REVIEWS
Helicobacter pylori evolution
and phenotypic diversification
in a changing host
Sebastian Suerbaum and Christine Josenhans
Abstract | Helicobacter pylori colonizes the stomachs of more than 50% of the world’s
population, making it one of the most successful of all human pathogens. One striking
characteristic of H. pylori biology is its remarkable allelic diversity and genetic variability.
Not only does almost every infected person harbour their own individual H. pylori strain,
but strains can undergo genetic alteration in vivo, driven by an elevated mutation rate
and frequent intraspecific recombination. This genetic variability, which affects both
housekeeping and virulence genes, has long been thought to contribute to host
adaptation, and several recently published studies support this concept. We review the
available knowledge relating to the genetic variation of H. pylori, with special emphasis on
the changes that occur during chronic colonization, and argue that H. pylori uses mutation
and recombination processes to adapt to its individual host by modifying molecules that
interact with the host. Finally, we put forward the hypothesis that the lack of opportunity
for intraspecies recombination as a result of the decreasing prevalence of H. pylori could
accelerate its disappearance from Western populations.
RAPD
(Random amplification of
polymorphic DNA). A simple
method to assess the genetic
relatedness of bacterial strains
within one species. A single
short primer is used in PCR
reactions and the resulting
band patterns are compared.
Medizinische Hochschule
Hannover, Institut für
Medizinische Mikrobiologie
und Krankenhaushygiene,
Carl-Neuberg-Strasse 1,
30625 Hannover, Germany.
e-mails: suerbaum.
[email protected];
josenhans.christine@
mh-hannover.de
doi:10.1038/nrmicro1658
The Gram-negative bacterium Helicobacter pylori
colonizes the stomachs of more than half of the world’s
population from infancy, making it one of the most
successful bacterial pathogens1. H. pylori has probably
accompanied humans for tens of thousands of years2–4,
and it has been hypothesized that H. pylori colonization
could have provided benefits to its human carriers and
hence provided a selective advantage during long periods
of human history5. In the modern world, H. pylori infections are responsible for a heavy toll of morbidity and
mortality as a consequence of ulcer disease, lymphoma
of the mucosa-associated lymphoid tissue (MALT) and,
the most dangerous complication of H. pylori infection,
gastric adenocarcinoma. The discovery of H. pylori in
1982 (REF. 6) had fundamental consequences for the treatment of stomach diseases and earned the two discoverers,
Robin Warren and Barry Marshall, a Nobel Prize in 2005.
H. pylori is the only formally recognized definitive bacterial carcinogen for humans7 and is estimated to be responsible for 5.5% of all human cancer cases, or approximately
592,000 gastric cancer cases per year 8. H. pylori has also
become a paradigm for a bacterium that causes chronic
infections, and its mode of action as a pathogen has been
NATURE REVIEWS | MICROBIOLOGY
termed ‘slow’ or ‘stealth’9,10. One other Helicobacter species, Helicobacter hepaticus, has been associated with the
development of both hepatocellular carcinoma and colon
cancer in immunocompromised mice11–13.
For several years, it has been known that H. pylori is
one of the most diverse and variable bacterial species to
be studied. When fingerprinting methods, such as restriction endonuclease digestion, random amplification of
polymorphic DNA (RAPD), or nucleotide-sequence-based
methods are used to analyse H. pylori strains from unrelated individuals, the data indicate that every individual
seems to carry his or her own strain, or even multiple
strains14–17 (FIG. 1). Direct clonal transmission of strains
from person to person has rarely been documented; evidence for direct clonal transmission that has been attained
was by the detection of closely related strains within
families18–20. Transmission of the organism in developed
countries is thought to occur mainly vertically through
direct human-to-human contact, usually within families
and during the first years of life21.
Although our mechanistic understanding of the
bacterial processes involved in generating diversity in
H. pylori has substantially increased over recent years,
VOLUME 5 | JUNE 2007 | 441
© 2007 Nature Publishing Group
REVIEWS
we still know little about how this diversity relates to the
survival of the bacteria in their individual human hosts.
Because of the lifestyle of H. pylori as a chronic and
persistent host-specific bacterium that lacks a natural
reservoir outside humans, we have to assume that adaptation processes that take place in the context of the host
environment are responsible for bacterial diversification.
However, what are the driving forces for the adaptation
processes in the host niche during H. pylori infection?
H. pylori causes an ‘active chronic infection’, in which the
bacteria are constantly multiplying and displaying vigorous motility in the stomach mucus (indicating constant
high energy consumption by the bacteria), but appear
to be only poorly contained by the immune system to
the extent that several thousand bacterial cells can be
observed in 1 nL of gastric mucus22. The concept of
an almost complete lack of control by the human
immune system is supported by the fact that immunodeficient individuals do not have a higher incidence
Microevolution
The generation of genetic
variation within a species over
relatively short timescales.
b
High
a
of H. pylori infection or disease symptoms caused by
H. pylori infection. On the contrary, H. pylori itself seems
to have developed mechanisms during its evolution to
evade and thwart the host’s natural immune responses.
In addition, microevolution of the bacteria inside each
single individual host is likely to further contribute to
maintaining a host–pathogen balance that promotes
persistence23. Hence, immune evasion and suppression,
as well as achieving a specific polarization of the immune
response that is beneficial for bacterial survival, are likely
to be the main selective forces driving the microevolution
of H. pylori in vivo.
These selective pressures operate on a microorganism that possesses specific capabilities for diversification
by mutation and recombination, as is discussed below.
The bacteria need to interact indirectly and directly
with the hosts, requiring both fixed bacterial surface
molecules to provide adherence and soluble molecules
that are either surface-bound or secreted, and act on
Level of acid production
Antralpredominant
gastritis
Normal gastric
mucosa
Acute
H. pylori
infection
Chronic
H. pylori
infection
Duodenal ulcer
MALT lymphoma
Asymptomatic
H. pylori
infection
Nonatrophic
pangastritis
Corpuspredominant
atrophic gastritis
Gastric ulcer
Intestinal metaplasia
Dysplasia
Low
Gastric cancer
Childhood
Advanced age
Age
c
d
A ATGCACCTCC TAGGTCTTCG AGTAATGCCC TCGGGCCTTC CTCCCCGCTC GCGTGTAGCC GCTG
B TCA...T..T ..T..C.... .AC....... .......C.. .......... .T.C.C.... ....
C T.A....C.. ......C... .AC...A... ......TGC. TCAGA.A... .T....T... ....
D ..A...T... .....TC.TT G......... .T.A...GC. ..AG...... A..C..T... ....
E ...TGTTC.. .....TC... ..C...A... .......C.. .CAGG..... ......T..T ....
F T.A....C.. ......C... .......... .T.A...C.. .......... .T.C.C.... ....
G T.A...T..T .....T..TT G.......T. .T.A..TGC. TCAG...... ...C..T... ....
H ......TC.T C..T..C.TT G.C....... .......... .......... A.....TA.. ....
I T.....T..T ...T.TC.TT G.....A.T. .......... .....T.... .....CT... ....
A
B
C
D
E
F
G
H
I
J
J .......... ......C... .......... ......TCC. .......... .T.C..T... ....
Figure 1 | Helicobacter pylori and its extensive genetic heterogeneity. a | Transmission electron micrograph of H. pylori
showing its characteristic curved morphology and a unipolar bundle of sheathed flagella, which are essential for the
colonization of the gastric mucosa. b | Natural progression of H. pylori infection. Infection usually occurs during childhood
and causes symptomatic acute gastritis. Because the symptoms of acute gastritis are non-specific and transient, a diagnosis
is rarely made at this stage. Acute infection transforms to chronic active gastritis in most patients and persists for decades
or is life-long. The infection can take multiple courses. Most people that are infected with H. pylori will never develop
symptomatic disease. 10–15% will develop ulcer disease (gastric or duodenal ulcer), approximately 1% will develop gastric
adenocarcinoma, and a small group of patients will develop gastric MALT lymphoma. c–d | H. pylori exhibits extensive genetic
variation, so that almost every individual carries his or her own H. pylori strain. c | Random amplification of polymorphic DNA
(RAPD) fingerprints of ten H. pylori strains from unrelated individuals (A–J) showing a unique banding pattern for each strain.
d | Partial sequences of the flaB flagellin gene for ten strains A–J showing a unique combination of polymorphic nucleotides
for each strain. Part b reprinted with permission from REF. 1 © (2002) Massachusetts Medical Society.
442 | JUNE 2007 | VOLUME 5
www.nature.com/reviews/micro
© 2007 Nature Publishing Group
REVIEWS
Polymorphic nucleotide
A position in a nucleotide
sequence that displays variation
in a sample population. If a
sequence analysis of a gene
fragment for n isolates yields
three different alleles, for
example, AACTTA, AAGTTA and
AAATTA, the third position in
this sequence is polymorphic
but the other positions are not.
Multilocus enzyme
electrophoresis
(MLEE). A classical method that
was used to study the structure
of bacterial populations.
Differences between the
electrophoretic mobilities of
multiple enzymes in starch gels
are used as indicators of allelic
variation.
Homoplasy test
A method to quantify the
contribution of recombination
to sequence variation in a set of
homologous nucleotide
sequences from multiple
isolates.
Panmictic
A population structure where
clonal structure is lost due to
frequent recombination.
Species with panmictic or close
to panmictic population
structures include Helicobacter
pylori and Neisseria
gonorrhoeae; species with
predominantly clonal
population structures include
Salmonella enterica and
Mycobacterium tuberculosis.
Type IV secretion system
(T4SS). A complex bacterial
secretion system that can
transport bacterial protein
effector molecules or DNA into
a eukaryotic cell.
MLST
(Multilocus sequence typing).
A nucleotide-sequencebased approach for the
characterization of isolates of
microorganisms. The method
involves the sequence analysis
of approximately seven
housekeeping gene fragments.
Unique sequences obtained for
each fragment are assigned an
allele number, and the
combination of allele numbers
for all fragments defines the
sequence type (ST). MLST is
applicable to almost all
bacteria and some other
microorganisms. See Further
information for a central
website to access MLST
databases for different
organisms.
their respective host receptors. As such, one might
assume that adaptation processes could lead to alterations in three groups of bacterial genes: first, genes in
systems that affect intrabacterial mutation, DNA uptake,
repair and recombination themselves; second, genes that
favour bacteria–bacteria interactions for the purpose of
interbacterial genetic exchange, including decreasing or
increasing the barrier of genetic exchange; and third,
genes that influence bacterial properties that modulate
host interaction (adherence and immune response). In
the following sections, we review the current knowledge
relating to the diversity of H. pylori and the mechanisms
that mediate diversification within the host.
Allelic diversity and population structure
Following the discovery of H. pylori, it was noted that
this pathogen has extraordinary genetic heterogeneity,
and that almost every isolate from unrelated patients
appears to have a unique ‘fingerprint’4,15,17,24. Individuals
can be colonized with multiple strains25, and strains
have been shown to change during chronic colonization26,27. The genetic heterogeneity of H. pylori is
perhaps most striking at the nucleotide sequence level.
The sequence analysis of a few hundred base pairs of
only one housekeeping or virulence gene is sufficient to
obtain a unique signature for an H. pylori isolate, suggesting an unprecedented degree of allelic diversity16,19.
Only when strains from members of the same family
or people living closely together were studied, could
related strains be observed, indicating clonal transmission18–20,28. These observations led to the hypothesis that
H. pylori rapidly adapts to individual hosts, sparking
intensive research into the underlying mechanisms of
genetic variation.
Genetic variation can be generated in a bacterial
population by mutation and/or recombination between
different strains. Owing to their haploid genotype and
mode of replication, bacteria are by default clonal,
and diversity arises by the sequential acquisition of
mutations. However, recombination due to natural
transformation, conjugation, or phage transfer, which
shuffles polymorphic nucleotides between different clonal
lineages, can greatly influence the structure of bacterial
populations29. Recombination is capable of generating a
large number of alleles from relatively few polymorphic
nucleotides. The first evidence of the strong impact of
recombination on the population structure of H. pylori
was obtained from multilocus enzyme electrophoresis data30.
Analysis of nucleotide sequences from small collections
of strains from one geographical location with population
genetic analysis tools, such as the Homoplasy test31, provided robust evidence for the impact of recombination
and allowed its quantification. These studies showed that
allelic diversity within H. pylori was primarily created by
recombination between strains during mixed infection,
and that the population structure was quasi-panmictic,
largely lacking clonal structure19. A large study comparing mutation and recombination rates between different
pathogenic bacteria based on sequence data confirmed
that H. pylori stands out as the bacterial species with the
highest population recombination rate32.
NATURE REVIEWS | MICROBIOLOGY
H. pylori from different geographical regions
The virulence genes vacA and cagA, which encode the
vacuolating cytotoxin and the translocated substrate of
the cag type IV secretion system, respectively, were the first
genes for which differences related to the geographical origin of strains were noted. The vacA and cagA
sequences from Asian strains were notably distinct from
the sequences obtained from Western H. pylori strains,
indicating that at least for these virulence-related genes,
geographical partitioning of the bacterial population and
some degree of a clonal structure existed in this rapidly
recombining species33–36. A breakthrough in the analysis of
the population structure of H. pylori came with the application of the multilocus sequence typing (MLST) approach37.
This approach, which was first developed for meningococci38 and has since been applied to a wide range of
pathogens, uses a small number of housekeeping genes to
sample the genome. Housekeeping genes encode proteins
with functions such as nucleic acid and protein synthesis
that are conserved in most bacteria and, in comparison
to virulence genes, are less likely to be under positive
diversifying selection pressures39. The MLST approach, in
conjunction with modern population genetic tools such as
Structure40, has proven extremely powerful for the analysis
of recombining H. pylori populations. An H. pylori multilocus haplotype contains partial sequences from 7 housekeeping genes — atpA, efp, mutY, ppa, trpC, ureI and yphC
— giving a total length of 3,406 bp. Two large analyses of
the population structure of H. pylori have been published,
based on MLST datasets from 370 and 769 strains from
diverse geographical and ethnic sources3,4, and the results
of both studies are summarized below. Despite frequent
recombination, the species H. pylori can be subdivided
into six main populations with distinct geographical distributions (FIG. 2). Four of these are relatively homogeneous
(hpEurope, hpAsia2, hpAfrica2 and hpNEAfrica), and
two are composed of subpopulations (hspWAfrica and
hspSAfrica together form a population called hpAfrica1,
and hspEAsia, hspMaori and hspAmerind together form
the population hpEastAsia). These modern populations
are the result of tens of thousands of years of joint human
and bacterial population movements, geographical
isolation and bacterial interstrain recombination.
The Structure tool also allows the five ancestral
populations from which these modern populations have
been derived to be reconstructed, and every strain can
be analysed to assess how its nucleotide composition
relates to the five ancestral populations. Interestingly,
none of the modern H. pylori strains has derived their
nucleotides from just one ancestral population. All
strains showed a nucleotide composition derived from
a mixture of ancestral populations. The distribution of
H. pylori populations across the globe and the distribution of sequence polymorphisms assigned to ancestral
H. pylori populations are consistent with known ancient
and more recent human migrations. For example, strains
isolated from Native Americans in Venezuela or from the
Inuit contain a high proportion of ancestral Asian nucleotides, consistent with the fact that the ancestors of these
human populations migrated to the Americas through
the Bering strait approximately 13,000 years ago 3.
VOLUME 5 | JUNE 2007 | 443
© 2007 Nature Publishing Group
REVIEWS
a
b
0.01
Kimura 2-parameter distance
hpAfrica2
hspAmerind
hpNEAfrica
hspEAsia
hpAsia2
hspSAfrica
hspMaori
hpEurope
hspWAfrica
Autosomal microsatellite
marker
A microsatellite is a simple
sequence repeat that consists
of repeating units of 1–4
nucleotides. Microsatellites are
highly polymorphic and are
widely used as markers in
human genetic studies. The
term autosomal is used if a
microsatellite marker is located
on a non-sex chromosome (in
contrast to markers located on
X or Y chromosomes).
Mutator strain
A strain of a bacterial species
that has an elevated mutation
rate compared with the
average mutation rate of the
species. The mutator
phenotype is due to defects in
genes coding for DNA repair
enzymes or proteins involved
in assuring fidelity of DNA
replication.
Mismatch repair
(MMR). A DNA repair
mechanism that recognizes
and corrects mismatches
between the parental DNA
strand and the copied DNA
strand that is generated during
replication.
Base excision repair
(BER). A DNA repair
mechanism that recognizes
and corrects single mutated
bases in the DNA, such as
oxidated or alkylated bases.
Figure 2 | Helicobacter pylori populations and their worldwide distribution. H. pylori can be subdivided into six
main populations. Four of these are relatively homogeneous (hpEurope, hpAsia2, hpAfrica2 and hpNEAfrica), and two
are composed of subpopulations (hspWAfrica and hspSAfrica together form a population called hpAfrica1, and
hspEAsia, hspMaori and hspAmerind together form the population hpEastAsia). a | Phylogenetic tree of the populations
and subpopulations; diameters of circles represent within-population genetic diversity, angles of filled arcs are
proportional to numbers of isolates. b | Distribution of the nine populations and subpopulations among the 769 strains
studied in REF. 4. The pie charts placed in 51 different locations represent the relative abundance of a population in a
given location. Reprinted with permission from REF. 4 © (2007) Macmillan Publishers Ltd.
A high prevalence of hpAfrica1 strains and hpEurope
strains containing large proportions of ancestral hpAfrica1
nucleotides is consistent with the slave trade between
Africa and the Americas. Likewise the distribution of
strains with varying proportions of ancestral Europe 1
and ancestral Europe 2 nucleotides is consistent with
the colonization of Europe by migrations from the Near
East and Central Asia. These studies provide strong
evidence that the association of H. pylori with humans
predates the migration of anatomically modern humans
out of Africa, and that H. pylori has accompanied all
human ethnic groupings ever since4. Genetic diversity
within H. pylori population samples has decreased with
increasing distance from east Africa, the cradle of modern humans, in a strikingly similar way to that described
for the genetic diversity of humans, indicating an old
and close association between the two. Simulations from
the data show that H. pylori is likely to have migrated
from Africa 58,000 ± 3,500 years ago, consistent with
current estimates for the migrations of humans out
of Africa4.
The observation that H. pylori sequences reflect
human migrations has raised the possibility that
H. pylori multilocus haplotypes could be used to resolve
open questions regarding the history of human migrations — as a valuable addition to the anthropological
toolbox. Indeed, Wirth et al. have presented a first
example in which H. pylori multilocus haplotyping was
more informative about human migrations than the currently available human genetic markers. In this study,
444 | JUNE 2007 | VOLUME 5
they showed that H. pylori multilocus haplotype analysis
could distinguish between Buddhists and Muslims in
Ladakh, two populations that had been socially distinct
for 500–1000 years, whereas human mitochondrial DNA
markers and 17 autosomal microsatellite markers were not
informative41. Multiple studies are currently in progress
to further exploit this potential of H. pylori to reveal the
history of their human hosts.
Mechanisms generating allelic diversity
Allelic diversity in bacteria is created by a combination
of mutagenesis and recombination. The mutation rate
of H. pylori is significantly higher than that of many
other bacteria. Twenty six out of twenty nine H. pylori
strains, the mutation rates of which were assayed by
measuring the emergence of resistance to rifampicin,
had a higher mutation rate than the average value for
the Enterobacteraceae, and about 25% of strains had a
mutation rate that even exceeded that of Escherichia coli
mutator strains42. Genome analysis reveals that H. pylori
apparently lacks homologues of many of the genes that
contribute to DNA repair in E. coli, including the complete mismatch repair pathway (mutS1/mutL/mutH) and
several enzymes involved in base excision repair (BER)43.
The lack of these enzymes might explain the overall higher
mutation rate, although this has not been tested experimentally. In addition to the overall high mutation rate,
H. pylori possesses 46 genes that contain homopolymeric
runs of nucleotides or dinucleotide repeats that are
prone to frequent length changes as a consequence of
www.nature.com/reviews/micro
© 2007 Nature Publishing Group
REVIEWS
slipped-strand mispairing-mediated mutagenesis44.
Length changes can lead to reversible inactivation of
genes due to frameshifts (phase variation), or to changed
gene transcription if the repeat is located in regulatory
sequences. The large repertoire of hyper-mutable genes
implies that any large population of H. pylori will consist
of many different subpopulations, each with a specific
combination of active and inactive phase-variable
genes (the term ‘bacterial quasispecies’ has been used
to describe this phenomenon). Although the inactivation of some genes containing hypermutable sequences
is likely to be selected against in vivo, a large body of
evidence (some of which is further reviewed in later
sections) demonstrates that slipped-strand mispairingmediated mutagenesis and intrastrain recombination do
indeed generate highly diverse populations of H. pylori
in an individual host26,45–47. The bacterial population
can therefore react quickly to changing environments
by expanding a specific subpopulation with higher fitness. This mechanism could even allow the bacteria to
regulate their mutation rate, as the antimutator gene
mutY contains a repeat sequence in which length variation could lead to gene inactivation43,48,49. Details of the
mechanisms involved in recombination, DNA repair
and mutagenesis have been the subject of several recent
reviews and are not reviewed here43,50.
Finally, the H. pylori genome contains numerous
repetitive sequences of different lengths that permit
intragenomic deletions or rearrangements. Aras et al.
have studied the distribution of such repeats and experimentally demonstrated that the deletion of fragments
between repeats of up to 100 bp was RecA-independent
and that deletion frequencies increased with the increasing length of the repeats51. Examples of genes that showed
frequent intragenomic rearrangements included cagY
and cagA (located on the cag pathogenicity island (PAI)),
as well as amiA, a gene encoding an amidase involved in
peptidoglycan biosynthesis46, and genes involved in the
fucosylation of lipopolysaccharide (LPS)45. Functional
implications of the variability of these and other genes
will be discussed in more detail below.
Pyrosequencing
A sequencing method that is
based on the detection of
released pyrophosphate (PPi)
during DNA synthesis.
Evidence for interstrain recombination in vivo
Can H. pylori generate genetic diversity during the colonization of an individual host stomach by recombination
between different strains, in addition to the intrastrain
diversification mechanisms outlined above? The first
evidence for interstrain recombination during chronic
colonization came from a study by Kersulyte and colleagues, who characterized six H. pylori strains that
were isolated from a single patient and showed that this
patient harboured two different H. pylori strains that had
repeatedly exchanged DNA, creating multiple mosaic
genotypes27. A different approach was used by Falush
et al., who studied the genetic relationships of sequential H. pylori isolates, cultured from biopsies taken from
the same patient at time intervals of several months to
years52. Numerous recombination events, many of them
spanning only a few hundred base pairs, were detected
when 10 gene fragments were sequenced for 24 pairs of
such sequential isolates (FIG. 3). A Bayesian mathematical
NATURE REVIEWS | MICROBIOLOGY
model was then developed and used to determine the
most likely combination of recombination rate, mutation
rate and length of the imported fragments that would
generate the real dataset. Strikingly, H. pylori cells that
undergo recombination import short pieces of DNA (on
average 417 bp) into their chromosomes, in contrast to
other bacteria, for which known lengths range from 2 kb
(pneumococci) to over 10 kb (E. coli). Recombination
events during chronic infection were also unexpectedly
frequent, and extrapolations from the model predict that
up to 50% of the genome of an H. pylori strain could
be exchanged by recombination over four decades of
infection52.
However, the speed of intrahost evolution of
H. pylori currently remains a subject of some controversy. The number of differences between paired
sequential H. pylori isolates varies strongly between
patients, with some pairs of sequential isolates showing little or no change over time periods extending to
9 years52–55. One obvious explanation for the relative
stability of H. pylori strains in some patients is the lack
of mixed infection in those individuals, the probability of
which is likely to vary in parallel with the prevalence
of H. pylori infection in a population, and would have
obvious effects on interstrain recombination. Another
reason why robust estimates of rates of mutation and
recombination in vivo are not yet available is inherent
in the design of the sequential isolate studies carried
out so far. Because in most studies only one strain per
time point was characterized, the exact point in time
at which an observed difference has been generated is
not known. Mutations or recombination events might
have occurred between the isolation of the first and
the follow-up strain, but both strains may also already
have coexisted for some time before the first isolation.
Given the overall low transmissibility of H. pylori, it
seems unlikely that a mixture of strains, which have
already undergone recombination, are transmitted
simultaneously. As such, the assumption made in
sequential isolate studies that mixed infections and
recombination events occur in the same individual
seems realistic. Because of the uncertainty in timing
the mutation and recombination events, using the
sequential isolate approach (so far) only allows a calculation of the maximal rates for mutation and recombination52. Future studies that use faster sequencing
technologies including highly parallel pyrosequencing56
to fully sample the population diversity of H. pylori
at every time point should soon clarify these open
questions.
Genomic changes during colonization in vivo
H. pylori strains also differ markedly in their genomic
content. This was first shown by the comparison
of the two complete genome sequences of H. pylori
strains 26695 and J99 (REF. 57). These two genomes
share approximately 1,406 of their 1,590 and 1,495
open reading frames, respectively, and each contains
approximately 100 (7%) strain-specific genes. A third
H. pylori strain, HPAG1, the genome of which was
sequenced more recently, lacked another 29 of the
VOLUME 5 | JUNE 2007 | 445
© 2007 Nature Publishing Group
REVIEWS
Pa
tie
a
nt
M
on
th
s
genes shared by the first two genomes58. The set of
core genes present in all H. pylori genomes was further
determined by studies that used comparative genome
hybridization technology59,60. Gressmann et al. used a
collection of 56 globally representative H. pylori strains
that included examples from all known populations
and subpopulations in comparative genome hybridizations with a microarray representing the genes of
the combined genomes of 26695 and J99. Between the
56 strains, 1,150 genes were conserved. Extrapolation
of this number to infinity yielded an estimate of 1,111
genes that are predicted to be conserved in all H. pylori
strains (the core genome). The remaining genes that
each H. pylori genome contains (approximately 400
genes), come from a pool of genes that are only present
in a subset of H. pylori strains. Although some of these
are important in pathogenesis, most notably the cag
PAI, the majority of these non-conserved genes have
as-yet-unknown functions.
If H. pylori strains recombine during chronic infection in one individual, is this also associated with the
loss or gain of genes, and if yes, how do short allelic
replacement events and those associated with gain or
3001
3005
24
6
1010
1037
2003
3
12
36
315
331
367
1014
1040
1062
352
36
36
36
24
24
3
36
299
36
ureI
flaB
mutY
efp
b
H. pylori strain
1014-1
1014-4
1014-6
1014-1
1014-4
1014-6
loss compare quantitatively? Israel et al. compared the
genome of H. pylori J99, which was originally isolated
in 1994, with multiple strains that had been isolated
from the same patient six years later 47. All follow-up
strains differed from the original isolate by one or
multiple gene losses or gains. However, significant
genomic changes are apparently much rarer than
sequence alterations where a small segment of DNA
is exchanged with a segment of the same size from a
different strain. Using DNA microarray hybridization, Kraft et al.61 quantified gains and losses of genes
in 21 pairs of sequential isolates and compared these
with estimates of recombination frequency calculated
for the same set of strains based on MLST data52.
According to their analysis, only one in 650 recombination events is associated with gene loss or gain, showing
remarkable conservation of genome structure despite
frequent recombination. Although the significance of
such genomic changes is unknown in most cases, they
can have important implications for pathogenesis. For
example, the cag PAI can be deleted when a cag-positive
strain recombines with a cag-negative strain resulting
in the replacement of the cag PAI with an ‘empty site
flaA
ppa
yphC
vacA
atpA
trpC
Fragment of vacA gene
GAAGAAGCGAATAAAACCCCAGATAAACCCGATAAAGTTTGGCGCATTCAA
GAAGAAGCGAATAAAACCCCAGATAAACCCGATAAAGTTTGGCGCATTCAA
GAATAAGCGAATAAAACCCCAGATAAACCCGATAAAGTTTGGTGCATTCAA
E
E
A
N
K
T
P
D
K
P
D
K
V
W
R
I
Q
E
E
A
N
K
T
P
D
K
P
D
K
V
W
R
I
Q
E
*
A
N
K
T
P
D
K
P
D
K
V
W
C
I
Q
Figure 3 | The effect of mutation and recombination on sequences during chronic infection. a | Shows the genetic
relationships between H. pylori strains isolated sequentially from patients at two time points. The time between the
isolation of the first and the follow-up strain is given in the second column. Ten gene fragments were sequenced and
compared for each pair. The first two lines show patients for whom no changes were detected in any of the ten fragments
(indicated by a green rectangle). The next three lines show patients for whom a single nucleotide change, most likely due
to a point mutation, occurred in one of the fragments (indicated by a yellow box, with the position of single nucleotide
change indicated by a black horizontal line within the box). In the next seven patients, recombination events have
occurred in one or more of the ten sequenced fragments. Recombination events are easily recognized by multiple
clustered polymorphisms (recombination events are indicated by violet boxes), clusters can extend over the entire
sequenced fragment or be limited to a short patch. The last row is an unusual case in which two strains isolated
sequentially seem completely unrelated, indicated by completely different sequences for all ten fragments. b | The effect
of a recombination event on the expression of the vacuolating cytotoxin VacA. The three strains 1014-1, 1014-4 and
1014-6 were isolated sequentially from patient 1014 and the sequence of a short fragment of the vacA gene is shown for all
three strains. The sequence of the strain (1014-6) isolated last (that is, two years after the first strain) differs from the other
two strains in two nucleotides. One of these changes, which has most likely been acquired by the importation of a piece of
DNA from a different strain that co-colonized the stomach of patient 1014, has introduced a stop codon into the vacA
coding sequence (represented by *). Part a modified with permission from REF. 52 © (2001) National Academy of Sciences.
446 | JUNE 2007 | VOLUME 5
www.nature.com/reviews/micro
© 2007 Nature Publishing Group
REVIEWS
allele’27. Alternatively, the PAI can be excised without
contact with a second strain by an intrachromosomal
recombination event involving the two 31-bp repeats
that flank the island61,62.
Evidence for adaptation of H. pylori to the host
Although nucleotide sequence changes and gene gains
and losses during chronic infection have been well
documented, the role these changes have in the ability
of H. pylori to cause persistent infections and in the
pathogenesis of H. pylori gastritis and associated
diseases remains poorly understood. An attractive
hypothesis suggests that H. pylori could use its genetic
plasticity to adapt to individual human hosts. Although
this hypothesis remains as-yet unproven, there are
now several lines of evidence indicating that this could
indeed be the case, and that H. pylori is capable of rapidly adapting to a host by selecting a population with
modified surface properties or with changes in other
molecules that interact with the host. The same mechanism could enable H. pylori to colonize a more diverse
ecological niche (for example, different regions of the
stomach that vary with respect to acidity, gastric mucus
composition, expression of host cell products, such as
trefoil peptides or host cell glycans, or the degree of
inflammation) than could be colonized by a genetically
homogenous population.
Adhesins and other outer-membrane proteins. H. pylori
possesses a large superfamily of 33 paralogous genes
encoding predicted outer-membrane proteins63,64. These
genes have been subdivided into two families termed
hop and hor genes. The function of most of their gene
products, the Hop and Hor proteins, is still unknown,
but several have been shown to be involved in the adherence of H. pylori to glycoconjugates on the gastric epithelium. The two best-studied members of the families are
BabA and SabA, which mediate adherence to ABO/
Lewis b and sialyl-Lewis x/sialyl-Lewis a blood-group
antigens, respectively65,66. BabA sequences show strong
allelic variation, and different alleles encode proteins
with two different binding modes67 (BOX 1). H. pylori
is capable of varying the expression of these adhesins
by multiple mechanisms. The babA and sabA genes are
phase-variable owing to the presence of dinucleotide
repeats, ensuring that a larger population of H. pylori
will always contain a subpopulation of cells with a
different expression status from that of the dominant
population that can quickly expand if selective pressures
change65,66. For example, expression of sialyl-Lewis x and
sialyl-Lewis y increases in inflamed mucosa, and inflammation may therefore provide selection for strains that
express SabA66. Intragenomic recombination between
highly homologous genes from the hop/hor family might
help H. pylori to adapt its adhesive properties to different niches within the stomach, or to changing gastric
conditions that result from ageing, atrophy, other infections or dietary changes. The same mechanism might
apply to ensure efficient transmission within families
whose individuals can differ in traits that are important
for colonization, such as blood-group antigens. Such
intragenomic recombination events that rearrange the
hop/hor genes have been shown to occur in vitro68 as
well as in vivo in Rhesus monkeys69. The large pool of
hop/hor genes, which share several highly conserved
regions, might allow the generation of a large variety
of mosaic adhesin genes that are adapted to the surface
properties of the individual stomach. The hop family
members AlpA and AlpB, which have also been linked
to adhesion70, occur in allelic variants correlated with the
geographical origin of the strain (Eastern and Western
type). These variants displayed differences in their ability to activate the innate immune system, independently
from their contribution to adherence71.
Box 1 | Helicobacter pylori and blood-group antigens
Helicobacter pylori adheres to human epithelial cells using fucosylated glycoproteins and sialylated glycolipids as
cellular receptors66,105. This adhesion is mediated by two members of the large family of Helicobacter outer-membrane
proteins (Hop) termed BabA and SabA. The BabA adhesin, a 75-kDa surface-exposed protein, was initially described
to bind to the fucosylated Lewis antigens Leb and H-1, which are abundantly expressed on the epithelial cells of people
with blood group O65. This observation was consistent with the epidemiological observation that peptic ulcer disease is
particularly common in individuals with this blood group. An extensive investigation by Thomas Borén and colleagues67
into the binding patterns of H. pylori strains from different geographical regions showed that the babA gene and
its encoded adhesin display marked sequence variation, and that this variation correlates with differential binding
properties. BabA proteins from many strains had a wider spectrum of binding that included the antigens expressed
on cells of individuals with blood groups A or B (A-Lewis b and B-Lewis b, respectively). Strains with a narrower binding
spectrum (Leb and H-1 only) were termed ‘specialist binders’, whereas those with the wider spectrum were termed
‘generalist binders’. The geographical distribution of the strains studied correlated strikingly with the occurrence of
host blood-group antigens. Specialist binders were particularly abundant among strains isolated from South American
Amerindians, where blood group O is extremely common. The generalist binding characteristic was the most common
type in European and Asian strains, where the distribution of blood groups is much more even. In in vitro experiments,
specialist binders could be converted into generalist binders by transformation with DNA from a generalist, a phenomenon
that is likely to occur in vivo. The data provide a telling example of how the genetic makeup of the host population might
shape the H. pylori population. Adaptation to the host individual must not interfere with successful transmission.
Specialist adaptation to an individual with, for example, blood group A, would make transmission to individuals
with other blood groups more difficult, thereby reducing the effectiveness of transmission in a population that is
heterogeneous with respect to blood groups. Only in a highly homogeneous population such as the Amerindians will
specialist adaptation not interfere with transmission within the community.
NATURE REVIEWS | MICROBIOLOGY
VOLUME 5 | JUNE 2007 | 447
© 2007 Nature Publishing Group
REVIEWS
Box 2 | The cag secretion apparatus and the CagA oncoprotein
The cag pathogenicity island (PAI) has a central role in Helicobacter pylori pathogenesis. A
large number of epidemiological studies have shown that strains containing a cag PAI are
associated with more severe disease (such as ulcers and adenocarcinomas) in H. pyloriinfected individuals worldwide106,107. The >30 kb genomic island contains approximately
28 genes89. Some of these genes encode proteins with homology to components of
the T pilus of Agrobacterium tumefaciens, the prototype of the type IV secretion system
(T4SS)103,108. T4SSs are multisubunit nanomachines that can introduce proteins (and/or
DNA) into host cells and thereby influence host cell functions109. The cag T4SS
translocates the CagA protein into host epithelial cells110. After entering the host cell,
CagA becomes phosphorylated by cellular kinases and binds to several target proteins.
These interactions, some of which are phosphorylation-dependent and some are
phosphorylation-independent, induce multiple cellular events that contribute to cellular
responses. These responses include the morphogenetic changes that are characteristic of
cell infection with cag-positive H. pylori strains, and may ultimately lead to malignant
transformation92,97,111. CagA has therefore been termed a bacterial oncoprotein. In
addition, cag-mediated contact between bacteria and epithelial cells has been shown
to lead to the delivery of peptidoglycan fragments into the host cell, which are
recognized by the intracellular pattern receptor, NOD1, leading to the activation of
pro-inflammatory signalling pathways112 and increased interleukin-8 secretion.
VacA cytotoxin. The majority of H. pylori strains express
a vacuolating cytotoxin, VacA, which exerts multiple
effects on epithelial cells72 and inhibits the proliferation
of T cells73. The vacA gene displays pronounced allelic
variation, which has given rise to a widely used typing
scheme for H. pylori based on polymorphisms in vacA
gene sequences encoding the signal peptide and a mid
region33. Different alleles show varying affinity for cellular receptors74, and strains carrying multiple recombinant
alleles with differential toxic activity have been isolated
from a single stomach at one time point75, or sequentially
during chronic colonization in vivo76 (FIG. 3b).
LPS. Lipopolysaccharides are another important component of the outer surface of H. pylori that show extensive
phenotypic variation. The O-antigen side chains of many
strains display one or multiple Lewis antigens77. The
expression of these antigens is controlled by three fucosyltransferase genes, futA, futB and futC, the expression of
which can be switched on or off by transcriptional or
translational frameshifting, creating populations with
highly diverse LPS glycosylation patterns78–80. In addition, FutA and FutB contain a C-terminal heptad repeat
region, consisting of a variable number of repeats of
seven amino acids. Different strains that can coexist in
one host display fut genes with varying numbers of these
heptad repeats, and the number of these repeats determines the specificity of the enzyme for O-antigen sidechain backbones of different lengths, thus functioning as
a ‘molecular ruler’45. Recently, Lewis-antigen-expressing
H. pylori strains were shown to bind more strongly
to dendritic cells (DCs) through the C-type lectin,
DC-SIGN, than Lewis-negative variants, suggesting that
this variation might have a role in regulating the interaction of H. pylori with DCs, which might determine T-cell
immune polarization81.
Flagellar motility. Another property that is important
for persistent colonization that can undergo phenotypic
ON/OFF switching is flagellar motility. Flagellar motility
448 | JUNE 2007 | VOLUME 5
depends on the coordinated expression of more than 30
genes that mediate the assembly and operation of the
flagellar filament, the flagellar motor and the chemotaxis machinery82,83. One of the genes encoding a component of the flagellar basal body, fliP, is amenable to
ON/OFF switching by translational frameshift that is
due to slipped strand mispairing, and non-motile variants can be isolated from a motile population and vice
versa84. The role this switch has in vivo has not yet been
elucidated.
The cag PAI. The cag PAI (see BOX 2 and FIG. 4 ), a
chromosome segment that plays an important part
in H. pylori pathogenesis, is not present in all strains,
and the prevalence of cag PAI-containing strains varies
widely between different geographical regions. Almost
all Asian H. pylori strains and strains from the hpAfrica1
population contain the complete cag PAI. By contrast,
there is one H. pylori population, hpAfrica2, found in
South Africa, where all strains studied so far have been
devoid of a cag PAI60. Strains from Amerinds, although
closely related to Asian H. pylori, either completely lack
the PAI, or carry islands with large deletions. Finally,
carriage of the cag PAI is variable in hpEurope strains
that are the most common strains in western Europe
and North America60. Possession of all or most cag genes
does not guarantee that the type IV secretion apparatus is functional, and more data are needed where the
function of the island (for example, ability to translocate
CagA) has been studied in strains from the different
populations.
The cag PAI is a highly plastic region of the H. pylori
genome. Not only do strains differ significantly in the
number of cag PAI genes they carry, but the island can
be lost, either completely or partially, during chronic
infections of humans61,62 or experimentally infected
animals85,86. Many patients have been shown to simultaneously carry cag-positive and cag-negative bacteria87. It
has therefore been proposed that a dynamic population
of cag-positive and cag-negative strains or subclones can
exist in one human individual that can expand and contract depending on the physiological and immune status
of the host, and on the requirements of different niches
within the stomach88. However, data supporting this
hypothesis are still limited. The cag apparatus is in direct
contact with the host, and some of its proteins are likely
to interact with the host cell, although its receptor has
not yet been identified. Thus, it can be postulated that
the cag PAI and its components have to be under positive selection in individual human hosts, possibly more
than most other H. pylori genes. The cag PAI is therefore
a particularly attractive target to test the hypothesis of
changes leading to host adaptation.
Since the first description of the cag PAI in 1996
(REF. 89), the full cag PAI sequence has been elucidated
in three other complete genome sequences (H. pylori
26695, J99 and HPAG1). In addition, complete cag
PAI sequences from four Swedish strains90 and eleven
Japanese strains91 have been published. The cag PAI gene
whose allelic variation and its functional implications
have been studied in most detail is cagA. CagA proteins
www.nature.com/reviews/micro
© 2007 Nature Publishing Group
REVIEWS
a
H. pylori strain 26695 genome
cag pathogenicity island
HP0524
(VirD4)
HP0525
(VirB11)
HP0527
(VirB10)
HP0530
(VirB8)
HP0528
(VirB9)
HP0530
(VirB7)
HP0544
(VirB4)
CagY
FRR
cagA
Translocation of
CagA into gastric
epithelial cells by
type IV secretion
Many of these genes
are required to form
type IV secretion aparatus
b
HP0546
(VirB2)
c
CagC
MRR
FVR
VirB10 domain
TVR
VirB10 domain
VirB10 domain
VirB10 domain
d
CagA
EPIYA mosaic types
AB
ABC
ABCC
ABCCC
ABD
Figure 4 | The cag pathogenicity island contains genes that show marked sequence variation. Most Helicobacter
pylori strains that cause disease contain the cag pathogenicity island (PAI), a chromosomal region comprising approximately
37,000 base pairs and 29 genes (see BOX 2 for details). a | Arrangement of cag PAI genes in H. pylori strain 26695. Most of the
cag genes are probably involved in the assembly of the type IV secretion system that translocates the protein CagA into
the cytoplasm of gastric epithelial cells. Seven genes (marked in red) show similarity to components of the type IV secretion
system of the plant pathogen Agrobacterium tumefaciens. Proteins encoded by the island are involved in two major
processes, the induction of interleukin-8 (IL-8) production by gastric epithelial cells and the translocation of CagA from
the bacterium into host cells. All genes depicted by arrows in dark shades of red and green are essential for IL-8 induction,
whereas lighter shades of red and green indicate genes that are not involved in this process. The arrows marked with a red
dot indicate genes that are not required for translocation of CagA, the non-marked genes are essential for translocation103.
b–d | Exposure of cag proteins to the host presumably places them under strong positive selection in vivo. Extensive
sequence variation, possibly linked to host adaptation, has so far been documented for three cag PAI-encoded proteins,
CagY (HP0527, b), a protein that probably forms a sheath covering the type IV pilus46,104, CagC (HP0546, c), the putative cag
pilin100, and the translocated effector CagA (HP0547, d)97. CagA shows striking ethnic and individual variation in its C-terminal
repetitive phosphorylation (EPIYA) motifs; the upper four combinations of EPIYA types depicted are characteristic for
Western strains, and the lower combination (ABD), including the unique Asian D-type EPIYA motif, is associated with east
Asian strains. See text and references for details. FRR, 5′-repeat region; FVR, 5′-variable region; MRR, middle repeat region;
TVR, 3′-variable region. Part a modified with permission from REF. 1 © (2002) Massachusetts Medical Society.
from different strains show extensive variation in their
mosaic C-terminal domain92. This domain contains
repetitive phosphorylation motifs (EPIYA motifs) that
can be tyrosine phosphorylated by kinases of the Src
family93,94 and the kinase c-Abl95. Phosphorylated CagA
subsequently binds to the SHP-2 tyrosine phosphatase,
inducing elevated cell motility and deregulating cell
NATURE REVIEWS | MICROBIOLOGY
growth96,97. EPIYA motifs have been classified into four
types based on sequences. H. pylori strains vary widely
in their configuration of EPIYA motifs (in both the
number and combination of different EPIYA motifs, as
well as the number of each type present in the CagA
C terminus). Some combinations of these motifs are
highly characteristic of Western strains, whereas others
VOLUME 5 | JUNE 2007 | 449
© 2007 Nature Publishing Group
REVIEWS
T helper (TH) 1 immune
response
T cell immune responses can
be broadly categorized into
two types. TH1 responses are
dominated by TH1 cells, which
produce interferon-γ and
tumour necrosis factor. TH2
responses are characterized by
a prodominance of TH2 cells
secreting interleukins (IL)-4,
IL-5 and IL-13. The TH1
response is particularly geared
towards the defence against
intracellular bacteria, whereas
the TH2 response is more
suited to defend against
extracellular bacteria.
1.
2.
3.
4.
5.
are characteristic of East Asian strains (FIG. 4). CagA proteins with different EPIYA configurations differ in their
interactions with different interaction partners, such as
SHP-2 or C-terminal Src kinase (Csk)98,99. The strong
association between the ethnicity of the host and the
CagA type suggests strong positive selection. Whether
CagA also changes during chronic colonization and how
this affects the development of gastric diseases over time
has not yet been elucidated.
Strong variability has also been documented for a
second cag PAI gene, cagY, a virB10 orthologue. The
cagY gene contains two long, repetitive regions, FRR
(5′) and MRR (middle region), which are both absent
from virB10 family genes from other bacteria, and can
vary in length and in the amino-acid composition of the
resulting proteins46. Isolates from different human hosts
and bacteria recovered from experimentally colonized
mice and rhesus monkeys varied considerably in repeat
numbers, always leading to new in-frame combinations
of nucleotide repeats, resulting in CagY proteins of different length46. As the antibody response against this protein
in human hosts was low, the authors postulate that the
almost infinite potential for variation in the cagY gene by
intergenomic or intragenomic recombination or deletion
serves the purpose of evading the host antibody response,
while preserving cag apparatus function. The ability of
the cag secretion system to induce interleukin-8 expression in gastric epithelial cells also varied in some strains
that harboured changes in CagY, therefore the observed
variation of the surface-exposed protein could have a different function in host interaction and host adaptation.
The surface-exposed region of a cag PAI VirB2
orthologue, CagC, a surface-associated protein of the cag
apparatus that is essential for cag function (cag pilin), was
also shown to vary extensively between strains100. It has
not yet been assessed whether cagC variation is found in
sequential or simultaneous isolates from a single host,
or after experimental colonization in animals. Sufficient
information on intraspecies variability of other cag PAI
proteins to assess their possible roles in host adaptation
is currently not available.
Suerbaum, S. & Michetti, P. Helicobacter pylori
infection. N. Engl. J. Med. 347, 1175–1186 (2002).
Ghose, C. et al. East Asian genotypes of Helicobacter
pylori strains in Amerindians provide evidence for its
ancient human carriage. Proc. Natl Acad. Sci. USA 99,
15107–15111 (2002).
Falush, D. et al. Traces of human migrations in
Helicobacter pylori populations. Science 299,
1582–1585 (2003).
Linz, B. et al. An African origin for the intimate
association between humans and Helicobacter pylori.
Nature 445, 915–918 (2007).
Two analyses of the global population structure of
H. pylori using multilocus sequence data. The first
paper established that H. pylori can be subdivided
into populations with distinct geographical
distribution, and that its genes reflect human
migrations. The second study compared the genetic
diversity of human and H. pylori DNA, and provides
evidence that H. pylori was already associated with
humans at the time they migrated out of Africa
60,000 years ago.
Blaser, M. J. Who are we? Indigenous microbes
and the ecology of human diseases. EMBO Rep. 7,
956–960 (2006).
6.
H. pylori: is variability important for its success?
Although a large body of evidence points towards a
role of H. pylori genetic variability in adaptation to its
human host, experimental evidence to support this
is currently scarce. So far, only two published studies
have experimentally addressed the impact of a loss of a
factor involved in genetic variation on bacterial fitness.
Mutants in ruvC, a Holliday-junction resolvase that
is essential for recombination, were cleared from the
mouse stomach whereas the wild-type strain showed
persistent infection101,102. The mutant also elicited a
polarized T helper (TH) 1 immune response, whereas the
wild-type strain generated a TH2-cell- type response.
However, the mechanism underlying the fitness defect
of the mutant is not known, and more work is needed
in this area.
If H. pylori adapts to the host individual by continuously improving its genome, predominantly by
interstrain recombination, then this mechanism is
critically dependent on the frequent occurrence of
mixed infections with two or more different H. pylori
strains. This is probably still the case in regions of the
world where H. pylori infection remains almost universal, but could now be rare in Western countries,
where the prevalence of H. pylori has been declining
over several decades. Such a decline in prevalence,
initiated by changing environmental conditions such
as general hygiene, less crowded living conditions and,
more recently, the use of antibiotics, would make a
recombination-based method of genomic adaptation
ineffective, giving rise to abortive infections, and ultimately accelerating the disappearance of H. pylori from
regions where its prevalence has fallen beyond a critical
threshold level. This hypothesis, if confirmed, would
have important implications for models that predict the
impact of interventive measures, such as vaccination
and treatment campaigns on prevalence rates, because
the long-term effect of measures that have a moderate effect on prevalence could be much stronger than
anticipated and ultimately lead to the disappearance
of H. pylori.
Warren, J. R. & Marshall, B. Unidentified curved bacilli
on gastric epithelium in active chronic gastritis. Lancet
1, 1273–1275 (1983).
7.
Schistosomes, liver flukes and Helicobacter pylori.
IARC Working Group on the Evaluation of Carcinogenic
Risks to Humans. Lyon, 7–14 June 1994. IARC
Monogr Eval. Carcinog. Risks Hum. 61, 1–241
(1994).
8.
Parkin, D. M. The global health burden of infectionassociated cancers in the year 2002. Int. J. Cancer
118, 3030–3044 (2006).
9.
Blaser, M. J. Helicobacter pylori: microbiology of a
‘slow’ bacterial infection. Trends Microbiol. 1,
255–260 (1993).
10. Merrell, D. S. & Falkow, S. Frontal and stealth attack
strategies in microbial pathogenesis. Nature 430,
250–256 (2004).
11. Suerbaum, S. et al. The complete genome sequence
of the carcinogenic bacterium Helicobacter
hepaticus. Proc. Natl Acad. Sci. USA 100,
7901–7906 (2003).
12. Erdman, S. E. et al. CD4+ CD25+ regulatory T
lymphocytes inhibit microbially induced colon cancer
in Rag2-deficient mice. Am. J. Pathol. 162, 691–702
(2003).
450 | JUNE 2007 | VOLUME 5
13. Ward, J. M. et al. Chronic active hepatitis and
associated liver tumors in mice caused by a persistent
bacterial infection with a novel Helicobacter species.
J. Natl Cancer Inst. 86, 1222–1227 (1994).
14. Langenberg, W., Rauws, E. A., Widjojokusumo, A.,
Tytgat, G. N. & Zanen, H. C. Identification of
Campylobacter pyloridis isolates by restriction
endonuclease DNA analysis. J. Clin. Microbiol. 24,
414–417 (1986).
15. Majewski, S. I. & Goodwin, C. S. Restriction
endonuclease analysis of the genome of
Campylobacter pylori with a rapid extraction method:
evidence for considerable genomic variation. J. Infect.
Dis. 157, 465–471 (1988).
These two papers were the first two descriptions of
the striking allelic diversity in H. pylori.
16. Kansau, I. et al. Genotyping of Helicobacter pylori
isolates by sequencing of PCR products and
comparison with the RAPD technique. Res. Microbiol.
147, 661–669 (1996).
17. Akopyanz, N., Bukanov, N. O., Westblom, T. U.,
Kresovich, S. & Berg, D. E. DNA diversity among
clinical isolates of Helicobacter pylori detected by
PCR-based RAPD fingerprinting. Nucleic Acids Res.
20, 5137–5142 (1992).
www.nature.com/reviews/micro
© 2007 Nature Publishing Group
REVIEWS
18. Bamford, K. B. et al. Helicobacter pylori: comparison
of DNA fingerprints provides evidence for intrafamilial
infection. Gut 34, 1348–1350 (1993).
19. Suerbaum, S. et al. Free recombination within
Helicobacter pylori. Proc. Natl Acad. Sci. USA 95,
12619–12624 (1998).
Demonstrates that the population structure of
H. pylori is shaped by frequent recombination, and
that H. pylori behaves clonally on a short-term
range after natural transmission in families.
20. Miehlke, S., Genta, R. M., Graham, D. Y. & Go, M. F.
Molecular relationships of Helicobacter pylori strains
in a family with gastroduodenal disease. Am. J.
Gastroenterol. 94, 364–368 (1999).
21. Magalhaes Queiroz, D. M. & Luzza, F. Epidemiology of
Helicobacter pylori infection. Helicobacter 11
(Suppl. 1), 1–5 (2006).
22. Schreiber, S. et al. The spatial orientation of
Helicobacter pylori in the gastric mucus. Proc. Natl
Acad. Sci. USA. 101, 5024–5029 (2004).
23. Lee, S. K. & Josenhans, C. Helicobacter pylori and the
innate immune system. Int. J. Med. Microbiol. 295,
325–334 (2005).
24. Akopyanz, N., Bukanov, N. O., Westblom, T. U. & Berg,
D. E. PCR-based RFLP analysis of DNA sequence
diversity in the gastric pathogen Helicobacter pylori.
Nucleic. Acids. Res. 20, 6221–6225 (1992).
25. Taylor, N. S. et al. Long-term colonization with single
and multiple strains of Helicobacter pylori assessed
by DNA fingerprinting. J. Clin Microbiol. 33,
918–923 (1995).
26. Kuipers, E. J. et al. Quasispecies development of
Helicobacter pylori observed in paired isolates
obtained years apart from the same host. J. Infect.
Dis. 181, 273–282 (2000).
27. Kersulyte, D., Chalkauskas, H. & Berg, D. E.
Emergence of recombinant strains of Helicobacter
pylori during human infection. Mol. Microbiol. 31,
31–41 (1999).
First demonstration of intrahost recombination in
multiple strains isolated from one individual patient.
28. Raymond, J. et al. Genetic and transmission analysis
of Helicobacter pylori strains within a family. Emerg.
Infect. Dis. 10, 1816–1821 (2004).
29. Maynard Smith, J., Smith, N. H., O’Rourke, M. &
Spratt, B. G. How clonal are bacteria? Proc. Natl
Acad. Sci. USA 90, 4384–4388 (1993).
A seminal paper that established the concept that
different species of bacteria possess different
population structures.
30. Go, M. F., Kapur, V., Graham, D. Y. & Musser, J. M.
Population genetic analysis of Helicobacter pylori by
multilocus enzyme electrophoresis: extensive allelic
diversity and recombinational population structure.
J. Bacteriol. 178, 3934–3938 (1996).
31. Maynard Smith, J. & Smith, N. H. Detecting
recombination from gene trees. Mol. Biol. Evol. 15,
590–599 (1998).
32. Perez-Losada, M. et al. Population genetics of
microbial pathogens estimated from multilocus
sequence typing (MLST) data. Infect. Genet. Evol. 6,
97–112 (2006).
33. Atherton, J. C. et al. Mosaicism in vacuolating cytotoxin
alleles of Helicobacter pylori. Association of specific
vacA types with cytotoxin production and peptic
ulceration. J. Biol. Chem. 270, 17771–17777 (1995).
This paper describes the mosaic structure of the
vacA cytotoxin gene, establishes a vacA typing
system for H. pylori and presents evidence for a
differential association of vacA alleles with disease.
34. Pan, Z. J. et al. Equally high prevalences of infection
with cagA-positive Helicobacter pylori in Chinese
patients with peptic ulcer disease and those with
chronic gastritis-associated dyspepsia. J. Clin
Microbiol. 35, 1344–1347 (1997).
35. Pan, Z. J. et al. Prevalence of vacuolating cytotoxin
production and distribution of distinct vacA alleles in
Helicobacter pylori from China. J. Infect. Dis. 178,
220–226 (1998).
36. Miehlke, S. et al. Allelic variation in the cagA gene of
Helicobacter pylori obtained from Korea compared to
the United States. Am. J. Gastroenterol. 91,
1322–1325 (1996).
37. Achtman, M. et al. Recombination and clonal
groupings within Helicobacter pylori from different
geographic regions. Mol. Microbiol. 32, 459–470
(1999).
First application of the multilocus sequence
approach to H. pylori from different geographical
regions. This paper showed that weakly clonal
groupings exist despite frequent recombination.
38. Maiden, M. C. et al. Multilocus sequence typing: a
portable approach to the identification of clones
within populations of pathogenic microorganisms.
Proc. Natl Acad. Sci. USA 95, 3140–3145 (1998).
39. Maiden, M. C. Multilocus sequence typing of bacteria.
Annu. Rev. Microbiol. 60, 561–588 (2006).
40. Falush, D., Stephens, M. & Pritchard, J. K. Inference
of population structure using multilocus genotype
data: linked loci and correlated allele frequencies.
Genetics 164, 1567–1587 (2003).
41. Wirth, T. et al. Distinguishing human ethnic groups
by means of sequences from Helicobacter pylori:
lessons from Ladakh. Proc. Natl Acad. Sci. USA 101,
4746–4751 (2004).
42. Bjorkholm, B. et al. Mutation frequency and biological
cost of antibiotic resistance in Helicobacter pylori.
Proc. Natl Acad. Sci. USA 98, 14607–14612 (2001).
The study established that H. pylori has a higher
mutation rate than the Enterobacteriaceae.
43. Kang, J. & Blaser, M. J. Bacterial populations as
perfect gases: genomic integrity and diversification
tensions in Helicobacter pylori. Nature Rev. Microbiol.
4, 826–836 (2006).
44. Salaun, L., Linz, B., Suerbaum, S. & Saunders, N. J.
The diversity within an expanded and redefined
repertoire of phase-variable genes in Helicobacter
pylori. Microbiology 150, 817–830 (2004).
45. Nilsson, C. et al. An enzymatic ruler modulates Lewis
antigen glycosylation of Helicobacter pylori LPS
during persistent infection. Proc. Natl Acad. Sci. USA
(2006).
Phase variation in H. pylori LPS glycosylation genes
during persistent infection suggests a possible
temporal adaptation mechanism to a host niche,
which changes through chronic infection.
46. Aras, R. A. et al. Plasticity of repetitive DNA
sequences within a bacterial (Type IV) secretion system
component. J. Exp. Med. 198, 1349–1360 (2003).
Investigation of the interstrain and intrastrain
variation of the H. pylori cag pathogenicity island
gene cagY in natural infection and experimental
infection, and its possible role in host immune
adaptation.
47. Israel, D. A. et al. Helicobacter pylori genetic diversity
within the gastric niche of a single human host. Proc.
Natl Acad. Sci. USA 98, 14625–14630 (2001).
48. Huang, S., Kang, J. & Blaser, M. J. Antimutator role of
the DNA glycosylase mutY gene in Helicobacter pylori.
J. Bacteriol. 188, 6224–6234 (2006).
49. Mathieu, A., O’Rourke, E. J. & Radicella, J. P.
Helicobacter pylori genes involved in avoidance of
mutations induced by 8-oxoguanine. J. Bacteriol.
188, 7464–7469 (2006).
50. Kraft, C. & Suerbaum, S. Mutation and recombination
in Helicobacter pylori: Mechanisms and role in
generating strain diversity. Int. J. Med. Microbiol.
295, 299–305 (2005).
51. Aras, R. A., Kang, J., Tschumi, A. I., Harasaki, Y. &
Blaser, M. J. Extensive repetitive DNA facilitates
prokaryotic genome plasticity. Proc. Natl Acad. Sci.
USA 100, 13579–13584 (2003).
52. Falush, D. et al. Recombination and mutation during
long-term gastric colonization by Helicobacter pylori:
Estimates of clock rates, recombination size and
minimal age. Proc. Natl Acad. Sci. USA 98,
15056–15061 (2001).
Intrahost evolution was studied using sequence
comparisons from paired sequential H. pylori
isolates from one host. Mathematical modelling
was used to determine quantitative parameters of
recombination and mutation in vivo.
53. Lundin, A. et al. Slow genetic divergence of
Helicobacter pylori strains during long-term
colonization. Infect. Immun. 73, 4818–4822 (2005).
54. Prouzet-Mauleon, V. et al. Pathogen evolution in vivo:
genome dynamics of two isolates obtained 9 years
apart from a duodenal ulcer patient infected with a
single Helicobacter pylori strain. J. Clin. Microbiol.
43, 4237–4241 (2005).
55. Salama, N. R. et al. Genetic analysis of Helicobacter
pylori strain populations colonizing the stomach at
different times post-infection. J. Bacteriol. 189,
3834–3845 (2007).
56. Margulies, M. et al. Genome sequencing in
microfabricated high-density picolitre reactors. Nature
437, 376–380 (2005).
57. Alm, R. A. et al. Genomic-sequence comparison of two
unrelated isolates of the human gastric pathogen
Helicobacter pylori. Nature 397, 176–180 (1999).
First complete genome comparison of two
unrelated strains within one species.
NATURE REVIEWS | MICROBIOLOGY
58. Oh, J. D. et al. The complete genome sequence of a
chronic atrophic gastritis Helicobacter pylori strain:
evolution during disease progression. Proc. Natl Acad.
Sci. USA 103, 9999–10004 (2006).
59. Salama, N. et al. A whole-genome microarray reveals
genetic diversity among Helicobacter pylori strains.
Proc. Natl Acad. Sci. USA 97, 14668–14673 (2000).
60. Gressmann, H. et al. Gain and loss of multiple genes
during the evolution of Helicobacter pylori. PLoS
Genet. 1, e43 (2005).
61. Kraft, C. et al. Genomic changes during chronic
Helicobacter pylori infection. J. Bacteriol. 188,
249–254 (2006).
62. Bjorkholm, B. et al. Comparison of genetic
divergence and fitness between two subclones of
Helicobacter pylori. Infect. Immun. 69, 7832–7838
(2001).
63. Tomb, J.-F. et al. The complete genome sequence of
the gastric pathogen Helicobacter pylori. Nature 388,
539–547 (1997).
64. Alm, R. A. et al. Comparative genomics of Helicobacter
pylori: analysis of the outer membrane protein
families. Infect. Immun. 68, 4155–4168 (2000).
65. Ilver, D. et al. Helicobacter pylori adhesin binding
fucosylated histo-blood group antigens revealed by
retagging. Science 279, 373–377 (1998).
66. Mahdavi, J. et al. Helicobacter pylori SabA adhesin in
persistent infection and chronic inflammation. Science
297, 573–578 (2002).
67. Aspholm-Hurtig, M. et al. Functional adaptation of
BabA, the H. pylori ABO blood group antigen binding
adhesin. Science 305, 519–522 (2004).
Describes the discovery of the association of the
H. pylori adhesin BabA to human ethnic groupings
with different blood-group prevalences. Hints at a
link between adhesive properties and host
adaptation.
68. Backstrom, A. et al. Metastability of Helicobacter
pylori bab adhesin genes and dynamics in Lewis b
antigen binding. Proc. Natl Acad. Sci. USA 101,
16923–16928 (2004).
69. Solnick, J. V., Hansen, L. M., Salama, N. R.,
Boonjakuakul, J. K. & Syvanen, M. Modification
of Helicobacter pylori outer membrane protein
expression during experimental infection of
rhesus macaques. Proc. Natl Acad. Sci. USA 101,
2106–2111 (2004).
Currently, the only published study that shows
H. pylori strain variation arising after experimental
infection in rhesus monkeys.
70. Odenbreit, S., Till, M., Hofreuter, D., Faller, G. & Haas,
R. Genetic and functional characterization of the
alpAB gene locus essential for adhesion of
Helicobacter pylori to human gastric tissue. Mol.
Microbiol. 31, 1537–1548 (1999).
71. Lu, H. et al. Functional and intracellular signalling
differences associated with the Helicobacter pylori
AlpAB adhesin from Western and East Asian strains.
J. Biol. Chem. (2007).
72. Cover, T. L. & Blanke, S. R. Helicobacter pylori VacA, a
paradigm for toxin multifunctionality. Nature Rev.
Microbiol. 3, 320–332 (2005).
73. Gebert, B., Fischer, W., Weiss, E., Hoffmann, R. &
Haas, R. Helicobacter pylori vacuolating cytotoxin
inhibits T lymphocyte activation. Science 301,
1099–1102 (2003).
74. Pagliaccia, C. et al. The m2 form of the Helicobacter
pylori cytotoxin has cell type-specific vacuolating
activity. Proc. Natl Acad. Sci. USA 95, 10212–10217
(1998).
75. Aviles-Jimenez, F. et al. Evolution of the Helicobacter
pylori vacuolating cytotoxin in a human stomach.
J. Bacteriol. 186, 5182–5185 (2004).
76. Carroll, I. M. et al. Microevolution between paired
antral and paired antrum and corpus Helicobacter
pylori isolates recovered from individual patients.
J. Med. Microbiol. 53, 669–677 (2004).
77. Aspinall, G. O. & Monteiro, M. A.
Lipopolysaccharides of Helicobacter pylori strains
P466 and MO19: structures of the O antigen and
core oligosaccharide regions. Biochemistry 35,
2498–2504 (1996).
78. Monteiro, M. A. et al. Simultaneous expression of
type 1 and type 2 Lewis blood group antigens by
Helicobacter pylori lipopolysaccharides. Molecular
mimicry between H. pylori lipopolysaccharides and
human gastric epithelial cell surface glycoforms.
J. Biol. Chem. 273, 11533–11543 (1998).
79. Appelmelk, B. J. et al. Phase variation in Helicobacter
pylori lipopolysaccharide due to changes in the
lengths of poly(C) tracts in α3-fucosyltransferase
genes. Infect. Immun. 67, 5361–5366 (1999).
VOLUME 5 | JUNE 2007 | 451
© 2007 Nature Publishing Group
REVIEWS
80. Wang, G., Ge, Z., Rasko, D. A. & Taylor, D. E. Lewis
antigens in Helicobacter pylori: biosynthesis and
phase variation. Mol. Microbiol. 36, 1187–1196
(2000).
81. Bergman, M. P. et al. Helicobacter pylori modulates
the T helper cell 1/T helper cell 2 balance through
phase-variable interaction between
lipopolysaccharide and DC-SIGN. J. Exp. Med. 200,
979–990 (2004).
The authors report a strain-specific influence on
immune responses associated with phase-variable
expression of lipopolysaccharide outer chains in
H. pylori.
82. Josenhans, C. & Suerbaum, S. Helicobacter pylori:
Molecular and Cellular Biology. (eds Achtman, O. &
Suerbaum, S.) 171–184 (Horizon Scientific Press,
Wymondham, 2001).
83. Niehus, E. et al. Genome-wide analysis of
transcriptional hierarchy and feedback regulation in
the flagellar system of Helicobacter pylori. Mol.
Microbiol. 52, 947–961 (2004).
84. Josenhans, C., Eaton, K. A., Thevenot, T. &
Suerbaum, S. Switching of flagellar motility in
Helicobacter pylori by reversible length variation of
a short homopolymeric sequence repeat in fliP, a
gene encoding a basal body protein. Infect. Immun.
68, 4598–4603 (2000).
85. Thompson, L. J. et al. Chronic Helicobacter pylori
infection with Sydney strain 1 and a newly identified
mouse-adapted strain (Sydney strain 2000) in
C57BL/6 and BALB/c mice. Infect. Immun. 72,
4668–4679 (2004).
86. Sozzi, M., Crosatti, M., Kim, S. K., Romero, J. &
Blaser, M. J. Heterogeneity of Helicobacter pylori
cag genotypes in experimentally infected mice.
FEMS Microbiol. Lett. 203, 109–114 (2001).
87. Figura, N. et al. cagA positive and negative
Helicobacter pylori strains are simultaneously
present in the stomach of most patients with nonulcer dyspepsia: relevance to histological damage.
Gut 42, 772–778 (1998).
88. Covacci, A. & Rappuoli, R. Helicobacter pylori:
molecular evolution of a bacterial quasi-species.
Curr. Opin. Microbiol. 1, 96–102 (1998).
89. Censini, S. et al. cag, a pathogenicity island of
Helicobacter pylori, encodes type I-specific and
disease-associated virulence factors. Proc. Natl
Acad. Sci. USA 93, 14648–14653 (1996).
90. Blomstergren, A., Lundin, A., Nilsson, C., Engstrand,
L. & Lundeberg, J. Comparative analysis of the
complete cag pathogenicity island sequence in four
Helicobacter pylori isolates. Gene 328, 85–93
(2004).
91. Azuma, T. et al. Distinct diversity of the cag
pathogenicity island among Helicobacter pylori
strains in Japan. J. Clin. Microbiol. 42, 2508–2517
(2004).
92. Covacci, A. et al. Molecular characterization of the
128-kDa immunodominant antigen of Helicobacter
pylori associated with cytotoxicity and duodenal
ulcer. Proc. Natl Acad. Sci. USA 90, 5791–5795
(1993).
93. Stein, M. et al. c-Src/Lyn kinases activate
Helicobacter pylori CagA through tyrosine
phosphorylation of the EPIYA motifs. Mol. Microbiol.
43, 971–980 (2002).
94. Selbach, M., Moese, S., Hauck, C. R., Meyer, T. F. &
Backert, S. Src is the kinase of the Helicobacter
pylori CagA protein in vitro and in vivo. J. Biol.
Chem. 277, 6775–6778 (2002).
95. Poppe, M., Feller, S. M., Romer, G. & Wessler, S.
Phosphorylation of Helicobacter pylori CagA by
c-Abl leads to cell motility. Oncogene (2006).
96. Higashi, H. et al. SHP-2 tyrosine phosphatase as an
intracellular target of Helicobacter pylori CagA
protein. Science 295, 683–686 (2002).
97. Hatakeyama, M. & Higashi, H. Helicobacter pylori
CagA: a new paradigm for bacterial carcinogenesis.
Cancer Sci. 96, 835–843 (2005).
98. Naito, M. et al. Influence of EPIYA-repeat
polymorphism on the phosphorylation-dependent
biological activity of Helicobacter pylori CagA.
Gastroenterology 130, 1181–1190 (2006).
This study presents evidence for an influence of
interstrain diversity in CagA types on host
interaction.
99. Higashi, H. et al. Biological activity of the
Helicobacter pylori virulence factor CagA is
determined by variation in the tyrosine
phosphorylation sites. Proc. Natl Acad. Sci. USA 99,
14428–14433 (2002).
100. Andrzejewska, J. et al. Characterization of the pilin
ortholog of the Helicobacter pylori type IV cag
pathogenicity apparatus, a surface-associated
protein expressed during infection. J. Bacteriol.
188, 5865–5877 (2006).
101. Robinson, K., Loughlin, M. F., Potter, R. & Jenks, P.
J. Host adaptation and immune modulation are
mediated by homologous recombination in
Helicobacter pylori. J. Infect. Dis. 191, 579–587
(2005).
102. Loughlin, M. F., Barnard, F. M., Jenkins, D.,
Sharples, G. J. & Jenks, P. J. Helicobacter pylori
mutants defective in RuvC Holliday junction
resolvase display reduced macrophage survival and
spontaneous clearance from the murine gastric
mucosa. Infect. Immun. 71, 2022–2031 (2003).
103. Fischer, W. et al. Systematic mutagenesis of the
Helicobacter pylori cag pathogenicity island:
essential genes for CagA translocation in host cells
and induction of interleukin-8. Mol. Microbiol. 42,
1337–1348 (2001).
104. Rohde, M., Puls, J., Buhrdorf, R., Fischer, W. & Haas,
R. A novel sheathed surface organelle of the
Helicobacter pylori cag type IV secretion system.
Mol. Microbiol. 49, 219–234 (2003).
105. Boren, T., Falk, P., Roth, K. A., Larson, G. &
Normark, S. Attachment of Helicobacter pylori to
human gastric epithelium mediated by blood group
antigens. Science 262, 1892–1895 (1993).
106. Crabtree, J. E. et al. Helicobacter pylori induced
interleukin-8 expression in gastric epithelial cells is
associated with CagA positive phenotype. J. Clin.
Pathol. 48, 41–45 (1995).
452 | JUNE 2007 | VOLUME 5
107. Crabtree, J. E. et al. Mucosal IgA recognition of
Helicobacter pylori 120 kDa protein, peptic
ulceration, and gastric pathology. Lancet 338,
332–335 (1991).
108. Bourzac, K. M. & Guillemin, K. Helicobacter pylorihost cell interactions mediated by type IV secretion.
Cell Microbiol. 7, 911–919 (2005).
109. Christie, P. J., Atmakuri, K., Krishnamoorthy, V.,
Jakubowski, S. & Cascales, E. Biogenesis,
architecture, and function of bacterial type iv
secretion systems. Annu. Rev. Microbiol. 59,
451–485 (2005).
110. Odenbreit, S. et al. Translocation of Helicobacter
pylori CagA into gastric epithelial cells by type IV
secretion. Science 287, 1497–1500 (2000).
111. Tummuru, M. K., Cover, T. L. & Blaser, M. J. Cloning
and expression of a high-molecular-mass major
antigen of Helicobacter pylori: evidence of linkage to
cytotoxin production. Infect. Immun. 61,
1799–1809 (1993).
112. Viala, J. et al. Nod1 responds to peptidoglycan
delivered by the Helicobacter pylori cag
pathogenicity island. Nature Immunol. 5,
1166–1174 (2004).
Acknowledgments
The authors wish to dedicate this article to their long-time
academic teacher and mentor, W. Opferkuch, on the occasion of his 75th birthday. M. Achtman and D. Falush are
acknowledged for many fruitful discussions on bacterial evolution. We also thank three anonymous reviewers for helpful
suggestions. Work in the authors’ laboratories was supported by grants from the German Research Foundation
(DFG), the German Ministry for Education and Research
(Competence network PathoGenoMik and ERA-NET
Pathogenomics - HELDIVNET), the European Commission
(FP6 Integrated Project INCA) and the Volkswagen
Foundation.
Competing interests statement
The authors declare no competing financial interests.
DATABASES
The following terms in this article are linked online to:
Entrez Gene: http://www.ncbi.nlm.nih.gov/entrez/query.
fcgi?db=gene
amiA | babA | cagA | cagC | cagY | fliP | mutY | sabA | VacA |
Entrez Genome Project: http://www.ncbi.nlm.nih.gov/
entrez/query.fcgi?db=genomeprj
Escherichia coli | Helicobacter hepaticus | Helicobacter pylori |
Helicobacter pylori HPAG1 | Helicobacter pylori J99 |
Helicobacter pylori 26695
UniProtKB: http://ca.expasy.org/sprot
AlpA | AlpB | BabA | CagA | CagC | CagY | VacA
FURTHER INFORMATION
MLST databases: http://www.mlst.net
Structure software: http://pritch.bsd.uchicago.edu/
structure.html
Access to this links box is available online.
www.nature.com/reviews/micro
© 2007 Nature Publishing Group