Journal
of General Virology (2002), 83, 1777–1781. Printed in Great Britain
..........................................................................................................................................................................................................
SHORT COMMUNICATION
RNA 2 of Citrus psorosis virus is of negative polarity and has a
single open reading frame in its complementary strand
Marı! a Eugenia Sa! nchez de la Torre1, Carmelo Lo! pez2, Oscar Grau1 and Marı! a Laura Garcı! a1
1
Instituto de Bioquı! mica y Biologı! a Molecular, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, Calles 47 y 115–1900 La
Plata, Argentina
2
Instituto de Biologı! a Molecular y Celular de Plantas (UPV-CSIC), Universidad Polite! cnica de Valencia, Spain
Citrus psorosis virus (CPsV) causes a citrus disease
occurring worldwide. Isolate CPV 4 has a genome
with three single-stranded RNAs. The complete
sequence of RNA 2 (1643 nucleotides) is reported
here. Northern blot hybridization with strandspecific probes showed that most of the encapsidated RNA 2 is of negative polarity, although a
small amount of the complementary strand may
also be present in particles. The RNA 2 complementary strand contained a single open reading
frame encoding a protein of 476 amino acids, which
includes a motif resembling a nuclear localization
signal. The sequence of this putative protein shows
no significant similarity to any other in the databases. In the 3h-terminal untranslated region there
is a putative polyadenylation signal. No subgenomic
RNAs derived from RNA 2 were detected.
Psorosis is a serious disease affecting citrus in many
countries (Roistacher, 1993). In Argentina, it seems to be
spread by an unknown vector (Ben4 atena & Portillo, 1984) and
it causes important losses (Danos, 1990). The presumed causal
agent, Citrus psorosis virus (CPsV), is the type member of the
genus Ophiovirus (Milne et al., 2000) but the low concentration
of virus particles in citrus tissues and their instability has so far
impeded characterization of the genome. All species of the
genus, Ranunculus white mottle virus (RWMV), Tulip mild mottle
mosaic virus (TMMMV) and Mirafiori lettuce virus (MiLV), have
similar morphology : circular, filamentous naked nucleocapside
about 3 nm in diameter of different lengths. Limited information is available about their genomic structure : RWMV
has at least three RNAs of approximately 7n5, 1n8 and 1n5 kb
and a coat protein of 43 kDa (Vaira et al., 1997) ; TMMMV
Author for correspondence : Oscar Grau.
Fax j54 221 4259223. e-mail grau!biol.unlp.edu.ar
The GenBank accession number of the sequence reported in this paper
is AF218572.
0001-8422 # 2002 SGM
presents a 47 kDa coat protein (Morikawa et al., 1995) and
MiLV also contains three RNAs of 8n5, 1n9 and 1n7 kb and a
coat protein of 48 kDa (Roggero et al., 2000).
Although the morphology of ophioviruses resembles that
of the nucleocapsids of bunyaviruses and tenuiviruses, their
RNAs 3 and 2 (as shown in this paper) have no sequence
homology with them or with any other negative or ambisense
viruses and their coat proteins have no serological reationship
(Vaira et al., 1997 ; Milne et al., 2000).
CPsV particles can be separated in a sucrose gradient into
two components, ‘ toph (T) and ‘ bottomh (B), which individually
are not infectious (Derrick et al., 1988 ; Garcı! a et al., 1991).
Particles from both components share a single coat protein and
they have a similar highly sinuous morphology, but B particles
have contour lengths about five times larger than T particles
(Derrick et al., 1988 ; Garcı! a et al., 1991, 1994). The CPV 4
isolate of CPsV has been reported to contain one large RNA in
the B component and a small single-stranded RNA in the T
component (Derrick et al., 1991). More recent results have
confirmed that RNA 1 is in the B component, but Northern
blot hybridization indicated that in the T component there are
two RNAs (RNA 2 and RNA 3) of approximately 1650 and
1500 nucleotides, respectively (Sa! nchez de la Torre et al.,
1998). RNA 3 codes for the coat protein (Sa! nchez de la Torre
et al., 1998 ; Barthe et al., 1998), but the sequences and possible
functions of the other RNAs are unknown. Here we report
the molecular characterization of CPsV RNA 2, which is of
negative polarity. The complementary strand of this RNA has
a single open reading frame (ORF) potentially encoding a
protein of unknown function with a putative nuclear localization signal (NLS).
The CPV 4 isolate (Garnsey & Timmer, 1980) was
mechanically transmitted from Citrus sinensis to Chenopodium
quinoa leaves, which developed local lesions. Virus particles
were partially purified from those lesions by differential and
sucrose gradient centrifugation as described by Garcı! a et al.
(1991). RNA extracted from the T component (T RNA) was
used to prepare a cDNA library with the Librarian II cloning kit
(Invitrogen). The sequences of 55 clones, determined in both
directions with an automatic ABI Prism apparatus, were
assembled in two contigs using the GCG software package
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:27:16
BHHH
M. E. Sa! nchez de la Torre and others
Fig. 1. Nucleotide and predicted amino acid sequences of the complementary strand (positive polarity) of CPsV RNA 2. The
nucleotides corresponding to the bipartite nuclear targeting sequence are underlined, and the conserved amino acids of that
sequence are in bold. A 23 nucleotide sequence including a putative polyadenylation signal in bold is boxed.
Version 9.0. The largest contig, corresponding to RNA 2,
included 35 clones that constituted a consensus sequence of
1607 nucleotides, which was confirmed by repeated sequencing with internal primers.
Once it was established that the encapsidated viral RNA 2
was of negative polarity (see below), two strategies were used
to search for its two termini. The 3h end of RNA 2 was
determined after polyadenylation of RNA from the T component with yeast poly(A) polymerase (Amersham). FirstBHHI
strand cDNA was synthesized with primer PM1 (5h CCGGATCCTCTAGAGCGGCCGCT V-3h ; where V is A, C or G)
"(
(kindly provided by Pedro Moreno, IVIA, Spain) and SuperScript II reverse transcriptase (Gibco BRL), and then PCR
amplified using primers PM-1 and Met (5h CATCATTAATGCCTTCCAAATCAGCAGTGTTTCCATCC 3h), complementary to positions 211–174 in the positive strand of RNA 2 (Fig.
1). For amplifications with Taq DNA polymerase a touchdown
cycling was carried out in a Perkin Elmer 2400 Thermocycler :
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:27:16
Citrus psorosis virus RNA 2
Fig. 2. Primer extension of the genomic CPsV RNA 2. RNA from the top
component (lane I) and from an equivalent extract of healthy tissue (lane
H), was reverse transcribed with SuperScipt II reverse transcriptase using
the Stop primer and [α-32P]dCTP. The four sequence ladders obtained
with the same primer and a plasmid containing an insert with the
presumed 5h end were electrophoresed in the same gel. Lanes A, C, G
and T at the top of the autoradiogram indicate the dideoxynucleotide used
in the sequencing reactions. The arrowhead indicates the position of the
extended cDNA.
five cycles for 10 s at 94 mC, 5 s at 70 mC and 45 s at 72 mC,
followed by 30 cycles of 10 s at 94 mC, 5 s at 68 mC and 45 s
at 72 mC, with a final extension for 5 min at 72 mC. PCR
products were cloned in plasmid pGEM-T (Promega) and
sequenced as described above. Ten clones obtained by this
procedure extended the sequence up to 1643 nucleotides.
The 5h end of RNA 2 was determined using two strategies.
1. The 3h end of positive RNA 2 was polyadenylated and
the first strand of cDNA was synthesised with primer PM1 and
PCR amplified with primers Pr260 (5h GGACAGCAGGGATGAAGGAA 3h), homologous to positions 1350–1369 (Fig. 1),
and PM1 under the following conditions : 35 cycles for 45 s at
94 mC, 45 s at 55 mC and 2 min at 72 mC, with a final extension
for 10 min at 72 mC. PCR products were cloned in plasmid
pGEM-T (Promega) and sequenced as described above. Six
clones were obtained, four inserts ended at position 1643, one
had an extra C, and another a T at position 1644.
2. The 5h end of RNA 2 was studied using the Smart PCR
cDNA Synthesis Kit (Clontech) and primers Smart (Clontech)
and Stop (5h GAGTATTGTATGAAGATCGAAAGGAGTGAG 3h), homologous to positions 1432–1461 in the positive
strand of RNA 2 (Fig. 1). Cloning and sequencing were
performed as above. Four clones had the same sequence up to
position 1643 ; however, an extra C cannot be ruled out
because by the use of the Smart strategy Cs are added at the
end of the first cDNA strand.
The 5h end of the RNA 2 was further confirmed by primer
extension using primer Stop. A single band of the predicted
size was obtained (Fig. 2). The sequence of the insert used for
comparison contains Cs at positions 1643\1644 but this could
be a consequence of the Smart strategy.
Fig. 3. Northern blot hybridizations of total RNA (A and B) and RNA from
the CPsV top component (C and D), using riboprobes for detecting the
negative (A and C) or the positive (B and D) strand of CPsV RNA 2. H and
I refer to extracts from healthy and CPsV-infected plants, respectively.
Arrows indicate the positions of both polarity strands of CPsV RNA 2.
Autoradiographs (A) and (B) were exposed for 36 h and (C) and (D) for
48 h. Positive and negative riboprobes had similar specific activity and
were transcribed from two inserts of approximately 750 and 900 bases in
opposite directions. The longest one, which detected the positive strand,
overlapped completely the shortest. Both riboprobes were prepared in
parallel with the same reaction mixture of equal specific activity. RNA
samples were run in duplicate in the same gel and blotted at the same
time. The membrane was divided : one half was hybridized in parallel with
the positive riboprobe and the other with the negative one and washed
under the same conditions. Due to the extra purification step, there was
more viral RNA in panels (A) and (B) (total RNA) than in panels (C) and
(D) (top RNA).
The consensus sequence of RNA 2 was therefore derived in
each region from 9 to 27 overlapping sequences.
No complementarity between the 5h- and 3h-terminal
sequences was observed, in spite of the circular structures
observed by electron microscopy of CPsV particles (Garcı! a et
al., 1994), which suggested a possible ‘ panhandleh structure as
in other viral RNAs. In the case of CPsV, the 5h ends of the
complementary strand of RNA 1 (unpublished results), RNA 2
and RNA 3 are identical, GATAC(T) , thus reinforcing the
(
probability that this sequence is the 5h terminus. The same
results have been also obtained with RNAs 1, 2 and 3 from a
Spanish CPsV isolate, giving further credence to this view
(Pedro Moreno, personal communication). The circular structures observed must be maintained by some other type of
interaction.
Northern blot hybridizations with riboprobes derived from
cloned RNA 2 cDNA were used to investigate the polarity of
the encapsidated form of this RNA and to explore the possible
existence of subgenomic RNAs in purified virions (T RNA) and
crude extracts (total RNA), as previously described (Sa! nchez
de la Torre et al., 1998). One intense band of the expected size
was observed in the total RNA fraction from infected tissue
when hybridized with a riboprobe containing a region of the
coding sequence of RNA 2 (Fig. 3A). This band was not
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:27:16
BHHJ
M. E. Sa! nchez de la Torre and others
present in the healthy control thus confirming its viral origin.
Using a second riboprobe of the complementary polarity, one
single band of the same size but significantly less intense was
observed (Fig. 3B). A weaker band of larger size that was
detected in extracts from both infected and healthy tissue was
considered non-specific. A similar hybridization pattern
was found using T RNA instead of total RNA (Fig. 3C, D).
An intense signal was generated with the riboprobe detecting
negative strands whereas the complementary riboprobe produced only a faint signal. Therefore, we conclude that CPsV
RNA 2 is of negative polarity. No subgenomic RNAs were
found in either T or total RNA preparations indicating that the
single ORF (see below) is translated from the positive strand of
the genomic RNA.
Using the Translate program, a single ORF was found in
the complementary strand of RNA 2, potentially encoding a
476 amino acid protein with an Mr of 53 694 (Fig. 1). The first
AUG codon was found at positions 46–48 and a second one,
in-frame, at positions 52–54. Based on the consensus sequences
flanking the translation start codon of eukaryotic mRNAs [an
A and a G at positions k3 and j4, respectively ; Kozak
(1989) and Lutcke et al. (1987)], it is not possible to decide
which is the actual initiation codon. An A at position k3
precedes the first AUG which is followed by a U, instead of a
G, at position j4. The second AUG has a G at position j4
but it is preceded by a U, instead of an A, at position k3. Both
AUGs have a C residue at position k2, which is also present
in Kozakhs and Lutckehs consensus.
Comparison of the sequences of all clones indicated very
limited and dispersed variability. Eight changes were located in
the ORF, none of them producing a stop codon, and five
causing changes in the amino acid sequence. The remaining
two variations were located in the 3h UTR.
The hydropathy profile of the putative protein coded by
RNA 2, obtained according to Kyte & Doolittle (1982),
showed that both terminal regions are hydrophilic, as well as
six internal regions. No significant hydrophobic regions were
observed, suggesting that this is not a transmembrane protein.
Since this protein has no significant similarity to any other in
databases (GenBank\EMBL, SWISSPROT and PIR, using
,  and ), we cannot speculate on its function.
However, most likely it does not have a structural role because
only a 48 kDa protein is found in purified particles (Garcı! a et
al., 1991).
In the amino acid sequence, two motifs located between
positions 86–102 and 255–271 bear similarity to a putative
‘ bipartite nuclear targeting sequenceh, which is considered to
be a nuclear localization signal (NLS) (Nigg, 1997). These
motifs contain two adjacent basic amino acids, Arg or Lys, a
spacer region of 10 residues, and at least three basic residues in
the next five positions after the spacer region (Fig. 1,
underlined). These karyophilic signals are present in the N
protein of the negative-stranded non-segmented viruses that
replicate in the host nucleus, like Sonchus yellow net virus
BHIA
(Martins et al., 1998) and Borna disease virus (Pyper & Gartner,
1997). In the case of influenza virus, with a negative-stranded
segmented genome, a nonconventional NLS has been found in
the viral nucleoprotein (Wang et al., 1997).
The positive strand of RNA 2 has 5h and 3h UTRs of 45 and
167 nucleotides, respectively, flanking the ORF (Fig. 1). The 3h
UTR has a 23 nucleotide sequence located 50 nucleotides
downstream of the stop codon (Fig. 1, boxed) that is also found
essentially unchanged in the 3h UTR of the positive strand of
RNA 3, at 29 residues downstream of the stop codon (Sa! nchez
de la Torre et al., 1998). The presence of this 23 nucleotide
stretch in the 3h UTR of the positive strand of RNAs 2 and 3
suggests its involvement in regulating replication or stabilization. Within these conserved 23 nucleotides there is an
AAUAAA sequence, which is a highly conserved polyadenylation signal in eukaryotes (Zhao et al., 1999) that is also present
in several negative-stranded viruses (Matthews, 1991), indicating that it might function as a polyadenylation signal in both
RNA 2 and 3.
In summary CPsV, the type species of the Ophiovirus genus,
is a multipartite RNA virus with three RNAs. At least two of
them are of negative polarity, encoding in their complementary
strands a single protein : the coat protein (RNA 3) and a 54 kDa
protein with a putative NLS (RNA 2).
We thank L. W. Timmer and K. S. Derrick for the CPV 4 isolate ; P.
Moreno for the PM1 primer and for critical reading and providing
unpublished information ; N. Costa for citrus seedlings and G. Chiarrone
for greenhouse work. The authors are indebted to R. Flores and R. G.
Milne for critically reading the manuscript. M. L. G. belongs to the staff
of Facultad de Ciencias Exactas, UNLP ; O. G. is a recipient of the research
career award from CICBA, and M. L. G. from CONICET. M. E. S. T.
belongs to the staff of Facultad of Ciencias Agrarias y Forestales, UNLP.
This work was supported by grants BID802 OC-AR PID 332, SECyTCONICET, UE contract ERBIC18CT960044 and CICBA 1454\97.
References
Barthe, G. A., Ceccardi, G. L., Manjunath, K. L. & Derrick, K. S. (1998).
Citrus psorosis virus : nucleotide sequencing of the coat protein gene and
detection by hybridization and RT–PCR. Journal of General Virology 79,
1531–1537.
Ben4 atena, H. N. & Portillo, M. M. (1984). Natural spread of psorosis in
sweet orange seedlings. In Proceedings of the 9th Conference of the
International Organization of Citrus Virologists, pp. 159–164. Edited by
S. M. Garnsey, L. W. Timmer & J. A. Doods. IOCV, University of
California, Riverside.
Danos, E. (1990). La psorosis de los cı! tricos : la epidemia en curso en
Argentina y el desafio de su control. Revista de Investigaciones Agropecuarias 22, 265–277. [Edited by International Foundation for Science (IFS)
e Instituto Nacional de Tecnologia Agropecuaria (INTA).]
Derrick, K. S., Brlansky, R. H., da Graça, J. V., Lee, R. F., Timmer, L. W.
& Nguyen, T. K. (1988). Partial characterization of a virus associated
with citrus ringspot. Phytopathology 78, 1298–1301.
Derrick, K. S., Lee, R. F., Hewitt, B. G., Barthe, G. A. & da Graça, J. V.
(1991). Characterization of citrus ringspot virus. In Proceedings of the 11th
Conference of the International Organization of Citrus Virologists, 1989, pp.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:27:16
Citrus psorosis virus RNA 2
386–390. Edited by L. W. Timmer, S. M. Garnsey & L. Navarro. IOCV,
University of California, Riverside.
Garcı! a, M. L., Grau, O. & Sarachu, A. N. (1991). Citrus psorosis is
probably caused by a bipartite ssRNA virus. Research in Virology 142,
303–311.
Garcı! a, M. L., Dal Bo, E., Grau, O. & Milne, R. G. (1994). The closely
related citrus ringspot and citrus psorosis viruses have particles of novel
filamentous morphology. Journal of General Virology 75, 3585–3590.
Garnsey, S. M. & Timmer, L. W. (1980). Mechanical transmissibility of
citrus ringspot virus isolates from Florida, Texas, and California. In
Proceedings of the 8th Conference of the International Organization of Citrus
Virologists, 1980, pp. 174–179. Edited by E. C. Calavan, S. M. Garnsey &
L. W. Timmer. IOCV, University of California, Riverside.
Kozak, M. (1989). The scanning model for translation : an update. Journal
of Cell Biology 108, 229–241.
Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the
hydropathic character of a protein. Journal of Molecular Biology 157,
105–132.
Lutcke, H. A., Chow, K. C., Mickel, F. S., Moss, K. A., Kern, H. F. &
Scheele, G. A. (19897). Selection of AUG initiation codons differs in
plants and animals. EMBO Journal 6, 43–48.
Martins, C. R. F., Johnson, J. A., Lawrence, D. M., Choi, T., Pisi, A. M.,
Tobin, S. L., Lapidus, D., Wagner, D. O. J., Ruzin, S., McDonald, K. &
Jackson, A. O. (1998). Sonchus yellow net rhabdovirus nuclear
viroplasm contain polymerase-associated proteins. Journal of Virology 72,
5669–5679.
Matthews, R. E. F. (1991). Replication. I. Introduction to the study of
virus replication. In Plant Virology, 3rd edn, pp. 169–170. San Diego :
Academic Press.
Milne, R. G., Garcı! a, M. L. & Grau, O. (2000). Genus Ophiovirus. In Virus
Taxonomy. Seventh Report of the International Committee on Taxonomy of
Viruses, pp. 626–631. Edited by M. H. V. van Regenmortel, C. M.
Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J.
Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner.
San Diego : Academic Press.
Morikawa, T., Nomura, Y., Yamamoto, T. & Natsuaki, T. (1995). Partial
characterization of virus-like particles associated with tulip mild mottle
mosaic. Annals of the Phytopathological Society of Japan 61, 578–581.
Nigg, E. A. (1997). Nucleocytoplasmic transport : signals, mechanisms
and regulation. Nature 386, 779–787.
Pyper, J. M. & Gartner, A. E. (1997). Molecular basis for the differential
subcellular localization of the 38- and 39-kilodalton structural proteins of
borna disease virus. Journal of Virology 71, 5133–5139.
Roggero, P., Ciuffo, M., Vaira, A. M., Accottto, G. P., Masenga, V. &
Milne, R. G. (2000). An Ophiovirus isolated from lettuce with big-vein
symptoms. Archives of Virology 145, 1–14.
Roistacher, C. N. (1993). Psorosis – a review. In Proceedings of the 12th
Conference of the International Organization of Citrus Virologists, 1992, pp.
139–154. Edited by P. Moreno, J. V. da Graça & L. W. Timmer. IOCV,
University of California, Riverside.
Sa! nchez de la Torre, E., Riva, O., Zandomeni, R., Grau, O. & Garcı! a,
M. L. (1998). The top component of citrus psorosis virus contains two
ssRNAs, the smaller encodes the coat protein. Molecular Plant Pathology
On-Line http :\\www.bspp.org.uk\mppol\1998\1019sanchez.
Vaira, A. M., Milne, R. G., Accotto, G. P., Luisoni, E., Masenga, V. &
Lisa, V. (1997). Partial characterization of a new virus from ranunculus
with a divided RNA genome and circular supercoiled thread-like particles.
Archives of Virology 142, 2131–2146.
Wang, P., Palese, P. & OhNeill, R. E. (1997). The NPI-1\NPI-3
(karyopherin α) binding site on the influenza A virus nucleoprotein NP is
a nonconventional nuclear localization signal. Journal of Virology 71,
1850–1856.
Zhao, J., Hyman, L. & Moore, C. (1999). Formation of mRNA 3h ends
in eukaryotes : mechanism, regulation, and interrelation with other steps
in mRNA synthesis. Microbiology and Molecular Biololgy Reviews 63,
405–445.
Received 26 February 2002 ; Accepted 25 March 2002
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:27:16
BHIB