTGCGCTA P22nutL A ACGCTCT T TAACT TCGATGATGCGCTGACAAAGCGCGAACAAATACCAAACGAGAT TGGT T TGGACTGGCGTGTGGT λqut A TGGGT TAAT TCGCTCGT TGTGGTAGTGAGATGAAAAGAGGCGGCGCT TACTACCGAT TCCGCCTAGT TGGTCACT T 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.4 Gene O product pR ori cos RNA P ori cos Long concatemer co s Initially, RecBC blocks rollingcircle replication s co Rolling-circle replication RecBC Later, Gam inhibits RecBC Gam Circle-to-circle “θ” replication Dna B Host gene product 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.5 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.6 A cIII pL cII pR B int cI pI pRE CII CII C OFF pL o L O P Q R CI o R pR OFF Phage λ and Lysogeny FIND CHAP TOC Figure 8.7 A A′ attP P O P′ × cos B O B′ attB QR xis A J i nt 8 attP Int × gal B int xis gal attB/P attB bio A J attP/B bio 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.8 pL cI No repressor oL1 oL2 oL3 oR3 oR2 oR1 pR OFF pL oL1 Low repressor concentration oL2 oL3 cI mRNA pRM oR3 oR2 oR1 pR OFF High repressor concentration oL1 oL2 OFF oL3 oR3 oR2 oR1 OFF 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.9 RecA DNA damage ssDNA RecA* 1. Repressor cleaved pL int xis cro o1 o2 o3 o3 o2 o1 OP pR 2. Int and Xis produced Int/Xis attP/B bio × gal attB/P 3. Excision gal bio 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.10 OFF PRM cI Low [Cro] oR3 oR2 oR1 ON pR oR3 oR2 oR1 oR3 oR2 oR1 High [Cro] pR Low-level transcription of early lytic genes Affinity of oR for Cro: oR1 > oR2= oR3 8 Phage λ and Lysogeny FIND CHAP TOC Table 8.3 ��������� ������������������������������������������ ����������������������������� ������������������������� �� ��������������������� ��� �� �� ������������������������ �� ������������������ �� ����������������������� �� ������������������������ �� ������������������������ �� ���������� �� ������������ �� �������������������������������������������������� �� ���������������� ��������������������������������������������� ��������������� �� ���������������������������������������������������������� �� ����������������������������������������������������������� �������� ������������������������ ��� ������������������������������������������������������������� ��� ���������� ��� ������������������������������������������������������� �� ������������������������������������������� ��� �� ����������������� ��� �� ��������������������������������������������������������� 8 Phage λ and Lysogeny FIND CHAP TOC Box 8.2 A After λ infection, int expressed from pI RNase III cleavage site t int xis nutL int xis nutL int pI xis pL attP RNase III site RNase II t pL attP B After induction, int and xis expressed from pL nutL int attB/P xis pL RNase III site t attP/B 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.11 A λ genome int xis cIII 2 L pI N 1 L t t cro cI nutL pLoL pRM oR pR cII OP Q 1 R Late genes 2 R nutR t pRE t p′R t′R Regulatory sites B Early after infection N tL1 Immediately: pL tR1 pR Cro N p L Then: pR N CII C Decision Environmental factors cII Inactive D Active E Lytic cycle Cro 1st: oR3 pR CI OFF Cro 1st: Late genes 2nd: N p′R CII pI pRE N pL pR Int Q pL oL Red Gam 2nd: O P Q OFF pLoL CI CI CII pRM oR pR OFF CI Replication Phage DNA integration Phage production and lysis Maintenance of lysogen Lysogeny Phage λ and Lysogeny FIND CHAP TOC Figure 8.12 BP′ gal Prophage int xis cI att A J PB′ bio att Induction A J PB′ bio × gal BP′ int Rare excision error yields a low-frequency-transducing lysate A 8 λdgal cI Phage λ and Lysogeny FIND CHAP TOC Figure 8.13 cos cos 8 gal gal + BP′ BP′ PB′ Induction with UV light gal + BP′ c os s co PB′ × gal BP′ Excision and packaging yield a high-frequency-transducing lysate λ+ λdgal and gal + 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.14 A P4 infects a P2 lysogen B P4 P2 infects a P4 lysogen P2 P2 P4 P4 inhibits P2 repressor Sid Reduces head size P4 Sid protein reduces P2 head size Sid Induction of lysogen and P2 head and tail production P4 DNA Small P2 heads package P4 DNA P4 P4 P4 P4 Small P2 heads package P4 DNA P4 P4 P4 P4 P4 P4 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.15 Kanr ∆attP site deleted Q attB × Q Kanr attB Q Q Prophage Phage λ and Lysogeny 8 FIND CHAP TOC Figure 8.16 pstx P RM nutL p LoR tL1 attL Recombination nutR N oRpR cI tR1 cro tRstx qut CII OP tR234 pR′ Q –N +N –Q +Q t R′ attR stx2AB SR (lysis) Late genes (morphogenesis) 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.17 cIts cIts 1 Infection at nonpermissive temperature (42°C) If complementation occurs 2 Incubation at 42°C If complementation fails Lysogens form colonies 3 Plate at permissive temperature (30°C) No bacterial survivors, so no colonies Phage λ and Lysogeny FIND CHAP TOC Figure 8.18 N RP Red+ Gam+ red gam tL1 red gam tL1 nutL* pL nutL red gam tions a mut nut mut L (*) atio n 8 pL red* gam* P2 lysogen (λ plaques) tL1 nutL pL 8 Phage λ and Lysogeny FIND CHAP TOC Figure 8.19 A tL1 red + gam + nutL* Phenotype Red– Gam– × tL1 nutL+ Red– Gam– bio tL1 red + gam + nutL+ Red+ Gam+ tL1 nutL* Red– Gam– bio Plaques on RecA– E. coli B red tL1 gam nutL+ Red– Gam– × tL1 nutL+ Red– Gam– bio red gam tL1 nutL+ Red– Gam– tL1 nutL+ Red– Gam– bio No plaques on RecA– E. coli
© Copyright 2026 Paperzz