[CANCER RESEARCH 64, 7661–7663, November 1, 2004]
Advances in Brief
Gene Silencing in Androgen-Responsive Prostate Cancer Cells from the
Tissue-Specific Prostate-Specific Antigen Promoter
Jun Song,1 Shen Pang,1 Yingchun Lu,1 Kazunari K. Yokoyama,4 Jun-Ying Zheng,1 and Robert Chiu1,2,3
1
Dental Research Institute, University of California Los Angeles (UCLA) School of Dentistry, 2Department of Surgery/Oncology, UCLA School of Medicine, and 3Jonsson
Comprehensive Cancer Center, UCLA, Los Angeles, California; and 4BioResource Center, RIKEN, Ibaraki, Japan
Abstract
The success of gene therapy using a RNA interference approach relies
on small interfering RNA (siRNA) expression from a highly tissue-specific
RNA polymerase II promoter rather than from ubiquitous RNA polymerase III. Accordingly, we have developed a prostate-specific vector that
expresses siRNAs from the human prostate-specific antigen promoter, a
RNA polymerase II promoter. Our data demonstrate androgen-dependent
and tissue-specific siRNA-mediated gene silencing in the androgenresponsive prostate cancer cell line, LNCaP. The biological significance
was evidenced by altered apoptotic activity through the inhibition of the
apoptosis-related regulatory gene. These results demonstrate that siRNAmediated gene silencing from a tissue-specific RNA polymerase II promoter could be a potential tool for tissue-specific gene therapy.
Introduction
Expression of small interfering RNA (siRNA) transcripts from a
cytomegalovirus promoter is capable of generating siRNA-mediated
gene silencing in vitro and in vivo (1). Therefore, it is conceivable that
a functional siRNA could be expressed directly from a tissue-specific
promoter when suitable modifications are made both close juxtaposition of the hairpin to the transcriptional start site and a proper
polyadenylation signal. However, until now, there has been no study
on siRNA-mediated gene silencing directly from a tissue-specific
RNA polymerase II promoter.
The prostate-specific antigen (PSA) is a well-characterized protein
(2–5). Its promoter is androgen responsive and tissue specific (6 –9).
This tissue specificity makes the PSA promoter an ideal regulatory
element for prostate-specific transgene expression (10). Here, we
demonstrate for the first time that expression of a siRNA driven
directly from the PSA promoter is capable of specific gene silencing
in an androgen-dependent and tissue-specific fashion.
Materials and Methods
Plasmids. Sequences of fragments of the human PSA enhancer, the PSA
promoter, the target sequence for green fluorescent protein (GFP), and the
polyadenylation signal (AATAAA) were obtained by polymerase chain reaction amplification using pPSAR2.4K-PCPSA-P-Lux as a template (9). For
cloning purposes, forward primer 5⬘-ATCTCGAGCCGAGAAATTAATTGTGGCG-3⬘ is flanked with XhoI at the 5⬘ end (underlined), and reverse primers
5⬘-ATGAATTCTTTATTAAGCTTGAAGCAGCACGACTTCTTCAGCAAAATGAAGAAGTCGTGCTGCTTCAGCTTGGGGCTGGGGAGCCTCC-3⬘ (PSA-GFP), 5⬘-ATGAATTCTTTATTGATCAGTGGAATAAAGTTATTCGAAAATAACTTTATTTTATTCCACTGATCGCTTGGGGReceived 5/18/04; revised 8/17/04; accepted 9/9/04.
Grant support: USPHS grant CA66746 (R. Chiu) from the National Cancer Institute
and Department of Defense Trainingship PC040369 (J. Song).
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Robert Chiu, UCLA School of Dentistry, 10833 Le Conte
Avenue, 73-016 CHS, Los Angeles, CA 90095. Phone: 310-825-0535; Fax: 310-8250921; E-mail: [email protected].
©2004 American Association for Cancer Research.
CTGGGGAGCCTCC-3⬘ [PSA-c-Jun-NH2-terminal kinase (JNK)], and 5⬘ATGAATTCTTTATTAAGCAAGTTCACAATTACCCACGAATGGGTAATTGTGAACTTGCTTGCTTGGGGCTGGGGAGCCTCC-3⬘ [PSAphosphatidylinositol 3⬘-kinase (PI3K)] are flanked with EcoRI (underlined)
and a synthetic polyadenylation sequence (bold) at the 5⬘ end. Polymerase
chain reaction-amplified products were digested with XhoI and EcoRI and then
subcloned into pBluescript II KS⫹ (Invitrogen, Carlsbad, CA) to generate
pPSARNAi-GFP, pPSARNAi-JNK, or pPSARNAi-PI3K. A lentiviral vector
was used to generate PSARNAi-JNK and PSARNAi-PI3K to target the genes
of JNK1 and JNK2 and PI3K. Target sites for RNAi were selected from human
JNK1/JNK2 (5⬘-GATCAGTGGAATAAAGTTATT-3⬘), human PI3K (p110␤
subunit; 5⬘-AAGCAAGTTCACAATTACCCA-3⬘), and GFP (5⬘-TGAAGCAGCACGACTTCTTCA-3⬘).
RNA Interference Lentivirus System. The lentiviral construct was modified from pLL3.7 (11). In brief, a cytomegalovirus promoter driving the
expression of GFP was deleted. The mouse U6 promoter was replaced with the
PSA promoter and enhancer, as shown in the schematic map in Fig. 1A.
Lentiviral production was performed as described previously (12, 13).
Cell Culture and Transfection. LNCaP cells were grown in RPMI 1640
supplemented with 10% fetal bovine serum (Invitrogen). HeLa and 293T cells
were grown in Dulbecco’s modified Eagle’s medium supplemented with 10%
fetal bovine serum. Transfections were performed using LipofectAMINE 2000
according to the manufacturer’s protocol (Invitrogen).
Dot Hybridization. Total RNA was isolated from cells using TRIzol
solution (Invitrogen) according to the manufacturer’s protocol. Fifty micrograms of total RNA were dotted on a nylon membrane (Bio-Rad, Hercules,
CA). Radilabeled 20-mers oligonucleotides of the sense-strand target sequence
of JNK were used as a probe. Hybridization was performed as described
previously (14).
Western Blot Analyses. Whole-cell lysates were electrophoresed and immunoblotted according to the protocol provided by Santa Cruz Biotechnology
(Santa Cruz, CA). Anti-JNK1, anti-JNK2, anti-PI3K, and the anti–phospho-cJun polyclonal antibody were purchased from Santa Cruz Biotechnology. The
anti– c-Jun polyclonal antibody was purchased from Calbiochem (San Diego,
CA), anti-GFP polyclonal antibody was from BD Biosciences Clontech (Palo
Alto, CA), anti-FKBP12 polyclonal antibody was from Affinity Bioreagents,
Inc. (Golden, CO), and anti–poly(ADP-ribose) polymerase (PARP) polyclonal
antibody was obtained from Oncogene Research (Boston, MA).
Terminal Deoxynucleotidyl Transferase-Mediated Nick End Labeling
Staining. Programmed cell death was detected with the In Situ Cell Death
Detection Kit, TM red (Roche Applied Science, Indianapolis, IN). Terminal
deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) staining
was performed according to the manufacturer’s protocol.
Results and Discussion
To determine whether the PSA promoter is suitable for expressing
siRNA, we developed a vector, pPSARNAi-GFP (Fig. 1A), using the
human PSA promoter and its enhancer to express siRNAs to target the
GFP gene, a commonly used indicator (6, 9). In the presence of
androgen treatment, the GFP expression plasmid was cotransfected
with either pPSARNAi-GFP or empty vector pBluescript II KS⫹ into
the prostate-derived, androgen-responsive LNCaP cell line. Cervixderived HeLa cells and kidney-derived 293T cells were used as
control cell lines. Forty-eight hours after transfection, cells were
subjected to fluorescence microscopic analysis. The expression of
7661
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
TISSUE-SPECIFIC GENE SILENCING IN PROSTATE CANCER CELLS
was observed only in the pPSARNAi-GFP–transfected LNCaP cells
treated with androgen (Fig. 1D, Lane 4). In contrast, expression of
GFP in pPSARNAi-GFP–transfected HeLa cells was unaffected by
androgen treatment (Fig. 1D, compare Lanes 7 and 8 with Lanes 5 and
6). These results suggest that siRNA expression from the PSA promoter is androgen dependent and tissue specific.
We subsequently investigated siRNA-mediated endogenous gene
silencing from the PSA promoter and enhancer. PSARNAi-JNK was
constructed in a lentiviral-based vector to silence the human JNK1 and
JNK2 genes by virtue of a shared stretch of identical sequence.
Forty-eight hours after infecting LNCaP cells with lentiviral PSARNAi-JNK in the presence or absence of androgen, cell extracts were
prepared for Western blot analysis. Significant inhibition of JNK1 and
JNK2 was observed only in the androgen-treated lentiviral PSARNAiJNK–infected LNCaP cells (Fig. 2, A and B), suggesting that siRNA
expression from the PSA promoter effectively targets endogenous
genes in a tissue-specific manner and is also androgen dependent.
Similarly, silencing of the endogenous gene PI3K (15) by lentiviral
PSARNAi-PI3K is also androgen dependent and tissue specific (Fig.
2, D and E).
To determine whether the inhibition of JNK resulted from the
expression of siRNAs, we examined siRNA expression using dot
hybridization. We detected hybridization signal only in LNCaP cells
that were infected with lentiviral PSARNAi-JNK in the presence of
androgen (Fig. 2C), whereas no hybridization signals were present in
HeLa and 293T cells infected with lentiviral empty vector or lentiviral
PSARNAi-JNK (Fig. 2C). These results demonstrate that the inhibi-
Fig. 1. Tissue-specific gene silencing by expression of siRNAs from the human PSA
promoter. A, schematic map of pPSARNAi-GFP. PSA promoter and enhancer, polyadenylation signal, androgen-responsive element (ARE), transcription start sites (⫹1 and
ⴱ), and the target sequence are indicated. B, fluorescence imaging of the effect of RNAi.
Either pBluescript II KS⫹ vector or pPSARNAi-GFP was cotransfected with the GFP
expression plasmid (pEGFP-N1; BD Biosciences Clontech) into LNCaP, HeLa, and 293T
cells, along with treatment of cells with 10 nmol/L androgen. Cells were examined
microscopically for GFP expression. C, Western blot analysis of GFP expression. Cell
lysates prepared from LNCaP, HeLa, and 293T cells transfected with empty vector or
pPSARNAi-GFP were subjected to Western blot analysis of GFP expression. Expression
of FKBP12 was used as an internal control. D, androgen-dependent expression of a siRNA
from the PSA promoter. Either pBluescript II KS⫹ vector or pPSARNAi-GFP was
cotransfected with the GFP expression plasmid into LNCaP or HeLa cells. The cells were
either left untreated or treated with 10 nmol/L androgen. GFP expression was detected by
Western blot analysis. Expression of FKBP12 was used as an internal control.
GFP was reduced only in the pPSARNAi-GFP–transfected LNCaP
cells, and not in HeLa or 293T cells (Fig. 1B), which suggests that
PSA expressed siRNA to silence the target gene in a tissue-specific
fashion. Similarly, Western blot analysis further confirmed that inhibition of GFP expression only occurred in pPSARNAi-GFP–transfected LNCaP cells, not in HeLa or 293T cells (Fig. 1C).
To determine whether GFP silencing in LNCaP cells is androgen
dependent, LNCaP and HeLa cells were each transfected with the
aforementioned plasmids in the absence or presence of androgen.
Western blot analysis demonstrated that inhibition of GFP expression
Fig. 2. Androgen-dependent and tissue-specific gene silencing of endogenous genes in
LNCaP cells. A, androgen-dependent knockdown JNK from the PSA promoter. LNCaP
cells were infected with lentiviral PSARNAi-JNK or a lentiviral empty vector with or
without androgen treatment. Expression of JNK1 and JNK2 was detected using Western
blot analyses 48 hours after infection. B, tissue-specific gene silencing of both human
JNK1 and JNK2. LNCaP, HeLa, and 293T cells were infected with lentiviral PSARNAiJNK or lentiviral empty vector and treated with androgen. Forty-eight hours after infection, cell lysates were subjected to Western blot analysis for the expression of JNK1 and
JNK2. C, expression of siRNAs. Tissue-specific expression of siRNAs was examined
using dot hybridization. ␤-Actin was used as a control. D, androgen-dependent effect of
RNAi in targeting PI3K. LNCaP cells were infected with lentiviral PSARNAi-PI3K or a
lentiviral empty vector with or without androgen treatment. Expression of PI3K was
detected 48 hours after infection. E, tissue-specific gene silencing of human PI3K.
LNCaP, HeLa, and 293T cells were infected with either lentiviral PSARNAi-PI3K or
control lentivirus in the presence of androgen. Expression of PI3K was analyzed by
Western blotting 48 hours after infection.
7662
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
TISSUE-SPECIFIC GENE SILENCING IN PROSTATE CANCER CELLS
tion of JNK is dependent on expression of siRNAs. ␤-Actin was used
as a control probe.
To determine whether JNK knockdown affects the phosphorylation
status of the downstream target c-Jun, 12-O-tetradecanoylphorbol-l3acetate (TPA)–induced phosphorylated c-Jun was used to assess JNK
activity. Phosphorylated c-Jun was enhanced in cells infected with a
control viral vector (Fig. 3A, Lane 2, top panel) but not in cells
infected with lentiviral PSARNAi-JNK, even in the presence of TPA
treatment (Fig. 3A, Lane 4, top panel). Western blot analysis of
unphosphorylated c-Jun was used as a control (Fig. 3A, bottom panel).
These results clearly demonstrate that the cells with knockdown JNKs
lose their responsiveness to TPA-induced JNK activity for phosphorylation of c-Jun and suggest that siRNA-mediated gene silencing by
a tissue-specific promoter has a great impact on the regulation of
signaling pathways.
Additionally, we examined the effect of the JNK gene silencing in
TPA-induced apoptosis of LNCaP cells, using the cleaved Mr 90,000
PARP fragment as an apoptosis indicator. As shown in Fig. 3B, Lane
4, the detection of the Mr 90,000 PARP indicated that TPA induced
apoptosis in empty lentiviral vector-infected LNCaP cells. In contrast,
TPA did not enhance the Mr 90,000 PARP fragment in LNCaP cells
infected with lentiviral PSARNAi-JNK, suggesting that knockdown
JNK prevents cells from undergoing apoptosis in response to TPA
treatment (Fig. 3B, compare Lane 2 with Lane 1). To detect apoptosis
at the single cell level, LNCaP cells infected with either lentiviral
PSARNAi-JNK or control lentivirus in the presence or absence of
TPA treatment were subjected to TUNEL staining. DNA strand
breaks in the cells were then detected by fluorescence microscopy. As
shown in Fig. 3C, TPA-treated control cells displayed enhanced
TUNEL staining signals, whereas a minor stained signal was seen in
LNCaP cells with knockdown of JNK (Fig. 3C), suggesting that
knockdown of JNK protects cells from TPA-induced apoptosis in
LNCaP cells.
To our knowledge, this is the first evidence that siRNA can be
expressed from a tissue-specific promoter. This finding may lead to
new directions for application of RNAi technology and demonstrate
the possibility that many superior RNA polymerase II-mediated mammalian expression vectors can be used to drive the corresponding
small hairpin RNA to silence targeted gene expression in a tissuespecific manner. Furthermore, an inducible polymerase II-mediated
expression vector, as described by us, may be used to control the
expression of small hairpin RNA for functional analysis of genes
essential to cell viability.
In summary, these data demonstrated that a siRNA expressed from
either a vector- or lentiviral-based system using the PSA promoter not
only specifically reduced the expression of ectopic and endogenous
genes in cells but also acted in a tissue-specific and hormone-dependent manner. Further study of the effectiveness of siRNA-mediated
gene silencing by the PSA promoter in an animal system will lay the
groundwork for creating a potential gene therapy approach for the
treatment of prostate cancer.
Acknowledgments
We thank Dr. Luk Van Parijs for providing a lentivirus-based system, John
Rossi for valuable advice, Kristen Lum for critical review of the manuscript,
and Susan Chou for assistance with experiments.
References
Fig. 3. Biological effects of gene silencing of JNKs in LNCaP cells. A, JNKs are
required for the phosphorylation of c-Jun when stimulated by TPA. LNCaP cells were
infected with lentiviral PSARNAi-JNK or a control lentivirus and treated with androgen.
Forty-eight hours after infection, cells were treated with TPA (100 ng/mL) for 1 hour
before harvesting the cells. Expression of phosphorylated and unphosphorylated c-Jun was
detected by Western blot analysis. B, effects of JNK in TPA-induced apoptosis of LNCaP
cells. LNCaP cells were infected with lentiviral PSARNAi-JNK or control lentivirus in the
presence of androgen treatment. Forty eight hours after infection, cells were treated with
or without TPA (100 ng/mL) for 24 hours, followed by Western blot analysis of PARP
expression. C, TUNEL staining. LNCaP cells were cultured in an 8-well chamber slide.
Forty eight hours after infection, cells were treated with or without TPA for an additional
24 hours, followed by TUNEL staining. Images were captured with a digital camera using
an Olympus fluorescence microscope.
1. Xia H, Mao Q, Paulson HL, Davidson BL. siRNA-mediated gene silencing in vitro
and in vivo. Nat Biotechnol 2002;20:1006 –10.
2. Hara M, Kimura H. Two prostate-specific antigens, gamma-seminoprotein and betsmicroseminoprotein. J Lab Clin Med 1989;113:541– 8.
3. Wang MC, Valenzuela LA, Murphy GP, Chu TM. Purification of a human prostate
specific antigen. Investig Urol 1979;17:159 – 63.
4. Chan DW, Bruzek DJ, Oesterling JE, Rock RC, Walsh PC. Prostate-specific antigen
as a marker for prostatic cancer: a monoclonal and polyclonal immunoassay compared. Clin Chem 1987;33:1916 –20.
5. Martin DB, Gifford DR, Wright ME, et al. Quantitative proteomic analysis of proteins
released by neoplastic prostate epithelium. Cancer Res 2004;64:347–55.
6. Riegman PH, Vlietstra RJ, van der Korput JA, et al. The promoter of the prostatespecific antigen gene contains a functional androgen responsive element. Mol Endocrinol 1991;5:1921–30.
7. Pang S, Taneja S, Dardashti K, et al. Prostate tissue specificity of the prostate-specific
antigen promoter isolated from a patient with prostate cancer. Hum Gene Ther
1995;6:1417–26.
8. Louie MC, Yang HQ, Ma AH, et al. Androgen-induced recruitment of RNA polymerase II to a nuclear receptor-p160 coactivator complex. Proc Natl Acad Sci USA
2003;100:2226 –30.
9. Pang S, Dannull J, Kaboo R, et al. Identification of a positive regulatory element
responsible for tissue-specific expression of prostate-specific antigen. Cancer Res
1997;57:495–9.
10. Yu D, Chen D, Chiu C, et al. Prostate-specific targeting using PSA promoter based
lentiviral vectors. Cancer Gene Ther 2001;8:628 –35.
11. Rubinson DA, Dillon CP, Kwiatkowski AV, et al. A lentivirus-based system to
functionally silence genes in primary mammalian cells, stem cells and transgenic
mice by RNA interference. Nat Genet 2003;33:401– 6.
12. Lois C, Hong EJ, Pease S, et al. Germline transmission and tissue-specific expression
of transgenes delivered by lentiviral vectors. Science (Wash DC) 2002;295:868 –72.
13. Tiscornia G, Singer O, Ikawa M, et al. A general method for gene knockdown in mice
by using lentiviral vectors expressing small interfering RNA. Proc Natl Acad Sci
USA 2003;100:1844 – 8.
14. Song J, Lu YC, Yokoyama K, et al. Cyclophilin A is required for retinoic acidinduced neuronal differentiation of p19 cells. J Biol Chem 2004;279:24414 –9.
15. Beresford SA, Davies MA, Gallick GE, et al. Differential effects of phosphatidylinositol-3/Akt-kinase inhibition on apoptosis sensitization to cytokines in LNCaP and
PC-3 prostate cancer cells. Interferon Cytokine Res 2001;21:313–22.
7663
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Gene Silencing in Androgen-Responsive Prostate Cancer
Cells from the Tissue-Specific Prostate-Specific Antigen
Promoter
Jun Song, Shen Pang, Yingchun Lu, et al.
Cancer Res 2004;64:7661-7663.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/64/21/7661
This article cites 14 articles, 7 of which you can access for free at:
http://cancerres.aacrjournals.org/content/64/21/7661.full#ref-list-1
This article has been cited by 1 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/64/21/7661.full#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.