Role of the P2Y12 Receptor in the
Modulation of Murine Dendritic Cell
Function by ADP
This information is current as
of June 17, 2017.
Abduelhakem Ben Addi, Dorothée Cammarata, Pamela B.
Conley, Jean-Marie Boeynaems and Bernard Robaye
J Immunol 2010; 185:5900-5906; Prepublished online 15
October 2010;
doi: 10.4049/jimmunol.0901799
http://www.jimmunol.org/content/185/10/5900
Subscription
Permissions
Email Alerts
This article cites 41 articles, 23 of which you can access for free at:
http://www.jimmunol.org/content/185/10/5900.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2010 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
References
The Journal of Immunology
Role of the P2Y12 Receptor in the Modulation of Murine
Dendritic Cell Function by ADP
Abduelhakem Ben Addi,*,1 Dorothée Cammarata,*,1 Pamela B. Conley,†
Jean-Marie Boeynaems,‡,x and Bernard Robaye*
D
endritic cells (DCs) are the most potent APCs of the immune system (1, 2). These cells are distributed widely in
the body and regulate both immunity and immune tolerance. Within peripheral tissues, immature DCs collect antigenic
material and then traffic to secondary lymphoid organs, where they
communicate, as mature DCs, with lymphocytes to orchestrate adaptive immune responses.
The effects of extracellular ATP and adenosine on DC function
have been studied extensively. Extracellular ATP induces a semimaturation of human monocyte-derived DCs, characterized by increased expression of costimulatory molecules, inhibition of IL12, and stimulation of IL-10 (3–6). These effects are likely to be
mediated by the P2Y11 receptor (5, 7). Adenosine is well known to
exert an anti-inflammatory effect on DCs by activating the A2B receptor in murine bone marrow-derived DCs (BMDCs) (8, 9) and
*Institut de Recherche Interdisciplinaire en Biologie Humaine et Moléculaire, Université Libre de Bruxelles, Gosselies; ‡Institut de Recherche Interdisciplinaire en
Biologie Humaine et Moléculaire and xChimie Médicale, Hôpital Erasme, Université
Libre de Bruxelles, Brussels, Belgium; and †Portola Pharmaceuticals, Inc., South San
Francisco, CA 94080
1
A.B.A. and D.C. contributed equally to this work
Received for publication June 8, 2009. Accepted for publication September 7, 2010.
the A2A receptor in human monocyte-derived DCs (10, 11). The A3
receptor also is expressed on these last cells (12). Adenosine also
induces the chemotaxis of immature human plasmacytoid DCs
via the A1 receptor, whereas the A2A receptor is upregulated after
maturation and inhibits cytokine production (13).
On the contrary, the effects of ADP on DC function have been
little investigated. ADP has been shown to trigger a pertussis toxinsensitive intracellular Ca2+ transient in immature human DCs and
to activate the MAPK ERK-1 pathway (14, 15). The latter effect was
inhibited by AR-C69931MX, a dual P2Y12 and P2Y13 receptor
antagonist. In addition, ADP inhibits the production of both IL-12
and IL-10 (15), whereas it stimulates the expression of IL-23 p19
subunit mRNA (16). ADP also was reported to be chemotactic for
immature DCs, an effect inhibited by pertussis toxin (14).
Taken together, these results suggested the functional expression
of Gi/o protein-coupled ADP receptor(s) on DCs, presumably P2Y12
or P2Y13. Therefore, the aim of the present work was to investigate
the effects of ADP on murine DC function and to identify the receptor(s) involved thanks to the use of knockout mice.
Materials and Methods
Reagents
This work was supported by Actions de Recherche Concertées de la Communauté
Française de Belgique by the Belgian Program on Interuniversity Poles of Attraction
initiated by the Belgian State, Prime Minister’s Office, Federal Service for Science,
Technology and Culture, and by a grant of the Fonds de la Recherche Scientifique
Médicale. A.B.A. was supported by the Fonds National de la Recherche Scientifique,
Belgium, the Fonds David and Alice Van Buuren, and the ATPBone project (7th
Framework Programme of the European Commission). D.C. was supported by the
Fonds National de la Recherche Scientifique, Belgium.
Adenosine-59-O-(2-thiodiphosphate) (ADPbS), MRS-2179, (6)-diphenyl-4[phenylsulfinylethyl]-3,5-pyrazolidinedione, 3-amino-N-(aminoiminoethyl)5-(dimethylamino)-6-chloropyrazinecarboxamide hydrochloride (DMA),
BAPTA-AM, ionomycin, OVA, and FITC-dextran (40 kDa) were purchased
from Sigma-Aldrich (St. Louis, MO). AR-C69931MX and AR-C67085MX
were gifts from Astra Zeneca (London, U.K.), dye-quenched OVA (DQ OVA)
pluronic acid, and Fluo-4AM were purchased from Invitrogen (Carlsbad,
NM).
Address correspondence and reprint requests to Dr. Bernard Robaye, 10 Rue A.
Bolland, Université Libre de Bruxelles, Gosselies 6041, Belgium. E-mail address:
[email protected]
Animals
Abbreviations used in this paper: ADPbS, adenosine-59-O-(2-thiodiphosphate);
BMDC, bone marrow-derived dendritic cell; DC, dendritic cell; DMA, 3-aminoN-(aminoiminoethyl)-5-(dimethylamino)-6-chloropyrazinecarboxamide hydrochloride; DQ
OVA, dye-quenched OVA; MFI, mean fluorescence intensity; n, number of mice; NI,
nonimmunized mice; n.s., not significant; qPCR, quantitative RT-PCR; sDC, splenic
dendritic cell; WT, wild-type.
Copyright Ó 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901799
P2Y122/2 mice were generated as described by Andre et al. (17). They were
on a C57BL/6 genetic background. The generation of P2Y132/2 mice will
be described elsewhere (A.C. Fabre, C. Malaval, A. Ben Addi, C. Verdier,
V. Pons, N. Serhan, L. Lichtenstein, G. Combes, N. Nijstad, U. Tietge, et al.,
manuscript in preparation). In brief, the P2Y13 gene was disrupted in 129S/v
R1 embryonic stem cell lines after homologous recombination of the targeting vector. P2Y13-targeted embryonic stem cells were identified by
Southern blot analyses and used for chimeric mice generation by aggregation
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
The effects of ADP on the biology of dendritic cells have been studied much less than those of ATP or adenosine. In this study, we
showed that adenosine-59-O-(2-thiodiphosphate) (ADPbS) induced intracellular Ca2+ transients in murine dendritic cells (DCs).
This effect was abolished by AR-C69931MX, a dual P2Y12 and P2Y13 receptor antagonist. RT-PCR experiments revealed the
expression of both P2Y12 and P2Y13 mRNA in DCs. The Ca2+ response to ADPbS was maintained in P2Y13-deficient DCs, whereas
it was abolished completely in P2Y122/2 DCs. ADPbS stimulated FITC-dextran and OVA capture in murine DCs through
macropinocytosis, and this effect was abolished in P2Y122/2 DCs. ADPbS had a similar effect on FITC-dextran uptake by human
monocyte-derived DCs. OVA loading in the presence of ADPbS increased the capacity of DCs to stimulate OVA-specific T cells,
whereas ADPbS had no effect on the ability of DCs to stimulate allogeneic T cells. Moreover, after immunization against OVA, the
serum level of anti-OVA IgG1 was significantly lower in P2Y122/2 mice than that in wild-type controls. In conclusion, we have
shown that the P2Y12 receptor is expressed in murine DCs and that its activation increased Ag endocytosis by DCs with subsequent enhancement of specific T cell activation. The Journal of Immunology, 2010, 185: 5900–5906.
The Journal of Immunology
5901
with morulae. Mice with the targeted mutation were crossed with C57BL/6
mice for up to 10 generations. OT-1 and OT-2 Rag2/2 mice were provided
kindly by Dr. F. Bureau (Université de Liège, Liège, Belgium). The transgenic TCR of OT-1 and OT-2 mice was designed to recognize OVA residues
(323–339 and 257–264) in the context of H2Kb and I-Ab, respectively. All of
the mice used in this study were housed under specific pathogen-free conditions in our animal facility. All of the animal studies were authorized by the
Animal Care Use and Review Committee of the Université Libre de Bruxelles.
DC generation
Isolation of RNA, reverse transcription, and quantitative PCR
Total RNA was extracted using TriPure reagent (Roche, Basel, Switzerland)
and quantified on a NanoDrop 1000 (Thermo Fisher Scientific, Waltham,
MA). After DNase I treatment (Fermentas, Hanover, Germany), RNA was
reverse-transcribed using the RevertAid H Minus M-MuLV reverse transcriptase (Fermentas). PCR was performed using the Qiagen Taq Core Kit
(Quiagen, Venlo, Netherlands). Quantitative RT-PCR was performed with
the quantitative RT-PCR (qPCR) MasterMix for SYBR Green I (Eurogentec) on a 7300 Real-Time PCR System (Applied Biosystems, Foster
City, CA). All of the primers (Table I) were designed using the Primer3
software (http://fokker.wi.mit.edu/primer3/primer3_code.html). For qPCR,
housekeeping genes (CANX, RPL32, and YWHAZ; Biogazelle, Gent,
Belgium) were selected using Genorm program.
2+
[Ca ]i measurement
[Ca2+]i was measured in sDCs and BMDCs as described previously (8).
Briefly, freshly isolated sDCs (or BMDCs) were labeled with the calcium
fluorescent dye Fluo-4-AM (5 mM) in the presence of 250 mM (6)-diphenyl4-[phenylsulfinylethyl]-3,5-pyrazolidinedione and 100 mg/ml pluronic acid.
Cell fluorescence was monitored for 204 s at 37˚C, using a FACScan flow
cytometer (BD Biosciences, Franklin Lake, NJ). Antagonists were preincubated for 10 min before addition of the agonist. Data were analyzed with
the Winmdi software (The Scripps Research Institute, La Jolla, CA). Results
were expressed as the ratio of the maximal response induced by 300 ng/ml
ionomycin.
Endocytosis
Freshly purified sDCs (or BMDCs) were stimulated as indicated below in
the complete medium described earlier. FITC-dextran (1 mg/ml), DQ OVA
(1 mg/ml), and nucleotides were added simultaneously to the cell culture
and incubated at 37˚C. Endocytosis inhibitors (DMA and BAPTA-AM)
were preincubated for 15 min prior to stimulation. After three washes
with cold PBS (supplemented with 0.1% BSA and 0.1% sodium azide),
Cytokine measurement
Freshly isolated sDCs were cocultured for 24 h in complete medium (see
above) with 2 3 105 irradiated (10,000 rad) 3T3 or 3T3 cells expressing
CD40L, kindly provided by Dr. Moser (Université Libre de Bruxelles,
Gosselies, Belgium). Cell-free supernatants were harvested, and IL-12p70
levels were determined by a commercially available ELISA kit (eBioscience, San Diego, CA).
Mixed lymphocyte reaction
OT-1, OT-2, and BALB/c T lymphocytes were purified from spleen on
MACS cell separation columns by depletion of non-T cells. Purity was
analyzed by flow cytometry and was consistent with at least 95% CD3+
cells. OVA-loaded DCs and T cells were cocultured for 72 h, and proliferation of T cells was determined by [3H]thymidine (1 mCi/ml) incorporation for the last 12–16 h of culture.
Mice immunization
Mice were injected s.c. at the base of the tail with an emulsion of IFA and
OVA (100 mg per mouse) or with IFA only (non-immunized mice) and bled
16 d later. Serum was obtained after centrifugation of clotted blood (2–6 h
at 4˚C). Specific anti-OVA Igs and total Ig subclass G1 and G2a were
quantified by ELISA. Briefly, 96-well flat-bottom plates were coated
overnight at 4˚C with OVA (5 mg/ml in PBS) or monoclonal rat anti-mouse
IgG1 or IgG2a Abs (5 mg/ml in PBS) to quantify OVA-specific or total Ig,
respectively. Plates were saturated with PBS/0.5% BSA for 1 h at room
temperature. Serum samples were diluted in PBS/0.1% BSA and incubated
for 2 h at room temperature. Specific and total IgG subclass were detected
using HRP-conjugated rat anti-mouse IgG1 or IgG2a Abs (LO-IMEX,
Brussels, Belgium).
Statistical analysis
Statistical analyses were performed using Prism, version 3.00, for Windows (GraphPad, San Diego, CA)
Results
Expression of ADP receptor(s) in murine DCs
The functional expression of ADP receptors was investigated in
FLT3 ligand expanded murine sDCs and BMDCs. In these experiments, ADPbS was used instead of ADP to minimize effects due to
its degradation product adenosine. As shown in Fig. 1A, ADPbS
triggered a pertussis toxin-sensitive transient elevation of [Ca2+]i in
BMDCs as well as in sDCs. This rise in [Ca2+]i was concentrationdependent: EC50 = 1.9 mM (Fig. 1B). To identify the receptor(s)
involved, we used selective antagonists of ADP receptors. MRS2179, a P2Y1 receptor-selective antagonist, had no effect, whereas
AR-C69931MX, a dual P2Y12 and P2Y13 receptor antagonist,
completely abolished the [Ca2+]i rise induced by ADPbS in sDCs
(Fig. 1C). Furthermore, AR-C67085MX, an antagonist more potent
on the P2Y12 receptor than on the P2Y13 receptor (20), also abolished the rise in [Ca2+]i induced by ADPbS. RT-PCR experiments
revealed the expression of both P2Y12 and P2Y13 mRNA in sDCs
(Fig. 1D) and BMDCs (data not shown). To distinguish the contribution of each receptor, P2Y12- and P2Y13-deficient DCs were used.
Table I. List of specific primers used in this study
qPCR
RT-PCR
Gene
Forward (59–39)
P2Y12
RPL32
CANX
YWHAZ
P2Y12
P2Y13
GTGTTGACACCAGGCACATC
AACCCAGAGGCATTGACAAC
TTGCTGACTCCTTTGACAGAGG
TGCAACGATCTACTGTCTCTT
CCGGAGACACTCATATCCTTC
ATTCGTGGGTTGAGCTAGTAA
Reverse (59–39)
TCCCGGAGACACTCATATCC
AACCCAGAGGCATTGACAAC
CCACTTTCCATCATATTTGGCA
CGGTAGTAGTCACCCTTCATTTTCA
GCCCAGATGACAACAGAAAG
ATCAGGGACCAGACGGAAAT
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Splenic DCs (sDCs) were expanded in vivo by s.c. injection of 1 3 106
recombinant B16 melanoma cells expressing the murine FLT3 ligand as
described previously by Pasare et al. (18). sDCs were purified on MACS
cell separation columns using anti-CD11c microbeads (Miltenyi Biotec,
Gladbach, Germany). Purity was analyzed by flow cytometry and was
consistent with at least 95% CD11c+ cells. BMDCs were generated as
described previously by Inaba et al. (19). Briefly bone marrow cells
obtained from femur and tibia were cultured for 9 d in complete medium
(see below) supplemented with 20 ng/ml GM-CSF (Invitrogen). sDCs and
BMDCs were cultured in complete medium: RPMI 1640 supplemented
with 5% FCS (MultiCell Technologies, Lincoln, RI), 2 mM L-glutamine,
100 U/ml penicillin, 100 mg/ml streptomycin, and 50 mM 2-ME. Human
monocyte-derived DCs were generated as described previously (5). Briefly,
PBMCs were isolated from leukocyte-enriched buffy coats by standard
density gradient centrifugation on Lymphoprep solution from Nycomed
(Oslo, Norway) and resuspended in complete medium. Cells were allowed
to adhere for 2 h at 37˚C on culture plates. Adherent cells were cultured
further for 6 d in complete medium supplemented with 800 U/ml GM-CSF
and 1000 U/ml IL-4. GM-CSF and IL-4 were added every 3 d.
cells were analyzed by flow cytometry (20,000 events per sample were
analyzed). In all of the experiments, cells incubated with the probes at 4˚C
were used as background controls. Trypan blue (0.05%) was used to
quench extracellular fluorescence.
5902
REGULATION OF DC FUNCTION BY ADP
As shown in Fig. 2A, the Ca2+ response to ADPbS was maintained
in P2Y13-deficient DCs, whereas it was abolished completely in
P2Y122/2 sDCs. Surprisingly, the rise in [Ca2+]i in P2Y132/2 sDCs
was larger than that in wild-type cells. To find out the mechanism
underlying this alteration, we compared the expression levels of
P2Y12 transcripts in P2Y132/2 sDCs and wild-type cells (Table I). As
shown in Fig. 2B, the P2Y12 mRNA level was 2-fold higher in
P2Y132/2 sDCs than that in wild-type cells. The rise of [Ca2+]i
also was maintained in P2Y132/2 BMDCs (data not shown), whereas
it was decreased partially in P2Y122/2 BMDCs (Fig. 2C). The
remaining calcium response in BMDCs was abolished by MRS2179, indicating the functional expression of the P2Y1 receptor in
these cells.
Effects of ADP on DC function
After having demonstrated that murine DCs express at least one
functional ADP receptor, we studied the effects of ADPbS on DC
function. First of all, we observed that the IL-12p70 production by
CD40L-stimulated sDCs was reduced partially by ADPbS (mean
inhibition 40 6 4%; Fig. 3). This partial inhibition was maintained
in both P2Y122/2 and P2Y132/2 sDCs (40 6 1% and 35 6 7% inhibition, respectively). Furthermore, MRS-2179 did not abolish
the inhibitory effect of ADPbS on IL-12 production, excluding the
involvement of the P2Y1 receptor. The inhibition of IL-12 production may be due to the activation of A2B receptor by adenosine
contaminating or generated from ADPbS, as indicated by our previous results (8).
FIGURE 2. Functional expression of the P2Y12 receptor in mouse DCs. A, C, [Ca2+]i measurement in transgenic sDCs and BMDCs. A, Fluo-4-AMloaded wild-type (WT), P2Y132/2, and P2Y122/2 sDCs were stimulated with 10 mM ADPbS. Data are expressed as mean 6 SEM of five independent
experiments. B, Quantitative RT-PCR (SYBR Green) for P2Y12 mRNA in WT and P2Y132/2 sDCs. C, WT and P2Y122/2 BMDCs were preincubated with
MRS-2179 (MRS, 10 mM) for 10 min and then stimulated with ADPbS (10 mM). Data are expressed as mean 6 SEM of three independent experiments.
pp , 0.05; ppp , 0.01; pppp , 0.001 using Bonferroni’s multiple comparison test.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 1. Expression of ADP receptors in
murine DCs. A–C, [Ca2+]i measurement in DCs.
Cells were loaded with Fluo-4-AM, and fluorescence was monitored as described in Materials
and Methods. A, Freshly isolated sDCs (top) or
BMDCs (middle and bottom) were stimulated
(arrows) with ADPbS (10 mM) and then with
ionomycin (iono, 300 nM) to control variation of
loading. BMDCs (bottom) were preincubated with
pertussis toxin (100 ng/ml) during the last 24 h of
culture. Data are expressed as mean fluorescence
intensities (MFIs). B, sDCs were stimulated with
the indicated concentrations of ADPbS. Data are
expressed as ratios of the maximal response induced by ionomycin. C, sDCs were preincubated
with MRS-2179 (MRS, 10 mM), AR-C69931MX
(AR-C69, 10 mM), or AR-C67085 (AR-C67, 10
mM) for 10 min and then stimulated with ADPbS
(10 mM). pppp , 0.001 using Bonferroni’s multiple comparison test. D, RNA of sDCs was extracted as described in Materials and Methods,
and RT-PCR was performed using specific primers
for P2Y12 and P2Y13 cDNA. Negative controls
(bottom) of the PCR reactions (RNA without reverse transcription) are shown for each pair of
primers. A–C, One representative experiment out
of three to five is shown.
The Journal of Immunology
FIGURE 3. Effect of ADPbS on IL-12p70 release by murine DCs.
Freshly isolated WT, P2Y132/2, and P2Y122/2 sDCs were cocultured for
24 h with irradiated 3T3 (CTL) or 3T3 cells expressing CD40L. Supernatants were collected for measurement of IL-12p70 by ELISA. One representative experiment out of at least three is shown. Data are expressed as
mean 6 SD of triplicates.
FIGURE 4. Effect of ADPbS on Ag
uptake by DCs. A–E, Freshly isolated
sDCs were stimulated as indicated and
simultaneously incubated with FITCdextran (1 mg/ml). A, Representative
FACS histogram of cells incubated with
FITC-dextran for 30 min at 37˚C (dashed
line), simultaneously stimulated with
ADPbS (50 mM) (continuous line), or
left at 4˚C (dotted line). B, sDCs were
stimulated for 30 min with the indicated concentrations of ADPbS. C, sDCs
were stimulated for the indicated time
with ADPbS (50 mM). D, WT and
P2Y122/2 sDCs were stimulated with
ADPbS (50 mM) or solvent (CTL) for 30
min. E, sDCs were pretreated for 15 min
with DMA (500 mM) or BAPTA-AM
(50 mM) and stimulated with ADPbS
(50 mM) or solvent (CTL). B–E, Data are
expressed as MFI 6 SD and are representative of at least three independent
experiments. D and E, pppp , 0.001 using
Bonferroni’s multiple comparison test.
derived DCs to 136% of the control (mean of six experiments),
whereas ATP (100mM) increased it to 144%, an effect similar to
that previously reported in the literature (4).
Because Ag internalization was enhanced by ADPbS, we assessed whether this nucleotide could modulate Ag presentation by
DCs. OVA was used, instead of FITC-dextran, due to the availability of transgenic OVA-specific T cells that allow the study of
Ag presentation in vitro. OVA is internalized mainly through the
mannose receptor but also is taken up by macropinocytosis (24).
Because ADP stimulated macropinocytosis, we first investigated
the effect of ADPbS on OVA internalization. As shown in Fig. 5A,
ADPbS slightly, but significantly, increased OVA uptake by sDCs,
and this effect also was abolished completely in P2Y122/2 sDCs.
We then cocultured OVA preloaded splenic DCs with OVA-specific
T cells. sDCs loaded in presence of ADPbS showed an increased
ability to activate OVA-specific T cells (OT-1 and OT-2) (Fig. 5B,
5C). On the contrary, ADPbS did not enhance the capacity of sDCs
to activate allogeneic T cells (purified from BALB/c mice) (Fig.
5D), indicating that the stimulatory effect of ADPbS is related
mainly to Ag presentation.
Finally, we assessed whether the P2Y12 receptor may modulate an immune response to soluble Ags in vivo. For that purpose,
we immunized wild-type and P2Y122/2 mice with OVA and quantified their production of anti-OVA Igs. To enhance the immune response, OVA was injected s.c. as an emulsion in IFA. As shown in
Fig. 6, P2Y122/2 mice exhibit a lowered IgG1 response. IgG2a production also was reduced in these knockout mice, but the reduction
was not statistically significant. Total IgG1 and IgG2a levels were
similar in wild-type and P2Y122/2 mice.
Discussion
The P2Y12 receptor has restricted expression. It is known to be
expressed on platelets and to play a major role in their aggregation
(17, 25). Its presence in numerous regions of the brain is consistent
with a glial expression pattern (25). In particular, it is localized on
microglial cells and involved in microglial activation (polarization, process extension, and migration) by nucleotides after brain
damage (26, 27). Hollopeter et al. (25) showed that the P2Y12
mRNA is not present in peripheral blood leukocytes. However, others
have reported that the P2Y12 transcript is expressed in murine
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
DCs have the ability to take up Ags (endocytosis). Depending on
the nature of the particle to be internalized, distinct endocytosis
mechanisms are involved: phagocytosis, receptor-mediated endocytosis, or macropinocytosis (21). To characterize the effect of ADP
on endocytosis, we used FITC-dextran as a fluorescent Ag. As
shown in Fig. 4A, ADPbS stimulated FITC-dextran internalization. This effect was concentration-dependent (EC50 = 25.7 mM;
Fig. 4B) and was maximal after 30 min of stimulation (Fig. 4C). The
stimulatory effect of ADPbS was maintained in P2Y132/2 sDCs
(data not shown), whereas it was abolished completely in P2Y122/2
sDCs (Fig. 4D). To identify the mechanism of FITC-dextran uptake
induced by ADPbS, we used different inhibitors. As shown in
Fig. 4E, DMA, an inhibitor of macropinocytosis (22), abolished the
stimulatory effect of ADPbS on FITC-dextran internalization. Furthermore, BAPTA-AM, an intracellular calcium chelator, slightly
decreased the basal FITC-dextran internalization, as reported previously by Falcone et al. (23), but blocked completely the stimulatory effect of ADPbS on Ag uptake. In addition, ADPbS (100
mM) increased the uptake of FITC-dextran by human monocyte-
5903
5904
REGULATION OF DC FUNCTION BY ADP
Langherans cells (28) and lymphocytes (29). Our present results
show for the first time the functional expression of the P2Y12 receptor in murine DCs.
We show in the present work that the activation of the P2Y12
receptor increased macropinocytosis by murine DCs, which subsequently increased their ability to stimulate Ag-specific T cells.
Similarly, ATP has been shown to transiently stimulate FITC-
dextran internalization by human DCs through an unidentified
receptor (4). We now have shown that ADPbS exerts a similar
effect on human DCs. Our results are also consistent with the fact
that other Gi/o protein-coupled receptors are known to stimulate
Ag uptake by DCs. Activation of CCR5 and CCR7, two Gi/o-coupled chemokine receptors involved in DC migration, enhanced the
endocytotic activity of murine DCs (30).
FIGURE 6. Ig production in WT versus P2Y122/2 mice. Mice were immunized s.c. with an emulsion of IFA and OVA (100 mg per mouse). Sixteen days
after immunization, mice were bled. Specific anti-OVA IgG1 (A) and IgG2a (B) as well as total IgG1 (C) and IgG2a (D) were determined in serum by
ELISA. Data are expressed as mean of OD 6 SEM from four independent experiments. pp , 0.05 using unpaired t test with Welch’s correction (WT versus
P2Y12 knockout are compared at the same dilution). n, number of mice; NI, nonimmunized mice; n.s., not significant.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 5. Effect of ADPbS on the
Ag presentation ability of DCs. A, Endocytosis of OVA by freshly isolated
WT and P2Y122/2 sDCs. Cells were
stimulated with ADPbS (50 mM) and
simultaneously incubated with DQ
OVA (1 mg/ml) for 30 min. Data are
expressed as MFI 6 SD and are representative of at least three independent experiments. B–D, sDCs were
cocultured with T cells purified from
OT-2 Rag2/2 mice (B), OT-1 Rag2/2
mice (C), or BALB/c mice (D) for 72 h,
and proliferation was determined by
[3H]thymidine incorporation for the
last 12–16 h of culture. sDCs were
preloaded with OVA (100 mg/ml) and
simultaneously stimulated with ADPbS
(50 mM) for 1 h. A, pppp , 0.001 using
Bonferroni’s multiple comparison test.
B–D, pppp , 0.001; ppp , 0.01 using
Student t test.
The Journal of Immunology
Acknowledgments
We thank Dr. O. Leo, Dr. F. Eddahri, Laurent Conde da Silva Fraga, and
Dr. M. Moser (Université Libre de Bruxelles, Gosselies, Belgium) for helpful discussions, Dr. F. Bureau and H. Wallemacq (Université de Liège,
Liège, Belgium) for the gift of OT-1 and OT-2 Rag2/2 mice, and D. Fokan
for efficient technical assistance.
Disclosures
The authors have no financial conflicts of interest.
References
1. Shortman, K., and S. H. Naik. 2007. Steady-state and inflammatory dendriticcell development. Nat. Rev. Immunol. 7: 19–30.
2. Alvarez, D., E. H. Vollmann, and U. H. von Andrian. 2008. Mechanisms and
consequences of dendritic cell migration. Immunity 29: 325–342.
3. la Sala, A., D. Ferrari, S. Corinti, A. Cavani, F. Di Virgilio, and G. Girolomoni.
2001. Extracellular ATP induces a distorted maturation of dendritic cells and
inhibits their capacity to initiate Th1 responses. J. Immunol. 166: 1611–1617.
4. Schnurr, M., F. Then, P. Galambos, C. Scholz, B. Siegmund, S. Endres, and
A. Eigler. 2000. Extracellular ATP and TNF-alpha synergize in the activation
and maturation of human dendritic cells. J. Immunol. 165: 4704–4709.
5. Wilkin, F., X. Duhant, C. Bruyns, N. Suarez-Huerta, J. M. Boeynaems, and
B. Robaye. 2001. The P2Y11 receptor mediates the ATP-induced maturation of
human monocyte-derived dendritic cells. J. Immunol. 166: 7172–7177.
6. Wilkin, F., P. Stordeur, M. Goldman, J. M. Boeynaems, and B. Robaye. 2002.
Extracellular adenine nucleotides modulate cytokine production by human
monocyte-derived dendritic cells: dual effect on IL-12 and stimulation of IL-10.
Eur. J. Immunol. 32: 2409–2417.
7. Schnurr, M., T. Toy, P. Stoitzner, P. Cameron, A. Shin, T. Beecroft, I. D. Davis,
J. Cebon, and E. Maraskovsky. 2003. ATP gradients inhibit the migratory capacity of specific human dendritic cell types: implications for P2Y11 receptor
signaling. Blood 102: 613–620.
8. Ben Addi, A., A. Lefort, X. Hua, F. Libert, D. Communi, C. Ledent, P. Macours,
S. L. Tilley, J. M. Boeynaems, and B. Robaye. 2008. Modulation of murine
dendritic cell function by adenine nucleotides and adenosine: involvement of the
A(2B) receptor. Eur. J. Immunol. 38: 1610–1620.
9. Novitskiy, S. V., S. Ryzhov, R. Zaynagetdinov, A. E. Goldstein, Y. Huang,
O. Y. Tikhomirov, M. R. Blackburn, I. Biaggioni, D. P. Carbone, I. Feoktistov,
and M. M. Dikov. 2008. Adenosine receptors in regulation of dendritic cell
differentiation and function. Blood 112: 1822–1831.
10. Panther, E., S. Corinti, M. Idzko, Y. Herouy, M. Napp, A. la Sala, G. Girolomoni,
and J. Norgauer. 2003. Adenosine affects expression of membrane molecules,
cytokine and chemokine release, and the T-cell stimulatory capacity of human
dendritic cells. Blood 101: 3985–3990.
11. Panther, E., M. Idzko, Y. Herouy, H. Rheinen, P. J. Gebicke-Haerter, U. Mrowietz,
S. Dichmann, and J. Norgauer. 2001. Expression and function of adenosine
receptors in human dendritic cells. FASEB J. 15: 1963–1970.
12. Fossetta, J., J. Jackson, G. Deno, X. Fan, X. K. Du, L. Bober, A. Soudé-Bermejo,
O. de Bouteiller, C. Caux, C. Lunn, et al. 2003. Pharmacological analysis of
calcium responses mediated by the human A3 adenosine receptor in monocytederived dendritic cells and recombinant cells. Mol. Pharmacol. 63: 342–350.
13. Schnurr, M., T. Toy, A. Shin, G. Hartmann, S. Rothenfusser, J. Soellner,
I. D. Davis, J. Cebon, and E. Maraskovsky. 2004. Role of adenosine receptors in
regulating chemotaxis and cytokine production of plasmacytoid dendritic cells.
Blood 103: 1391–1397.
14. Idzko, M., S. Dichmann, D. Ferrari, F. Di Virgilio, A. la Sala, G. Girolomoni,
E. Panther, and J. Norgauer. 2002. Nucleotides induce chemotaxis and actin
polymerization in immature but not mature human dendritic cells via activation
of pertussis toxin-sensitive P2y receptors. Blood 100: 925–932.
15. Marteau, F., D. Communi, J. M. Boeynaems, and N. Suarez Gonzalez. 2004.
Involvement of multiple P2Y receptors and signaling pathways in the action of
adenine nucleotides diphosphates on human monocyte-derived dendritic cells. J.
Leukoc. Biol. 76: 796–803.
16. Schnurr, M., T. Toy, A. Shin, M. Wagner, J. Cebon, and E. Maraskovsky. 2005.
Extracellular nucleotide signaling by P2 receptors inhibits IL-12 and enhances
IL-23 expression in human dendritic cells: a novel role for the cAMP pathway.
Blood 105: 1582–1589.
17. Andre, P., S. M. Delaney, T. LaRocca, D. Vincent, F. DeGuzman, M. Jurek,
B. Koller, D. R. Phillips, and P. B. Conley. 2003. P2Y12 regulates platelet
adhesion/activation, thrombus growth, and thrombus stability in injured arteries.
J. Clin. Invest. 112: 398–406.
18. Pasare, C., and R. Medzhitov. 2003. Toll pathway-dependent blockade of CD4
+CD25+ T cell-mediated suppression by dendritic cells. Science 299: 1033–
1036.
19. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu,
and R. M. Steinman. 1992. Generation of large numbers of dendritic cells from
mouse bone marrow cultures supplemented with granulocyte/macrophage
colony-stimulating factor. J. Exp. Med. 176: 1693–1702.
20. Marteau, F., E. Le Poul, D. Communi, D. Communi, C. Labouret, P. Savi,
J. M. Boeynaems, and N. S. Gonzalez. 2003. Pharmacological characterization
of the human P2Y13 receptor. Mol. Pharmacol. 64: 104–112.
21. Norbury, C. C. 2006. Drinking a lot is good for dendritic cells. Immunology 117:
443–451.
22. West, M. A., M. S. Bretscher, and C. Watts. 1989. Distinct endocytotic pathways
in epidermal growth factor-stimulated human carcinoma A431 cells. J. Cell Biol.
109: 2731–2739.
23. Falcone, S., E. Cocucci, P. Podini, T. Kirchhausen, E. Clementi, and
J. Meldolesi. 2006. Macropinocytosis: regulated coordination of endocytic and
exocytic membrane traffic events. J. Cell Sci. 119: 4758–4769.
24. Burgdorf, S., A. Kautz, V. Böhnert, P. A. Knolle, and C. Kurts. 2007. Distinct
pathways of antigen uptake and intracellular routing in CD4 and CD8 T cell
activation. Science 316: 612–616.
25. Hollopeter, G., H. M. Jantzen, D. Vincent, G. Li, L. England, V. Ramakrishnan,
R. B. Yang, P. Nurden, A. Nurden, D. Julius, and P. B. Conley. 2001. Identification of the platelet ADP receptor targeted by antithrombotic drugs. Nature
409: 202–207.
26. Haynes, S. E., G. Hollopeter, G. Yang, D. Kurpius, M. E. Dailey, W. B. Gan, and
D. Julius. 2006. The P2Y12 receptor regulates microglial activation by extracellular nucleotides. Nat. Neurosci. 9: 1512–1519.
27. Honda, S., Y. Sasaki, K. Ohsawa, Y. Imai, Y. Nakamura, K. Inoue, and
S. Kohsaka. 2001. Extracellular ATP or ADP induce chemotaxis of cultured
microglia through Gi/o-coupled P2Y receptors. J. Neurosci. 21: 1975–1982.
28. Granstein, R. D., W. Ding, J. Huang, A. Holzer, R. L. Gallo, A. Di Nardo, and
J. A. Wagner. 2005. Augmentation of cutaneous immune responses by ATP gamma
S: purinergic agonists define a novel class of immunologic adjuvants. J. Immunol.
174: 7725–7731.
29. Wang, L., S. E. Jacobsen, A. Bengtsson, and D. Erlinge. 2004. P2 receptor
mRNA expression profiles in human lymphocytes, monocytes and CD34+ stem
and progenitor cells. BMC Immunol. 5: 16.
30. Yanagawa, Y., and K. Onoé. 2003. CCR7 ligands induce rapid endocytosis in
mature dendritic cells with concomitant up-regulation of Cdc42 and Rac activities. Blood 101: 4923–4929.
31. Angiolillo, D. J., A. Fernandez-Ortiz, E. Bernardo, C. Ramı́rez, M. Sabaté,
P. Jimenez-Quevedo, R. Hernández, R. Moreno, J. Escaned, F. Alfonso, et al.
2006. Clopidogrel withdrawal is associated with proinflammatory and prothrom-
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Treatment with clopidogrel, a selective P2Y12 antagonist, is
associated with a marked reduction of inflammatory biomarkers
(31–35). However, this anti-inflammatory action is likely to be an
indirect effect involving inhibition of platelets that are known to
play a key role in vascular inflammation through the expression
and release of several proinflammatory mediators (CD40L and
P-selectin) (36–38). But our results suggest that the P2Y12 receptor also may directly modulate the immune responses by stimulating Ag endocytosis and presentation by DCs. Because platelets
also can enhance Ag presentation, improve CD8+ T cell responses,
and play a critical function in normal T-dependent humoral immunity (39), the relative contributions of platelet and DC P2Y12
receptor in the control of immune responses remain to be clarified. Indeed, Paruchuri et al. (40) recently reported that leukotriene
E4-induced pulmonary inflammation in OVA-sensitized mice
was abolished by clopidogrel and in P2Y122/2 mice, but this was explained entirely by decreased platelet activation, because platelet
depletion produced the same effect.
Previous studies have shown that extracellular nucleotides may
behave as immunization adjuvants. Granstein et al. (28) showed
that intradermal ATPgS enhanced contact hypersensitivity and the
response to a tumor vaccine via the induction of I-A, CD80, CD86,
IL-1b, and IL-12 and stimulation of the Ag-presenting function of
Langerhans cells. Furthermore, Idzko et al. (41) showed that ATP
enhances in vivo the Th2 sensitization to inhaled Ag in a model
of experimentally induced asthma. The adjuvant effects of ATP
were attributed to the recruitment and activation of lung myeloid
DCs that induced Th2 responses in the mediastinal nodes. In both
reports, the receptor mediating the effects of ATP was not identified.
One cannot exclude the possibility that at least part of these effects is due to the hydrolysis of ATP into ADP and the activation of
the P2Y12 receptor. This is supported by our observation that after s.c. injection of an emulsion of OVA in IFA the serum level
of IgG1 was decreased significantly in P2Y122/2 mice.
In conclusion, the current study demonstrates that the P2Y12
receptor is expressed on DCs and stimulates their endocytotic
activity and Ag-presenting function.
5905
5906
32.
33.
34.
35.
botic effects in patients with diabetes and coronary artery disease. Diabetes 55:
780–784.
Chew, D. P., D. L. Bhatt, M. A. Robbins, D. Mukherjee, M. Roffi, J. P. Schneider,
E. J. Topol, and S. G. Ellis. 2001. Effect of clopidogrel added to aspirin before
percutaneous coronary intervention on the risk associated with C-reactive protein. Am. J. Cardiol. 88: 672–674.
Dunzendorfer, S., C. M. Reinisch, N. C. Kaneider, Ch. Pechlaner, and
Ch. J. Wiedermann. 2002. Inhibition of plasma-dependent monocyte chemokinesis and cytokine-triggered endothelial activation for neutrophil transmigration
by administration of clopidogrel in man. Acta Med. Austriaca 29: 100–106.
Quinn, M. J., D. L. Bhatt, F. Zidar, D. Vivekananthan, D. P. Chew, S. G. Ellis,
E. Plow, and E. J. Topol. 2004. Effect of clopidogrel pretreatment on inflammatory marker expression in patients undergoing percutaneous coronary
intervention. Am. J. Cardiol. 93: 679–684.
Vivekananthan, D. P., D. L. Bhatt, D. P. Chew, F. J. Zidar, A. W. Chan,
D. J. Moliterno, S. G. Ellis, and E. J. Topol. 2004. Effect of clopidogrel pretreatment on periprocedural rise in C-reactive protein after percutaneous coronary intervention. Am. J. Cardiol. 94: 358–360.
REGULATION OF DC FUNCTION BY ADP
36. Hermann, A., B. H. Rauch, M. Braun, K. Schrör, and A. A. Weber. 2001. Platelet
CD40 ligand (CD40L)—subcellular localization, regulation of expression, and
inhibition by clopidogrel. Platelets 12: 74–82.
37. Klinkhardt, U., J. Graff, and S. Harder. 2002. Clopidogrel, but not abciximab,
reduces platelet leukocyte conjugates and P-selectin expression in a human ex
vivo in vitro model. Clin. Pharmacol. Ther. 71: 176–185.
38. Steinhubl, S. R., J. J. Badimon, D. L. Bhatt, J. M. Herbert, and T. F. Lüscher.
2007. Clinical evidence for anti-inflammatory effects of antiplatelet therapy in
patients with atherothrombotic disease. Vasc. Med. 12: 113–122.
39. Elzey, B. D., D. L. Sprague, and T. L. Ratliff. 2005. The emerging role of
platelets in adaptive immunity. Cell. Immunol. 238: 1–9.
40. Paruchuri, S., H. Tashimo, C. Feng, A. Maekawa, W. Xing, Y. Jiang, Y. Kanaoka,
P. Conley, and J. A. Boyce. 2009. Leukotriene E4-induced pulmonary inflammation is mediated by the P2Y12 receptor. J. Exp. Med. 206: 2543–2555.
41. Idzko, M., H. Hammad, M. van Nimwegen, M. Kool, M. A. Willart, F. Muskens,
H. C. Hoogsteden, W. Luttmann, D. Ferrari, F. Di Virgilio, et al. 2007. Extracellular ATP triggers and maintains asthmatic airway inflammation by activating
dendritic cells. Nat. Med. 13: 913–919.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017