Journal
of General Virology (2001), 82, 397–408. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
The C-terminal residues of poliovirus proteinase 2Apro are
critical for viral RNA replication but not for cis- or transproteolytic cleavage
Xiaoyu Li,1 Hui-Hua Lu,2 Steffen Mueller1 and Eckard Wimmer1
1
Department of Molecular Genetics and Microbiology, School of Medicine, State University of New York at Stony Brook, Stony Brook,
NY 11794, USA
2
Biochemistry and Molecular Biology, Chiron Corporation, Emeryville, CA 94608, USA
Poliovirus proteinase 2Apro is an essential enzyme involved in cleavages of viral and cellular
proteins during the infectious cycle. Evidence has been obtained that 2Apro is also involved in
genome replication. All enteroviruses have a negatively charged cluster of amino acids at their C
terminus (EE/DE/DAMEQ–NH2), a common motif suggesting function. When aligned with enterovirus
sequences, the 2Apro proteinase of human rhinovirus type 2 (HRV2) has a shorter C terminus
(EE…Q–NH2) and, indeed, the HRV2 2Apro cannot substitute for poliovirus 2Apro to yield a viable
chimeric virus. Here evidence is provided that the C-terminal cluster of amino acids plays an
unknown role in poliovirus genome replication. Deletion of the EEAME sequence from poliovirus
2Apro is lethal without significantly influencing proteinase function. On the other hand, addition of
EAME to HRV2 2Apro, yielding a C terminus of this enzyme of EEEAMEQ, stimulated RNA replication
of a poliovirus/HRV2 chimera 100-fold. The novel role of the C-terminal sequence motif is
manifested at the level of protein function, since silent mutations in its coding region had no effect
on virus proliferation. Poliovirus type 1 Mahoney 2Apro could be provided in trans to rescue the
lethal deletion EEAME in the poliovirus variant. Encapsidation studies left open the question of
whether the C terminus of poliovirus 2Apro is involved in particle formation. It is concluded that the
C terminus of poliovirus 2Apro is an essential domain for viral RNA replication but is not essential for
proteolytic processing.
Introduction
Poliovirus is a prototype of the Picornaviridae, a family of
small, non-enveloped plus-stranded RNA viruses. The Picornaviridae have been divided into nine genera as the number of
previously recognized genera, Enterovirus, Rhinovirus, Hepatovirus, Parechovirus, Cardiovirus and Aphthovirus, has recently
been extended by the three new genera Erbovirus, Kobuvirus
and Teschovirus (Rueckert, 1996 ; Pringle, 1999). A list of
species and their serotypes can be found on the Picornavirus
Sequence Database at http :\\www.iah.bbsrc.ac.uk\virus\
picornavaviridae\sequencedatabase\index.html. The genus
Enterovirus consists of poliovirus, coxsackie A viruses, coxsackie B viruses, echoviruses and a number of non-classified
enteroviruses. The genus Rhinovirus is divided into major and
minor receptor group rhinoviruses and contains more than 100
Author for correspondence : Eckard Wimmer.
Fax j1 631 632 8891. e-mail ewimmer!ms.cc.sunysb.edu
0001-7331 # 2001 SGM
serotypes. The enteroviruses and rhinoviruses share great
similarity in virion structure, gene organization and many
aspects of their replication cycle, in spite of differences in tissue
tropism and disease syndromes (Agol et al., 1999 ; Gromeier et
al., 1999 ; Pfister et al., 1999).
The enterovirus and rhinovirus genomes are about 7500
nucleotides long, with a small viral protein (VPg) and a poly(A)
tail present at their 5h and 3h termini, respectively (Kitamura et
al., 1980, 1981 ; Lee et al., 1977 ; Skern et al., 1985). Both
enterovirus and rhinovirus genomes encode a single large
polyprotein from which the viral structural proteins, expressed
as precursor P1, and non-structural proteins, as expressed as P2
and P3, are derived by proteolytic processing (Fig. 1 b). The
processing steps are catalysed by the virus-encoded proteinases 2Apro, 3Cpro and 3CDpro. The 2Apro proteinases are
encoded immediately downstream of the P1 precursor in
enterovirus and rhinovirus genomes. This proteinase cleaves
the P1–P2 junction in cis and cellular proteins in trans. The ciscleavage activity of the enterovirus and rhinovirus 2Apro
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
DJH
X. Li and others
(a)
(b)
Fig. 1. Genomic organization and sequences of poliovirus and derivatives. (a) Amino acid alignments of poliovirus 2Apro and
HRV2 2Apro. Identical residues are in white lettering on black. Missing amino acids are indicated by dots. Amino acid positions
are given at the end of each line. This alignment is in accordance with that of Palmenberg (1989). (b) Genotypes of the wildtype and chimeric full-length and replicon poliovirus genomic RNAs, containing different C-terminal domains of PV1(M) and
HRV2 2Apro sequences. Non-initiating AUGs are denoted by stars. P1 is the precursor of the structural proteins ; P2 and P3 are
the precursors of the non-structural proteins. 1A, 1B, 1C and 1D represent capsid proteins VP4, VP2, VP3 and VP1. In the
chimeric PV1(M) replicon genomes, the P1 region was replaced by the luciferase gene (shaded) and the sequence of the Cterminal domain of 2Apro was varied as indicated. The modified C-terminal domains of PV1(M) and HRV2 2Apro are enlarged.
PV1(M) 2Apro and HRV2 2Apro are depicted as open and filled boxes, respectively. In the Cm4 construct, the wobble positions
of the P1–P5 residues of poliovirus 2Apro were mutated. C-5 is a deletion of the P2–P6 positions of PV1(M) 2Apro. R2A Cj4
means that P2–P5 of PV1(M) 2Apro were added to the C-terminal region of HRV2 2Apro. P2A and R2A represent the wild-type
2Apro sequences of PV1(M) and HRV2, respectively. The alanine residues marked with asterisks (*) indicate the P4 position
favourable for 3Cpro/3CDpro cleavage relative to the Q–G scissile bond. Underlined regions show mutation sites. Black dots
indicate missing amino acids relative to the PV1(M) wild-type sequence.
DJI
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
Genetic study of poliovirus
proteinases releases the P1 precursor from the non-structural
P2–P3 precursors (Sommergruber et al., 1989 ; Toyoda et al.,
1986). The trans-cleavage activity of enterovirus and rhinovirus 2Apro processes cellular factors, including eukaryotic
initiation factor eIF-4G (eIF-4γ or p220) (Kra$ usslich et al.,
1987 ; Lamphear et al., 1993), TATA-binding protein
(Yalamanchili et al., 1997), poly(A)-binding protein (PABP)
(Joachims et al., 1999 ; Kerekatte et al., 1999), dystrophin
(Badorff et al., 1999) and the viral protein 3CDpro (Lee &
Wimmer, 1988). With the exception of eIF-4G, the effects of
the 2Apro trans-cleavage activity on cellular proteins are not
clear. Cleavage of eIF-4G, and possible also of PABP,
contributes to the shut-off of host cell protein synthesis
(Joachims et al., 1999 ; Kra$ usslich et al., 1987). Translation is
thus switched from cap-dependent cellular translation to capindependent viral translation. Shut-off of host cell protein
synthesis can also result in a process of programmed cell death
(Barco et al., 2000 ; Goldstaub et al., 2000). The precise function
of 2Apro in the cleavage of eIF-4G is presently debated.
Proteinase 2Apro is definitely responsible for the direct
cleavage of cellular proteins (Haghighat et al., 1996 ; Lamphear
et al., 1993 ; Liebig et al., 1993), but evidence for activation of
cellular activities has also been presented in eIF-4G processing
(Bovee et al., 1998 a, b). The cleavage of dystrophin of mouse
heart muscle cells by coxsackievirus B3 2Apro has been
suggested to be the mechanism of dilated cardiomyopathy
(Wessely et al., 1998). The 2Apro cleavage products of 3CDpro
(3Ch and 3Dh) are not essential for poliovirus replication (Lee &
Wimmer, 1988).
The crystal structure of human rhinovirus type 2 (HRV2)
2Apro has recently been elucidated and it revealed a unique
fold that comprises a four-stranded β-sheet at the N-terminal
domain and a six-stranded β-barrel containing a Zn#+ ion at the
C-terminal domain (Petersen et al., 1999). Site-directed mutagenesis studies on some conserved residues of poliovirus
2Apro indicate that the substrate-binding domains are different
for cis- and trans-cleavage activities (Ventoso & Carrasco,
1995 ; Yu et al., 1995). Both the poliovirus and rhinovirus
2Apro-encoding sequences have been expressed in yeast,
which does not result in cleavage of the yeast homologue of
eIF-4G. However, poliovirus 2Apro shuts off yeast cell RNA
synthesis by the cleavage of a host transcription factor (Barco
& Carrasco, 1995 ; Klump et al., 1996), a process distinct from
the effect of poliovirus 2Apro in mammalian cells (Ventoso et
al., 1998). Screening for peptide inhibitors of poliovirus 2Apro
by the yeast two-hybrid system revealed a small peptide that
inhibits poliovirus 2Apro cleavage activity (Ventoso et al.,
1999).
Genetic data suggest that 2Apro is an important component
for poliovirus RNA replication, but the function remains
elusive (Ansardi et al., 1995 ; Molla et al., 1992, 1993 b ; O’Neill
& Racaniello, 1989 ; Yu et al., 1995). Although not endowed
with strong hydrophobic sequences, poliovirus 2Apro was
found in the detergent-insoluble membranes (Martin-Belmonte
et al., 2000). Not surprisingly, the 2A proteins of hepatitis A
virus and Theiler’s murine encephalomyelitis virus do not seem
to be required for virus RNA replication (Harmon et al.,
1995 ; Michiels et al., 1997), since these viral polypeptides bear
no similarity to the entero- and rhinovirus 2Apro enzymes
(Gromeier et al., 1999).
In our previous study, we have demonstrated that mutations at the P position of coxsackievirus B4 (CBV4) 2Apro
&
promoted viral RNA replication of a chimeric poliovirus in
which the cognate poliovirus 2Apro sequence was exchanged
for that of CBV4. Chimeric poliovirus genomes with an HRV2
2Apro-encoding sequence did not produce viable virus, but
showed both a low level of viral RNA replication (detected by
RT–PCR) and minor alternations in processing of P2 proteins
(Lu et al., 1995 b). Amino acid alignments show that the C
terminus of the HRV2 2Apro lacks four amino acids compared
with the C terminus of 2Apro from poliovirus type 1 Mahoney
[PV1(M)] (Fig. 1 a). These four amino acids (EAME) correspond
to an acidic domain preserved among enterovirus 2Apro
polypeptides. In this paper, we have used site-directed
mutagenesis to show that the conserved C terminus of PV1(M)
2Apro plays an important role in viral RNA replication.
Methods
Cells, viruses and plasmids. HeLa R19 monolayers were
maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5 % bovine calf serum (BCS) at 37 mC. OST7-1 is a mouse
fibroblast cell line that expresses T7 RNA polymerase in the cytoplasm.
OST7-1 cells were maintained in DMEM with 10 % foetal bovine serum
and G418 (Elroy-Stein & Moss, 1990). VV-P1 is a recombinant vaccinia
virus containing poliovirus P1-encoding sequences, which was kindly
provided to us by C. D. Morrow (Ansardi et al., 1991). pT7HRV2 is a fulllength cDNA clone of HRV2, which was kindly provided to us by E.
Kuechler and T. Skern (Skern et al., 1985). pT7PVM is a derivative of
pT7XL, a full-length cDNA clone of PV1(M) (van der Werf et al., 1986).
The plasmid pGL2 (containing the luciferase gene) was purchased from
Promega. The plasmid pBS E2A contains the encephalomyocarditis virus
(EMCV) IRES sequence followed by the poliovirus 2Apro-encoding
sequences (Molla et al., 1993 a). pBS E2A(CH) is the same plasmid with
H20A and C109A mutations in the poliovirus 2Apro-encoding sequence
(Molla et al., 1993 a). pBS was purchased from Stratagene for construction
of pBS E2A and pBS E2A(CH) plasmids.
Oligonucleotides. The following oligonucleotide primers were
used in this study : 5101 (5h CGGAGACGCCAAAAA 3h), 5120 (5h
CTGAGCTCCAATTTGGACTTTCCGCC 3h), L2 (5h CCAAGGAGCTCACCAC 3h), 17 (5h GAGGCCTTGTTCGTAGGCATACAAGTC 3h),
25 (5h GAGGCCCTGCTCCATTGCCTCTTCTTCGTAGGCATACAAGTC 3h), 4578 (5h GCGGAGCTCACTACAGCTGGCCCC 3h) and
5040 (5h GGAGGCCTTGTTCCATGGCTTCTTCTTCAGCACAAT
3h).
DNA manipulations. Escherichia coli strain DH5α was used for
plasmid transformation and propagation. DNA cloning was accomplished
by standard procedures (Sambrook et al., 1989). Cloning enzymes and
reagents were purchased from New England Biolabs or Boehringer
Mannheim. pT7PVM(S+E−) is a full-length poliovirus cDNA clone that
contains two engineered restriction sites (EcoRI and SacI) downstream of
an authentic AUG codon (Mueller & Wimmer, 1998). pT7S\2A\S is a
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
DJJ
X. Li and others
full-length poliovirus cDNA clone with a SacI site at the junction of the
P1- and 2A-encoding sequences (Lu et al., 1995 b). pT7PVM(S+E−) and
pT7S\2A\S were digested by NheI and BglI and ligated to yield the
cDNA plasmid pT7S+E−S\2A\S. PCR-amplified luciferase-encoding
sequences (primers 5101 and 5120) were used to replace the P1 region
between the EcoRI and SacI sites of pT7S+E−S\2A\S to generate a
PV1(M) replicon plasmid PVM\Luc. The different 2Apro-encoding
sequences were amplified by PCR and cloned into the SacI and StuI sites
of the PVM\Luc plasmid. New chimeric poliovirus replicon clones
contained wild-type HRV2 2Apro sequences (PVM\Luc R2A), the
truncated C-terminal five amino acids (P –P ) of PV1(M) 2Apro (PVM\Luc
# '
C-5) (primers L2 and 17) and HRV2 2Apro with four amino acids (P –P )
# &
from the C terminus of PV1(M) 2Apro (PVM\Luc R2A Cj4) (primers
4578 and 5040). To determine whether the C-terminal sequences of 2Apro
act at the level of RNA or protein, mutations (P –P ) were made at every
" %
wobble position, generating silent mutations (PVM\Luc Cm4) (primers
L2 and 25). At the same time, the various modified 2Apro sequences were
introduced into full-length pT7S\2A\S cDNA clones. The new chimeric
PV1(M) full-length clones were named PVM Cm4, PVM C-5 and PVM
R2A Cj4. PVM R2A is identical to PV\HRV2-2A (Lu et al., 1995 b).
The details of the C-terminal modifications are shown in Fig. 1 (b).
and the cells were cultured in 2 ml DMEM–2 % BCS at 37 mC (Sambrook
et al., 1989). HeLa cell monolayers were harvested at different timepoints.
In vitro transcription, translation and Western blotting. In
order to produce the RNA transcripts in vitro, 0n7 µg of each full-length
and replicon cDNA plasmid was linearized by PvuI downstream from the
viral genome (Alexander et al., 1994 ; Lu et al., 1995 a, b). RNA transcripts
were synthesized from the linear template DNA by use of T7 RNA
polymerase in 100 µl of an in vitro transcription reaction mixture. RNA
transcripts were purified by phenol–chloroform extraction and ethanol
precipitation. For each RNA transcript, the optimal RNA concentration
was determined for in vitro translation in HeLa cell extracts as described
by Molla et al. (1991). Translation reactions were carried out at 34 mC for
7 h in the presence of 10 µCi of [$&S]-translabel (Amersham). SDS–12n5 %
polyacrylamide gels were used to analyse the translation products
(Laemmli, 1970). The intensity of the VP3 band of each poliovirus fulllength RNA translation reaction was measured by using the Un-Scan It
program (Silk Scientific Company). Translation efficiency was calculated
as described previously (Lu et al., 1995 b). Briefly, the translation efficiency
of PVM R2A RNA was taken as 100 %. The translation efficiency of each
chimeric RNA was calculated from the relative intensity of the VP3 band
compared with the intensity of the VP3 band from PVM R2A RNA.
Western blotting was used to detect degradation products of eIF-4G.
Briefly, in vitro translation reactions were carried out in 62n5 µl of total
translation reactions for each full-length RNA transcript at 30 mC for
24 h. TCA precipitation (8 %) was used to reduce the sample volume. The
samples were analysed on 7n5 % SDS–PAGE and transferred overnight at
4 mC to a nitrocellulose membrane (Schleicher & Schuell). The nitrocellulose membrane was incubated at room temperature for 2 h with a
rabbit anti-eIF-4G primary antibody (Aldabe et al., 1995) and then
incubated at room temperature for an additional 2 h with HRP-conjugated
goat anti-rabbit antibodies (Cappel) as secondary antibodies. Degradation
products of eIF-4G were detected by ECL (Amersham) followed by
exposure of the membrane to Kodak X-ray film for 5 min.
Luciferase assay. After transfections of RNA or DNA containing
the luciferase gene, HeLa cell or mouse cell monolayers were harvested
by washing three times with PBS and resuspending the cell pellet in
100 µl PBS (Ausubel et al., 1994). The cells were lysed immediately by
freeze–thawing three times. Twenty µl of cell lysate was examined by
adding 100 µl luciferin to measure luciferase activity in a luminometer
(Promega). The protein concentration (125 µg) of each cell lysate was
determined by a Micro BCA protein assay (Pierce) as an internal control
to normalize the luciferase activities (Ventoso & Carrasco, 1995).
RNA transfections. To perform the RNA transfection, HeLa R19
cells cultured on a 35 mm plate were incubated with 5–10 µg of RNA
transcripts in the presence of 0n5 mg\ml DEAE–dextran in HeBSS buffer
(42 mM HEPES, 270 mM NaCl, 9n6 mM KCl and 1n4 mM Na HPO ) at
#
%
room temperature for 30 min. The transfection mixtures were removed
EAA
Trans-rescue assay. The trans-rescue assay was performed as
described previously (Hambidge & Sarnow, 1992). Briefly, the DNA
transfection was performed with calcium phosphate by incubating 1 µg
of the PV1(M) replicon cDNA plasmids and 10 µg of the pBS, pBS E2A
and pBS E2A(CH) cDNA plasmids on OST7-1 monolayers. Glycerol
shock was carried out at 6 h after addition of the DNA\calcium
phosphate precipitate. Transfected OST7-1 cells were incubated at 37 mC
with 5 % CO for another 12 h (Ausubel et al., 1994). The harvested
#
OST7-1 cells were resuspended in PBS for luciferase assays as described
below.
Encapsidation assay. Encapsidation assays were performed
according to Ansardi et al. (1991, 1993). The PV1(M) replicon RNA
transcripts were transfected into HeLa cell monolayers 2 h after VV-P1
infection. HeLa cell monolayers were cultured in 1n5 ml of DMEM–2 %
BCS at 37 mC for 24 h. HeLa cell lysates were obtained by freeze–thawing
three times. Aliquots of 250 µl of the cell lysates were inoculated onto
another set of fresh HeLa cell monolayers, which were harvested at 0, 2,
4, 6, 8 and 10 h post-infection. The cell lysates were analysed for
luciferase activity.
Plaque assays. Plaque assays on HeLa cell monolayers were
performed as described previously (Lu et al., 1995 b). The virus was
diluted in PBS and placed on the cells. The mixture was incubated for
30 min at room temperature to allow the virus to absorb to the cells and
then 3 ml of 1i DMEM plus 10 % calf serum (Gibco-BRL) plus 1 % agar
was added to each plate. After incubation for 2 days, the agar overlays
were removed and the cells were stained with crystal violet.
Results
In vivo phenotypes of PV1(M) and HRV2 2Apro
C-terminal domains
On the basis of the observed differences between the 2Apro
sequences of poliovirus and HRV2 in the C-terminal region
(Fig. 1 a), we have constructed four virus variants, of which two
are chimeras (Fig. 1 b). In P2A Cm4, only the nucleotide
sequence encoding the C terminus was changed (silent
mutation ; see below). In P2A C-5, five amino acids have been
deleted and an alanine residue in the P position of the cleavage
%
site (indicated by an asterisk) was retained to ensure efficient
cleavage by 3Cpro\3CDpro. The chimeric constructs contained
either wild-type HRV2 2Apro lacking the EAME motif (R2A)
or a derivative thereof, in which the EAME was added (R2A
Cj4). To determine the in vivo phenotype for the C-terminal
domains of the PV1(M) and HRV2 2Apro polypeptides, RNA
transcripts of full-length PV1(M) and its derivatives (PVM
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
Genetic study of poliovirus
(a)
(b)
(c)
Fig. 2. Cell-free translation and eIF-4G cleavage analysis. (a) In vitro translation of PV1(M) full-length RNA transcripts with or
without modified 2Apro sequences. The optimal RNA concentration for each translation was used as follows : PVM RNA
transcript (16 µg/ml) ; PVM Cm4 RNA transcript (16 µg/ml) ; PVM C-5 RNA transcript (48 µg/ml) ; PVM R2A Cj4 RNA
transcript (48 µg/ml) and PVM R2A RNA transcript (64 µg/ml). Relative translation efficiency for each RNA transcript was
calculated by measuring the intensity of the VP3 band as described in Methods and is given at the bottom of the
autoradiogram. Lane 1, PV1(M) proteins from an infected HeLa cell extract. (b) In vitro translation of PV1(M) replicon RNA
transcripts containing the luciferase gene. The optimal RNA concentration for each RNA transcript was used, as indicated above.
(c) Western blot analysis of degradation products of eIF-4G. PV1(M) full-length RNA transcripts were translated in HeLa cell
extract. Rabbit anti-eIF-4G antibodies and goat anti-rabbit antibodies were used to detect eIF-4G-related products (see
Methods).
Cm4, PVM C-5, PVM R2A Cj4, PVM R2A) were transfected
into HeLa cell monolayers and the plates were incubated at
37 mC for 2 days. The cell lysates were harvested and plaque
assays were performed. PV1(M) and PV1(M) Cm4 constructs
produced progeny virus at 2n4i10) and 2n1i10) p.f.u.\ml,
respectively. No virus was detected from transfections with
PV1(M) C-5, PV1(M) R2A Cj4 or PV1(M) R2A RNA
transcripts, even after prolonged incubation and serial passages
of these cell lysates.
Translation efficiencies and proteolytic activities of
viral RNAs with modifications in the 2Apro C-terminal
domain
To investigate the pronounced effect of the C-terminal
domain of 2Apro on virus proliferation, we have analysed the
modified viral genomes by several methods. Firstly, we
determined the efficiency with which the RNA could direct
faithful protein synthesis. Translation of the RNAs was
performed in HeLa cell extracts (Molla et al., 1991). Chimeric
PV1(M) full-length RNA transcripts with modified 2Apro C
termini translated nearly as well as those of wild-type 2Apro
(Fig. 2 a ; lanes 4–8). This was determined by measuring the
VP3 intensity and calculating the translation efficiency for each
translation reaction as described in Methods. The translation
efficiency of each chimeric PV1(M) RNA is given at the bottom
of Fig. 2 (a). With PVM Cm4, neither the relative mobility of
2Apro nor the translation efficiency was altered, as expected
(Fig. 2 a ; lanes 4 and 5). PVM C-5 RNA transcripts, in which
five amino acids had been deleted, translated as well as PV1(M)
and PVM Cm4 RNA transcripts (Fig. 2 a ; compare lanes 4 and
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
EAB
X. Li and others
The function of the C-terminal domain of PV1(M) 2Apro
in viral RNA replication
It has been reported that the addition of a foreign gene
(Alexander et al., 1994) or the replacement of the poliovirus P1
region by a reporter gene does not affect poliovirus replication,
including viral protein processing, RNA synthesis or encapsidation in trans (Porter et al., 1998 ; for references see Mueller &
Wimmer, 2000). Our previous results showed that a chimeric
PV1(M) genome with HRV2 2Apro did not produce virus but
suggested very low levels of viral RNA replication (Lu et al.,
1995 b). Since the pattern of protein synthesis and proteolysis
in vitro showed production of all proteins involved in RNA
synthesis, we decided to investigate whether the 2Apro C
termini have a function in RNA replication. To monitor
EAC
(a)
Luciferase activity
(light units/125 lg protein)
106
PVM/Luc
PVM/Luc Cm4
PVM/Luc C-5
PVM/Luc R2A C+4
PVM/Luc R2A
105
104
103
102
0
4
8
12
16
20
24
28
Time post-transfection (h)
(b)
105
Luciferase activity
(light units/125 lg protein)
5 with lane 6). The relative mobility of 2Apro in PVM C-5
increased, however (lane 6). On the other hand, addition of
four amino acids to HR2 2Apro (PVM R2A Cj4) decreased
the relative mobility of HRV2 2Apro and the protein migrated
to the same position as PV1(M) 2Apro (lane 7). The translation
efficiency of PVM R2A Cj4, however, was reduced slightly
(Fig. 2 a, lane 4 and 7). The cleavage patterns seen in lanes 6, 7
and 8 clearly reveal a few aberrant cleavage products in
addition to all the major viral polypeptides.
To examine the cis-cleavage activity of PV1(M) and HRV2
2Apro proteinases in chimeric PV1(M) replicon genomes,
PV1(M) replicon RNA transcripts in which the capsid precursor
P1 was replaced by luciferase were translated in HeLa cell
extracts. No P1 precursors or processed coat proteins were
observed in these translations (Fig. 2 b ; lanes 4–8), as expected.
Bands corresponding to the luciferase protein and nonstructural proteins were found to be present, however (Fig. 2 b ;
lanes 4–8). The migration positions of each modified 2Apro in
PV1(M) replicon genomes were altered, as has been seen in
Fig. 2 (a) with PV1(M) full-length genomes. These results
suggest strongly that substitution of the P1 region with the
luciferase gene and modifications of PV1(M) and HRV2 2Apro
C-terminal domains did not affect the cis-cleavage activity of
PV1(M) and HRV2 2Apro significantly, if at all, in the chimeric
PV1(M) replicon genomes. This result is in agreement with our
previous observation that 2Apro cis-cleavage is not affected by
variations of P residues (Hellen et al., 1992).
"
The endogenous cellular protein eIF-4G was used to
examine the trans-cleavage activity of PV1(M) and HRV2
2Apro proteinases with modified C termini by Western
blotting. Intact eIF-4G protein is shown in the no-RNA control
(Fig. 2 c ; lane 1). Completely degraded eIF-4G products were
detected in all translation reactions (Fig. 2 c ; lanes 2–6). No
differences in eIF-4G cleavage were observed between the
wild-type 2Apro (Fig. 2 c ; lanes 2 and 6) and modified 2Apro
(Fig. 2 c ; lanes 3–5). Thus, the C-terminal modifications did not
affect the proteolytic activity in trans of PV1(M) and HRV2
2Apro proteinases.
PVM/Luc
PVM/Luc Cm4
PVM/Luc C-5
PVM/Luc R2A C+4
PVM/Luc R2A
104
103
102
0
4
8
12
16
20
24
28
Time post-transfection (h)
Fig. 3. Replication of different viral RNA constructs in HeLa cells. (a)
Transfections of chimeric PV1(M) replicon RNAs. HeLa cell monolayers
were transfected with 5 µg of each replicon RNA. Cell lysates were
collected at 0, 4, 8, 12 and 24 h post-transfection and the luciferase
activity for each cell lysate was determined. Aliquots of 125 µg total
protein from each cell lysate were used as internal controls to normalize
luciferase activity. (b) Separation of 2Apro functions. The transfection
experiments were repeated as above, but in the presence of 2 mM
guanidine–HCl.
replication, we constructed PV1(M) replicon genomes containing the luciferase gene. After transfection into HeLa cells,
the luciferase activity was measured. The transfected HeLa cell
monolayers were incubated at 37 mC and cells were lysed at
0, 4, 8, 12 and 24 h post-transfection. Luciferase activity
generated by PVM\Luc and PVM\Luc Cm4 RNA transcripts
was detected at 4 h and it reached a peak at 8 h posttransfection (Fig. 3 a ; open squares). At this time-point, the
luciferase activity produced by PVM\Luc R2A was nearly
1000-fold lower than that of PVM\Luc, while a detectable
signal emerged only 12 h post-transfection (closed circles).
Remarkably, addition of the four amino acids to the C terminus
of HRV2 2Apro in PVM\Luc R2A Cj4 genomes increased
the expression and led to a signal at 8 h post-transfection that
was about 100-fold greater than that of PVM\Luc R2A (open
circles) (Fig. 3 a) and only 10-fold lower than that of PVM\Luc.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
Genetic study of poliovirus
107
B
C
D
E
F
106
105
104
P/
7.
3.
G–
102
6
L+ . P/
G– L+
H p
8
9. . P Cl+pBS
P/ /L BS
L+ +E
E2 2A
AC
H
11.
P/ 10.
L C P/
m4 L C
13 12. +G– m4+
. P P/ HC pB
/L L C l+ S
Cm m4 pBS
4+ +E
E2 2A
AC
H
15
. P 14
/L . P
C– /L
5+ C
17 16. G–H–5+p
. P P/ C B
/L L C l+p S
C– –5 BS
5+ +E
E2 2A
AC
H
19
. P 18
/L . P
C+ /L
4+ C
21 20. G–H+4+p
. P P/
/L L C Cl+pBS
C+ +4 BS
4+ +E
E2 2A
AC
H
23
. P 22
/L . P
R2 /L
A R
25 24. +G–H2A+
. P P/
p
/L L R Cl+ BS
R2 2A pBS
A+ +E
E2 2A
AC
H
103
1.
M
2 ock
HC . pB
l+p S
5. 4. E BS
E2 2A
AC
H
Luciferase activity (light units/125 lg protein)
A
Fig. 4. Trans-rescue assay of PV1(M) replicons with wild-type and mutated 2A sequences. P/L, PVM/Luc. E2A is plasmid pBS
E2A expressing poliovirus 2Apro under the control of the EMCV IRES and E2A CH is the same plasmid except that two essential
amino acids of the catalytic triad of 2Apro have been mutated (H20A and C109A in pBS E2A CH). pBS is a control plasmid.
Guanidine–HCl (G–HCl) was added at the onset of transfection to a concentration of 2 mM.
The luciferase activity of PVM R2A Cj4 reached its peak at
12 h post-transfection. No luciferase activity above background could be detected with PVM\Luc C-5 RNA.
Expression of luciferase in these transfected cells could
conceivably result solely from translation of the incoming
RNAs, independent of viral RNA replication. To separate
translation from viral RNA replication, the experiments were
repeated in the presence of 2 mM guanidine–HCl, an inhibitor
of poliovirus RNA replication, but not of luciferase activity
(Alexander et al., 1994). No luciferase activity was detected
above the background level in cell lysates transfected with
these RNA transcripts over a period of 24 h. This observation
suggests strongly that the phenotypes of luciferase activity
result from altered viral RNA replication and not from
differences in viral RNA translation (Fig. 3 b).
Trans-rescue of the C-terminally modified 2Apro with
wild-type and mutated poliovirus 2Apro
In order to test whether the C-terminal functions of 2Apro
could be rescued in trans, we pursued a trans-rescue assay in a
mouse fibroblast cell line, OST7-1, that expresses phage T7
RNA polymerase in the cytoplasm. T7 RNA polymerase can
be used to transcribe RNA from transfected cDNA plasmids
containing the T7 promoter. Since transcription in all of our
cDNA plasmids is driven by the T7 promoter (van der Werf et
al., 1986), we were able to co-transfect PV1(M) replicon cDNA
plasmids, together with expression plasmids for PV1(M) 2Apro
cDNA [pBS E2A or pBS E2A(CH)], into OST7-1 cells and assay
for complementation by monitoring luciferase activity. Results
of such co-transfection experiments are shown in Fig. 4.
Transfection with vectors containing no luciferase gene gave
background signals (Fig. 4 ; group A, bars 2–5). Co-transfection
of different poliovirus-expression vectors is presented in
groups as follows : (B) wild-type PVM\Luc, (C) PVM\Luc
Cm4 ; (D) PVM\Luc C-5 ; (E) PVM R2A Cj4 and (F)
PVM\Luc R2A, involving either pBS or 2A-expressing
plasmids, as indicated. If guanidine–HCl was omitted at the
beginning of co-transfection, all plasmids, with the exception
of PVM\Luc C-5 (Fig. 4 ; group D, bar 14), yielded strong
luciferase signals (bars 6, 10, 18 and 22), which can be assumed
to be the result of mRNA production by transcription and
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
EAD
X. Li and others
Luciferase activity
(light units/125 lg protein)
106
PVM/Luc
PVM/Luc Cm4
PVM/Luc C-5
PVM/Luc R2A C+4
PVM/Luc R2A
105
104
103
0
2
4
6
8
10
12
Time post-infection (h)
Fig. 5. Encapsidation assay of PV1(M) replicon RNA transcripts. The
chimeric PV1(M) replicon RNA transcripts were transfected into HeLa cells
after infection with VV-P1. Cell lysates were lysed after overnight
incubation at 37 mC. Fresh HeLa cell monolayers were infected with equal
amounts of the cell lysates and collected at different time-points. The
luciferase activity of each cell lysate was analysed by standard methods.
replication. This is supported by the observation that
guanidine–HCl reduced the signal obtained in these cells to the
level of PVM\Luc C-5 (compare bars 7, 11, 19 and 23 with bar
15). Co-transfection with a plasmid expressing 2Apro under the
control of the EMCV IRES stimulated the luciferase signal (see
bars 8, 12, 16, 20 and 24), although the increase was barely
detectable in group F (bar 24). However, the 12n7-fold increase
(bar 16) is highly significant and required expression of active
proteinase, since expression of inactive proteinase had no
effect on the luciferase signal (bars 9, 13, 17, 21 and 25).
Is the C-terminal domain of PV1(M) 2Apro involved in
virus encapsidation ?
The P1 regions of PV1(M) and HRV2 encode the P1
precursors, which are processed by viral proteinases (2Apro
and 3CDpro) into capsid proteins VP0, VP3 and VP1 (Kitamura
et al., 1981 ; Wimmer et al., 1993) during ‘ maturation ’ of the
procapsid. An unknown mechanism induces VP0 cleavage and
produces VP2 and VP4. Sixty copies of each of these four
capsid proteins, VP1, VP2, VP3 and VP4, then form an
icosahedral virus particle (Wimmer et al., 1993). The encapsidation in poliovirus-infected cells is very specific in packaging
the viral genomic RNA only. It is assumed that the encapsidation signal is localized in the viral RNA genome. However,
available evidence suggests a strong coupling between RNA
replication and RNA encapsidation (Molla et al., 1991 ; Nugent
et al., 1999). If so, it may be possible to establish a correlation
between the replication of the poliovirus\HRV2 2A chimera
and encapsidation in trans. Accordingly, PV1(M) replicons and
VV-P1 vaccinia virus were used in our studies. In these transencapsidation studies, the poliovirus capsid precursor P1 is
provided by the vaccinia virus expression system (Porter et al.,
1998). The P1 precursor is then recruited and processed by
proteinase from heterologous replicating poliovirus genomes.
EAE
We assayed for trans encapsidation by analysing luciferase
activity after the second round of infection. The chimeric
PV1(M) genomes PVM\Luc, PVM\Luc Cm4 and PVM\Luc
R2A Cj4 could be packaged in trans by P1 precursors
provided by vaccinia virus expression, as indicated by the level
of luciferase activity in cell lysates. In contrast, PVM\Luc R2A
and PVM\Luc C-5 RNAs were not packaged, since no
luciferase activity higher than background was detected in
secondary infections (Fig. 5).
Discussion
Genetic data and amino acid alignments indicate that
PV1(M) and HRV2 2Apro belong to a group of small cysteine
proteinases (Bazan & Fletterick, 1988). These enzymes are
specified by a cysteine forming the catalytic triad together with
aspartate and histidine in both viral 2Apro proteinases (Hellen
et al., 1991 ; Petersen et al., 1999 ; Seipelt et al., 1999 ;
Sommergruber et al., 1989). HRV2 2Apro was found to contain
a Zn#+ ion (Sommergruber et al., 1994), the function of which
is to stabilize the structure of the protein (Petersen et al., 1999).
Although not proven for poliovirus 2Apro, this enzyme may
fold in a fashion similar to HRV2 2Apro and it may also contain
a Zn#+ ion. Genetic studies have demonstrated that PV1(M)
2Apro has multiple functions in virus proliferation (protein
processing, viral RNA replication, translation activation)
(Hambidge & Sarnow, 1992 ; Molla et al., 1993 b ; Toyoda et al.,
1986 ; Yu et al., 1995). It is not yet known whether the multiple
functions of 2Apro are due to independent functional domains
or to domains involved in proteolysis. There are no biochemical data available that indicate a direct role for 2Apro in
viral genome replication. Here, we report studies to dissect the
function of the C termini of PV1(M) and HRV2 2Apro in the
context of chimeric PV1(M) full-length and replicon genomes.
In our previous studies, we showed that 2Apro of CBV4,
another enterovirus, could replace the poliovirus 2Apro in a
chimera. However, mutations in the C terminus of CBV4 2Apro
were necessary to yield a chimera with wild-type replication
properties (Lu et al., 1995 b). These mutations all mapped to
precisely the region that is missing in HRV2 2Apro. Thus, we
both modified this region in poliovirus 2Apro and added four
amino acids to HRV2 2Apro to create an ‘ enterovirus-like ’
2Apro. In all constructs, the P1–P2 junction of the PV1(M)
polyprotein is LtTY*GfGh, where capital letters represent
residues conserved among polioviruses (Hellen et al., 1992) ;
ITTA*GPSD is the corresponding sequence in HRV2 (Skern et
al., 1991). To facilitate 3CDpro cleavage activity at the 2A–2B
junction, the P position for each C-terminal modification was
%
alanine, a residue greatly preferred by poliovirus 3CDpro
cleavage activity (Fig. 1 b) (Lawson & Semler, 1990).
To study the C-terminal functions of PV1(M) and HRV2
2Apro in terms of their proteolytic activities, the RNA
transcripts were translated in HeLa cell extracts. Even when
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
Genetic study of poliovirus
five amino acids (P –P ) were deleted at the C-terminal domain
# '
of PV1(M) 2Apro (PVM C-5), neither translation efficiency nor
the cis- and trans-cleavage activities was affected significantly
(Fig. 2 a, lanes 4 and 6 ; Fig. 2 c, lanes 2 and 4). Deletion of a
further nine amino acids at the C terminus of poliovirus 2Apro
abolished the cis-cleavage activity (Toyoda et al., 1986).
Insertions at the N and C termini also abolished cis-cleavage
activity of PV1(M) 2Apro (Bernstein et al., 1986 ; Kra$ usslich et
al., 1987). On the other hand, a C-terminal deletion of up to six
amino acids of HRV2 2Apro did not interfere with its ciscleavage activity, whereas a deletion of up to 10 amino acids
inactivated the enzyme (Sommergruber et al., 1989). Translation with chimeric PVM R2A Cj4 and PVM R2A genomes
showed that all expected proteins were produced by proteolytic processing (Fig. 2 a ; lanes 7 and 8). Importantly, none
of the 2A modifications at the C terminus impaired the
enzyme’s ability to cleave eIF-4G (Fig. 2 c ; lanes 5 and 6).
Whereas the C-terminal deletions caused little if any loss of
cleavage activity for either PV1(M) or HRV2 2Apro, severe
replication phenotypes were observed. We conclude that the
C-terminal domain up to amino acid 6 is not critical for
proteolytic activities of poliovirus 2Apro, but this conclusion is
based solely on in vitro translation assays. A correlation
between the structure and the function of poliovirus 2Apro
remains to be done.
The involvement of PV1(M) 2Apro in viral RNA replication
was suggested by Molla et al. (1993 b) from experiments using
dicistronic poliovirus genomes. While the insertion of an
EMCV IRES at the P1–P2 junction of the poliovirus genome
did not interfere with either proteolytic processing or genome
replication, deletion of 2Apro in these constructs and even
mutation of C109A abolished RNA synthesis (Molla et al.,
1992, 1993 b). Yu and colleagues (Yu et al., 1995 ; Yu & Lloyd,
1991) have come to the same conclusion, based on mutations
introduced into the catalytic triad or other conserved residues
of the 2Apro molecule. So far, two features of PV1(M) 2Apro
seem to be important for this protein to promote RNA
replication : the identity of C109 of the catalytic triad and the
presence of four amino acid residues (P –P ) at the C terminus.
# &
Whether the importance of both of these features relates to a
specific structure of 2Apro remains to be seen. It is possible that
a cluster of negatively charged amino acids involving the
sequence EAME may play a role in poliovirus RNA replication.
This would explain why the addition of the four amino acids
EAME to HRV2 2Apro greatly improved replication of the
chimeric replicon PVM\Luc R2A Cj4 (Fig. 3 a ; open circles).
A poliovirus genomic chimera in which the cognate 2Apro was
replaced with R2A Cj4 did not yield viruses, however (data
not shown). These observations led originally to our speculation that the nucleotide sequence encoding 2Apro may be
involved in encapsidation. A change of four nucleotides of the
EAME-encoding nucleotide sequence at the C terminus (2A
Cm4) did not yield a replication phenotype, however. The high
yield at which PVM\Luc R2A Cj4 was encapsidated in trans
(Fig. 5, open circles) must, therefore, relate to the ability of
PVM\Luc R2A Cj4 to replicate, rather than to a specific
encapsidation signal. This leaves unexplained the surprising
observation that the R2A Cj4 RNA does not form virions.
Experiments to find escape mutants have failed, but they have
not yet involved long-term, blind passages.
Encapsidation signals residing in virus genomes have been
identified for several RNA viruses, for example retroviruses
(Clever et al., 1995 ; Mansky et al., 1995) and a togavirus (Weiss
et al., 1989). Encapsidation of poliovirus is specific in that the
virus particle only contains VPg-linked, positive-sense poliovirus RNA. Thus, the encapsidation process discriminates
against virus mRNA, lacking VPg, and minus-sense RNA. An
encapsidation signal in poliovirus plus-stranded RNA has not
yet been discovered, however. Numerous studies have led to
the exclusion of possible signals, such as the IRES element and
regions in the coding sequences of P1 and VPg, or VPg itself
(Barclay et al., 1998 ; Gromeier et al., 1996 ; Lu & Wimmer,
1996 ; Porter et al., 1998 ; Reuer et al., 1990). Studies using the
cell-free, de novo synthesis of poliovirus (Molla et al., 1991) or
genetic analyses of replicons (Nugent et al., 1999) have
suggested that genome replication is necessary for encapsidation. The data presented here support these previous conclusions. The mechanism by which the plus-stranded viral
RNA is selected for encapsidation remains elusive, however.
Another less-likely possibility is that an intact, virus-specific
2Apro molecule is involved directly in virus particle formation,
since non-structural proteins have been discovered in virus
particles of foot-and-mouth disease virus and poliovirus
(Newman et al., 1994).
Co-transfection of plasmids expressing luciferase-containing replicons with plasmids expressing poliovirus 2Apro
resulted in all cases in an increased signal of the reporter gene
products (Fig. 4). Such an effect on translation efficiency has
been observed before (Hambidge & Sarnow, 1992) and may be
due to a specific but as yet undefined interaction of the
proteinase with the poliovirus IRES element (Macadam et al.,
1994 ; Rowe et al., 2000) combined with a more rapid
degradation of eIF-4G. In agreement with this, co-expression
of a mutant enzyme (2Apro CH) had no effect on the luciferase
signal. However, the increase in the luciferase signal of the
replication-incompetent replicon PVM\Luc C-5 (Fig. 4 ; bar 16)
may reflect trans-activation of RNA replication, since the IRES
sequence in this replicon is identical to that in the others.
The 2Apro enzyme of poliovirus has multiple functions, for
which stringent structural parameters may be essential. The
integrity of the catalytic triad (particularly of C109) appears to
play an important role in all functions. We have identified a
new structural determinant for genome replication, the Cterminal five amino acids.
We would like to thank Dr C. D. Morrow, who provided the VV-P1
vaccinia virus, Dr B. Moss, who provided the mouse fibroblast cell line
OST7-1, Dr L. Carrasco, who provided anti-eIF-4G antibody, and Drs E.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
EAF
X. Li and others
Kuechler and T. Skern, who provided HRV2 cDNA for our studies. We
are indebted to Dr A. Paul for her suggestions in preparing this
manuscript. This work was supported by National Institute of Health
grants R37-AI 15122 and R01-AI 32100.
based on constitutive synthesis of bacteriophage T7 RNA polymerase in
mammalian cells. Proceedings of the National Academy of Sciences, USA 87,
6743–6747.
Goldstaub, D., Gradi, A., Bercovitch, Z., Grosmann, Z., Nophar, Y.,
Luria, S., Sonenberg, N. & Kahana, C. (2000). Poliovirus 2A protease
References
Agol, V. I., Paul, A. V. & Wimmer, E. (1999). Paradoxes of the replication
of picornaviral genomes. Virus Research 62, 129–147.
Aldabe, R., Feduchi, E., Novoa, I. & Carrasco, L. (1995). Efficient
cleavage of p220 by poliovirus 2Apro expression in mammalian cells :
effects on vaccinia virus. Biochemical and Biophysical Research Communications 215, 928–936.
Alexander, L., Lu, H. H. & Wimmer, E. (1994). Polioviruses containing
picornavirus type 1 and\or type 2 internal ribosomal entry site elements :
genetic hybrids and the expression of a foreign gene. Proceedings of the
National Academy of Sciences, USA 91, 1406–1410.
Ansardi, D. C., Porter, D. C. & Morrow, C. D. (1991). Coinfection with
recombinant vaccinia viruses expressing poliovirus P1 and P3 proteins
results in polyprotein processing and formation of empty capsid
structures. Journal of Virology 65, 2088–2092.
Ansardi, D. C., Porter, D. C. & Morrow, C. D. (1993). Complementation
of a poliovirus defective genome by a recombinant vaccinia virus which
provides poliovirus P1 capsid precursor in trans. Journal of Virology 67,
3684–3690.
Ansardi, D. C., Pal-Ghosh, R., Porter, D. & Morrow, C. D. (1995).
Encapsidation and serial passage of a poliovirus replicon which expresses
an inactive 2A proteinase. Journal of Virology 69, 1359–1366.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,
Smith, J. A. & Struhl, K. (editors) (1994). Current Protocols in Molecular
Biology. New York : John Wiley.
Badorff, C., Lee, G. H., Lamphear, B. J., Martone, M. E., Campbell,
K. P., Rhoads, R. E. & Knowlton, K. U. (1999). Enteroviral protease 2A
cleaves dystrophin : evidence of cytoskeletal disruption in an acquired
cardiomyopathy. Nature Medicine 5, 320–326.
Barclay, W., Li, Q., Hutchinson, G., Moon, D., Richardson, A., Percy, N.,
Almond, J. W. & Evans, D. J. (1998). Encapsidation studies of poliovirus
subgenomic replicons. Journal of General Virology 79, 1725–1734.
Barco, A. & Carrasco, L. (1995). Poliovirus 2Apro expression inhibits
growth of yeast cells. FEBS Letters 371, 4–8.
Barco, A., Feduchi, E. & Carrasco, L. (2000). A stable HeLa cell line that
inducibly expresses poliovirus 2Apro : effects on cellular and viral gene
expression. Journal of Virology 74, 2383–2392.
Bazan, J. F. & Fletterick, R. J. (1988). Viral cysteine proteases are
homologous to the trypsin-like family of serine proteases : structural and
functional implications. Proceedings of the National Academy of Sciences,
USA 85, 7872–7876.
Bernstein, H. D., Sarnow, P. & Baltimore, D. (1986). Genetic
complementation among poliovirus mutants derived from an infectious
cDNA clone. Journal of Virology 60, 1040–1049.
Bovee, M. L., Marissen, W. E., Zamora, M. & Lloyd, R. E. (1998 a). The
predominant elF4G-specific cleavage activity in poliovirus-infected HeLa
cells is distinct from 2A protease. Virology 245, 229–240.
Bovee, M. L., Lamphear, B. J., Rhoads, R. E. & Lloyd, R. E. (1998 b).
Direct cleavage of elF4G by poliovirus 2A protease is inefficient in vitro.
Virology 245, 241–249.
Clever, J., Sassetti, C. & Parslow, T. G. (1995). RNA secondary
structure and binding sites for gag gene products in the 5h packaging
signal of human immunodeficiency virus type 1. Journal of Virology 69,
2101–2109.
EAG
Elroy-Stein, O. & Moss, B. (1990). Cytoplasmic expression system
induces apoptotic cell death. Molecular and Cellular Biology 20, 1271–
1277.
Gromeier, M., Alexander, L. & Wimmer, E. (1996). Internal ribosomal
entry site substitution eliminates neurovirulence in intergeneric poliovirus
recombinants. Proceedings of the National Academy of Sciences, USA 93,
2370–2375.
Gromeier, M., Wimmer, E. & Gorbalenya, A. E. (1999). Genetics,
pathogenesis, and evolution of picornaviruses. In Origin and Evolution of
Viruses, pp. 287–343. Edited by E. Domingo, R. G. Webster & J. J.
Holland. New York : Academic Press.
Haghighat, A., Svitkin, Y., Novoa, I., Kuechler, E., Skern, T. &
Sonenberg, N. (1996). The eIF4G-eIF4E complex is the target for direct
cleavage by the rhinovirus 2A proteinase. Journal of Virology 70,
8444–8450.
Hambidge, S. J. & Sarnow, P. (1992). Translational enhancement of the
poliovirus 5h noncoding region mediated by virus-encoded polypeptide
2A. Proceedings of the National Academy of Sciences, USA 89, 10272–10276.
Harmon, S. A., Emerson, S. U., Huang, Y. K., Summers, D. F. &
Ehrenfeld, E. (1995). Hepatitis A viruses with deletions in the 2A gene
are infectious in cultured cells and marmosets. Journal of Virology 69,
5576–5581.
Hellen, C. U. T., Fa$ cke, M., Kra$ usslich, H.-G., Lee, C.-K. & Wimmer, E.
(1991). Characterization of poliovirus 2A proteinase by mutational
analysis : residues required for autocatalytic activity are essential for
induction of cleavage of eukaryotic initiation factor 4F polypeptide p220.
Journal of Virology 65, 4226–4231.
Hellen, C. U., Lee, C. K. & Wimmer, E. (1992). Determinants of
substrate recognition by poliovirus 2A proteinase. Journal of Virology 66,
3330–3338.
Joachims, M., Van Breugel, P. C. & Lloyd, R. E. (1999). Cleavage of
poly(A)-binding protein by enterovirus proteases concurrent with
inhibition of translation in vitro. Journal of Virology 73, 718–727.
Kerekatte, V., Keiper, B. D., Badorff, C., Cai, A., Knowlton, K. U. &
Rhoads, R. E. (1999). Cleavage of poly(A)-binding protein by cox-
sackievirus 2A protease in vitro and in vivo : another mechanism for host
protein synthesis shutoff ? Journal of Virology 73, 709–717.
Kitamura, N., Adler, C. J., Rothberg, P. G., Martinko, J., Nathenson,
S. G. & Wimmer, E. (1980). The genome-linked protein of picorna-
viruses. Vll. Genetic mapping of poliovirus VPg by protein and RNA
sequence studies. Cell 21, 295–302.
Kitamura, N., Semler, B. L., Rothberg, P. G., Larsen, G. R., Adler, C. J.,
Dorner, A. J., Emini, E. A., Hanecak, R., Lee, J. J., van der Werf, S.,
Anderson, C. W. & Wimmer, E. (1981). Primary structure, gene
organization and polypeptide expression of poliovirus RNA. Nature 291,
547–553.
Klump, H., Auer, H., Liebig, H. D., Kuechler, E. & Skern, T. (1996).
Proteolytically active 2A proteinase of human rhinovirus 2 is toxic for
Saccharomyces cerevisiae but does not cleave the homologues of eIF-4
gamma in vivo or in vitro. Virology 220, 109–118.
Kra$ usslich, H. G., Nicklin, M. J. H., Toyoda, H., Etchison, D. & Wimmer,
E. (1987). Poliovirus proteinase 2A induces cleavage of eukaryotic
initiation factor 4F polypeptide p220. Journal of Virology 61, 2711–2718.
Laemmli, U. K. (1970). Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680–685.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
Genetic study of poliovirus
Lamphear, B. J., Yan, R., Yang, F., Waters, D., Liebig, H. D., Klump, H.,
Kuechler, E., Skern, T. & Rhoads, R. E. (1993). Mapping the cleavage
site in protein synthesis initiation factor eIF-4 gamma of the 2A proteases
from human coxsackievirus and rhinovirus. Journal of Biological Chemistry
268, 19200–19203.
Lawson, M. A. & Semler, B. L. (1990). Picornavirus protein processing
– enzymes, substrates, and genetic regulation. Current Topics in Microbiology and Immunology 161, 49–87.
Lee, C.-K. & Wimmer, E. (1988). Proteolytic processing of poliovirus
polyprotein : elimination of 2Apro-mediated, alternative cleavage of
polypeptide 3CD by in vitro mutagenesis. Virology 166, 405–414.
Lee, Y. F., Nomoto, A., Detjen, B. M. & Wimmer, E. (1977). A protein
covalently linked to poliovirus genome RNA. Proceedings of the National
Academy of Sciences, USA 74, 59–63.
Liebig, H.-D., Ziegler, E., Yan, R., Hartmuth, K., Klump, H., Kowalski,
H., Blaas, D., Sommergruber, W., Frasel, L., Lamphear, B., Rhoads, R.,
Kuechler, E. & Skern, T. (1993). Purification of two picornaviral 2A
proteinases : interaction with eIF-4γ and influence on in vitro translation.
Biochemistry 32, 7581–7588.
Lu, H. H. & Wimmer, E. (1996). Poliovirus chimeras replicating under
the translational control of genetic elements of hepatitis C virus reveal
unusual properties of the internal ribosomal entry site of hepatitis C virus.
Proceedings of the National Academy of Sciences, USA 93, 1412–1417.
Lu, H. H., Alexander, L. & Wimmer, E. (1995 a). Construction and
genetic analysis of dicistronic polioviruses containing open reading
frames for epitopes of human immunodeficiency virus type 1 gp120.
Journal of Virology 69, 4797–4806.
Lu, H. H., Li, X., Cuconati, A. & Wimmer, E. (1995 b). Analysis of
picornavirus 2Apro proteins : separation of proteinase from translation
and replication functions. Journal of Virology 69, 7445–7452.
Macadam, A. J., Stone, D. M., Almond, J. W. & Minor, P. D. (1994). The
5h noncoding region and virulence of poliovirus vaccine strains. Trends in
Microbiology 2, 449–454.
Mansky, L. M., Krueger, A. E. & Temin, H. M. (1995). The bovine
leukemia virus encapsidation signal is discontinuous and extends into the
5h end of the gag gene. Journal of Virology 69, 3282–3289.
Martin-Belmonte, F., Lopez-Guerrero, J. A., Carrasco, L. & Alonso,
M. A. (2000). The amino-terminal nine amino acid sequence of poliovirus
capsid VP4 protein is sufficient to confer N-myristoylation and targeting
to detergent-insoluble membranes. Biochemistry 39, 1083–1090.
Michiels, T., Dejong, V., Rodrigus, R. & Shaw-Jackson, C. (1997).
Protein 2A is not required for Theiler’s virus replication. Journal of
Virology 71, 9549–9556.
Molla, A., Paul, A. V. & Wimmer, E. (1991). Cell-free, de novo synthesis
of poliovirus. Science 254, 1647–1651.
delivery. In Viral Vectors : Basic Science and Gene Therapy, pp. 543–562.
Edited by A. Cid-Arregui & A. Garcia-Carranca. Natick, MA : Eaton
Publishing.
Newman, J. F., Piatti, P. G., Ryan, M. D. & Brown, F. (1994). Function
of minor polypeptides in foot-and-mouth disease virus and poliovirus.
Trends in Microbiology 2, 494–497.
Nugent, C. I., Johnson, K. L., Sarnow, P. & Kirkegaard, K. (1999).
Functional coupling between replication and packaging of poliovirus
replicon RNA. Journal of Virology 73, 427–435.
O’Neill, R. E. & Racaniello, V. R. (1989). Inhibition of translation in cells
infected with a poliovirus 2Apro mutant correlates with phosphorylation
of the alpha subunit of eucaryotic initiation factor 2. Journal of Virology
63, 5069–5075.
Palmenberg, A. C. (1989). Sequence alignments of picornavirus capsid
proteins. In Molecular Aspects of Picornavirus Infection and Detection, pp.
211–241. Edited by B. Semler & E. Ehrenfeld. Washington, DC : American
Society for Microbiology.
Petersen, J. F., Cherney, M. M., Liebig, H. D., Skern, T., Kuechler, E. &
James, M. N. (1999). The structure of the 2A proteinase from a common
cold virus : a proteinase responsible for the shut-off of host-cell protein
synthesis. EMBO Journal 18, 5463–5475.
Pfister, T., Mirazayan, C. & Wimmer, E. (1999). Polioviruses : molecular
biology. In Encyclopedia of Virology, 2nd edn, pp. 1330–1348. Edited by A.
Granoff & R. Webster. London : Academic Press.
Porter, D. C., Ansardi, D. C., Wang, J., McPherson, S., Moldoveanu, Z.
& Morrow, C. D. (1998). Demonstration of the specificity of poliovirus
encapsidation using a novel replicon which encodes enzymatically active
firefly luciferase. Virology 243, 1–11.
Pringle, C. R. (1999). Virus taxonomy at the XIth International Congress
of Virology, Sydney, Australia, 1999. Archives of Virology 144,
2065–2070.
Reuer, Q., Kuhn, R. J. & Wimmer, E. (1990). Characterization of
poliovirus clones containing lethal and nonlethal mutations in the
genome-linked protein VPg. Journal of Virology 64, 2967–2975.
Rowe, A., Ferguson, G. L., Minor, P. D. & Macadam, A. J. (2000).
Coding changes in the poliovirus protease 2A compensate for 5hNCR
domain V disruptions in a cell-specific manner. Virology 269, 284–293.
Rueckert, R. R. (1996). Picornaviridae and their replication. In Fundamental Virology, 3rd edn, pp. 507–548. Edited by B. N. Fields, D. M.
Knipe & P. M. Howley. Philadelphia : Lippincott–Raven.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : a
Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring
Harbor Laboratory.
Seipelt, J., Guarne, A., Bergmann, E., James, M., Sommergruber, W.,
Fita, I. & Skern, T. (1999). The structure of picornaviral proteinases.
Molla, A., Jang, S. K., Paul, A. V., Reuer, Q. & Wimmer, E. (1992).
Virus Research 62, 159–168.
Cardioviral internal ribosomal entry site is functional in a genetically
engineered dicistronic poliovirus. Nature 356, 255–257.
Molla, A., Hellen, C. U. T. & Wimmer, E. (1993 a). Inhibition of
proteolytic activity of poliovirus and rhinovirus 2A proteinases by
elastase-specific inhibitors. Journal of Virology 67, 4688–4695.
Skern, T., Sommergruber, W., Blaas, D., Gruendler, P., Fraundorfer,
F., Pieler, C., Fogy, I. & Kuechler, E. (1985). Human rhinovirus 2 :
Molla, A., Paul, A. V., Schmid, M., Jang, S. K. & Wimmer, E. (1993 b).
Studies on dicistronic polioviruses implicate viral proteinase 2Apro in
RNA replication. Virology 196, 739–747.
Mueller, S. & Wimmer, E. (1998). Expression of foreign proteins by
poliovirus polyprotein fusion : analysis of genetic stability reveals rapid
deletions and formation of cardiovirus-like open reading frames. Journal
of Virology 72, 20–31.
Mueller, S. & Wimmer, E. (2000). Picornaviruses as tools of antigen
complete nucleotide sequence and proteolytic processing signals in the
capsid protein region. Nucleic Acids Research 13, 2111–2126.
Skern, T., Sommergruber, W., Auer, H., Volkmann, P., Zorn, M., Liebig,
H. D., Fessl, F., Blaas, D. & Kuechler, E. (1991). Substrate requirements
of a human rhinoviral 2A proteinase. Virology 181, 46–54.
Sommergruber, W., Zorn, M., Blaas, D., Fessl, F., Volkmann, P.,
Maurer-Fogy, I., Pallai, P., Merluzzi, V., Matteo, M., Skern, T. and
others (1989). Polypeptide 2A of human rhinovirus type 2 : identifica-
tion as a protease and characterization by mutational analysis. Virology
169, 68–77.
Sommergruber, W., Casari, G., Fessl, F., Seipelt, J. & Skern, T. (1994).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47
EAH
X. Li and others
The 2A proteinase of human rhinovirus is a zinc containing enzyme.
Virology 204, 815–818.
Wessely, R., Klingel, K., Santana, L. F., Dalton, N., Hongo, M., Lederer,
W. J., Kandolf, R. & Knowlton, K. U. (1998). Transgenic expression of
Toyoda, H., Nicklin, M. J. H., Murray, M. G., Anderson, C. W., Dunn,
J. J., Studier, F. W. & Wimmer, E. (1986). A second virus-encoded
replication-restricted enteroviral genomes in heart muscle induces
defective excitation-contraction coupling and dilated cardiomyopathy.
Journal of Clinical Investigation 102, 1444–1453.
Wimmer, E., Hellen, C. U. & Cao, X. (1993). Genetics of poliovirus.
Annual Review of Genetics 27, 353–436.
Yalamanchili, P., Banerjee, R. & Dasgupta, A. (1997). Poliovirusencoded protease 2APro cleaves the TATA-binding protein but does not
inhibit host cell RNA polymerase II transcription in vitro. Journal of
Virology 71, 6881–6886.
Yu, S. F. & Lloyd, R. E. (1991). Identification of essential amino acid
residues in the functional activity of poliovirus 2A protease. Virology
182, 615–625.
proteinase involved in proteolytic processing of poliovirus polyprotein.
Cell 45, 761–770.
van der Werf, S., Bradley, J., Wimmer, E., Studier, F. W. & Dunn, J. J.
(1986). Synthesis of infectious poliovirus RNA by purified T7 RNA
polymerase. Proceedings of the National Academy of Sciences, USA 83,
2330–2334.
Ventoso, I. & Carrasco, L. (1995). A poliovirus 2Apro mutant unable to
cleave 3CD shows inefficient viral protein synthesis and transactivation
defects. Journal of Virology 69, 6280–6288.
Ventoso, I., Barco, A. & Carrasco, L. (1998). Mutational analysis of
poliovirus 2Apro. Distinct inhibitory functions of 2Apro on translation and
transcription. Journal of Biological Chemistry 273, 27960–27967.
Ventoso, I., Barco, A. & Carrasco, L. (1999). Genetic selection of
poliovirus 2Apro-binding peptides. Journal of Virology 73, 814–818.
Yu, S. F., Benton, P., Bovee, M., Sessions, J. & Lloyd, R. E. (1995).
Defective RNA replication by poliovirus mutants deficient in 2A protease
cleavage activity. Journal of Virology 69, 247–252.
Weiss, B., Nitschko, H., Ghattas, I., Wright, R. & Schlesinger, S. (1989).
Evidence for specificity in the encapsidation of Sindbis virus RNAs.
Journal of Virology 63, 5310–5318.
EAI
Received 3 August 2000 ; Accepted 19 October 2000
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 04:22:47