From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
HEMATOPOIESIS
Human BSAP and BLIMP1 conform an autoregulatory feedback loop
Francisco Mora-López,1 Elena Reales,1 José A. Brieva,1 and Antonio Campos-Caro1
1Unidad
de Investigación, Hospital Universitario Puerta del Mar, Cádiz, Spain
B-lymphocyte–induced maturation protein-1
(BLIMP1), encoded by the PRDM1 gene, is a
transcriptional repressor considered a master regulator that is required and sufficient
for plasma cell (PC) differentiation. BLIMP1
represses the PAX5 gene, coding for the
B-cell lineage–specific activator protein
(BSAP), which is required for B-cell identity
and survival. Mutations in PAX5 gene as
well as in PRDM1 gene have been recently
implicated in lymphomas. In the present
study, sequence analysis of PRDM1 gene
revealed a binding site for BSAP transcription factor. By analyzing different human
cell lines, we have found that a specific
nuclear factor for B-cell lines binds to a site
on the PRDM1 promoter. Electrophoretic
mobility shift assays identified this factor as
BSAP, and chromatin immunoprecipitation
assays confirmed its binding in vivo to the
human PRDM1 promoter. Moreover, by ectopically expressing BSAP, and using a
PRDM1 promoter with the BSAP-binding
site mutated, we demonstrated that this factor represses the expression of BLIMP1.
Therefore, repression of PRDM1 by BSAP
reveals an autoregulatory negativefeedback loop that could play a relevant role
in controlling human PC differentiation.
(Blood. 2007;110:3150-3157)
© 2007 by The American Society of Hematology
Introduction
In multicellular organisms, cell development and cell differentiation into many cell types is under the control of transcriptional
factors. In the vertebrate immune system, the B-lymphocyte
developmental pathway represents a model for the analysis of
genetic networks, which orchestrate cell fate specification and
commitment. Plasma cell (PC) differentiation from B lymphocyte depends on the switch-on/-off balance between transcription factors.1,2 In this context, BSAP is a critical transcription
factor required to establish and maintain B-cell lineage identity
until the PC stage.3-5 BSAP is a bifunctional transcription factor
that can, depending on the gene context, either activate transcription of genes involved in maintaining B-cell identity including
CD19,6 Ig␣, BLNK, and CIITA4 or repress transcription of
PC-associated gene commitment such as J chain, IgH, IgL, and
XBP1.7-10 In the absence of PAX5, the gene coding for BSAP,
progenitor B cells acquire the ability to differentiate into
multiple hematopoietic lineages both in vitro and in vivo.11-13
On the other hand, overexpression of PAX5 in the late stage of
B-cell lines and in PC lines leads to increased cell proliferation
and suppression of Ig synthesis.14 Thus, repression of PAX5 is
important for inhibiting B-lymphocyte functions and is required
for PC functions.15,16 Moreover, recent studies demonstrate the
oncogenic role of BSAP by mutations or alterations in the
expression of PAX5 gene.17-21
Murine B-lymphocyte–induced maturation protein-1 (BLIMP1),
or its human homologue positive regulatory domain I binding
factor 1 (PRDI-BF1), is a transcription factor that has been
demonstrated to act as a master regulator required10 and sufficient22
for the generation and for the prolonged maintenance of PCs.23 To
differentiate into PCs, BLIMP1 reduces B-cell proliferation as a
consequence of MYC repression,24 and decreases B-cell functions
as a result of PAX5 repression.25 An essential gene for PC
differentiation indirectly induced by BLIMP1, as well as by IRF4,
is XBP1.25-27 Moreover, BLIMP-1 (PRDM1) has been implicated in
cell growth control through p53 repression28 and in diffuse large
B-cell lymphomas.29,30
BCL6 is another transcription factor that plays a role in the
germinal center reaction and in the inhibition of terminal B-cell
differentiation.31-33 BCL6 acts as repressor of multiple genes,34
including the PRDM1 gene coding for BLIMP1. Direct as well as
indirect mechanisms for this repression have been reported.34-37 At
the same time, BLIMP1 could repress the expression of BCL6.38
Therefore, BCL6 and BLIMP1 together form a reciprocal regulatory loop in which BCL6 and BLIMP1 antagonize each other’s
expression.
Recently, the results obtained using a PAX5-deficient chicken
B-cell line (DT40) as knockout model showed that PAX5⫺/⫺ cells
differentiate to PC fate exhibiting an up-regulation in BLIMP1 and
XBP-1 expression and a down-regulation for BCL6 expression.39
This study suggests that BLIMP1 is up-regulated as consequence
of the low BCL6 levels because of PAX5 deficiency. However, a
simultaneous study using a knockout mouse model where conditional PAX5 inactivation takes place only in mature B cells did not
show PAX5-mediated BCL6 and XBP1 regulation but demonstrated BLIMP1 activation.13 This study proposes that PAX5 could
be involved in the repression of BLIMP1 and the corresponding PC
transcription program.
In the present study, we have identified a BSAP-binding site
onto the first exon of the PRDM1 gene, which has been corroborated by supershift assays. Our results show, for the first time in
vitro, the direct repression of PRDM1 by expression of BSAP
transcription factor. Moreover, BSAP binds to the PRDM1 promoter in vivo, as demonstrated by chromatin immunoprecipitation
(ChIP) assays.
Submitted May 24, 2007; accepted July 30, 2007. Prepublished online
as Blood First Edition paper, August 6, 2007; DOI 10.1182/blood2007-05-092262.
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
The publication costs of this article were defrayed in part by page charge
© 2007 by The American Society of Hematology
3150
BLOOD, 1 NOVEMBER 2007 䡠 VOLUME 110, NUMBER 9
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 1 NOVEMBER 2007 䡠 VOLUME 110, NUMBER 9
Materials and methods
Sequence retrieval and analysis programs
Genomic sequence for PRDM1 genes was retrieved from http://www.ensembl.org (Wellcome Trust Sanger Institute) with accession numbers AL358952
(Homo sapiens), AC027700.11 (Mus musculus), Contig-1099214663548
(Macaca mulata), Contig-RNOR03271653 (Rattus norvegicus), Contig13435 (Bos taurus), Contig-203874 (Dasypus novemcinctus), Contig414711 (Loxodonta Africana), Contig-367418 (Felix catus), Contig564227 (Echinops telfairi), and Contig-0.215 (Gallus domesticus), and
were compared by CLUSTALW (European Bioinformatics Institute, http://
www.ebi.ac.uk/clustalw). For searching transcription factor–binding sites,
the TFSEARCH program (National Institute of Advanced Industrial
Science and Technology, http://www.cbrc.jp/research/db/TFSEARCH.html)
was used.
Cell cultures
Daudi, Raji, NALM-6, Ramos, U266, RPMI-8226, IM-9, NCI-H929,
and HEp-2 cell lines were cultured in RPMI-1640 medium; and HEK293
cell line, in Dulbecco modified Eagle medium, supplemented with 10%
fetal calf serum, glutamine, and antibiotics (100 IU/mL penicillin and
100 ␮g/mL streptomycin).
Isolation of the 5ⴕ flanking region of the human PRDM1 gene
and plasmid construction
The 5⬘-flanking region of the human PRDM1 gene (⫺ 123/⫹ 138) was
isolated by polymerase chain reaction (PCR). Two specific primer genes,
5⬘-GCTAGCAATCTGGGGGAAAG-3⬘ as sense (⫺ 123 bp relative to the
translation start site) and 5⬘-CTCGGCGGTCCCTCCTCG-3⬘ as antisense
(⫹ 138 bp relative to the translation start site and including the entire
exon 1), were selected on the basis of the sequence of the human
PRDM1 genomic DNA accession number AL358952. The resulting PCR
fragment was cloned and sequenced into the pGL3-Basic (pGL3PRDM1) Firefly luciferase reporter vector (Promega, Madison, WI). For
site-directed mutagenesis of the BSAP cis element in the region of the
human PRDM1 promoter, we performed PCR amplification of pGL3PRDM1 wild-type promoter with appropriate mutagenic primers (sense:
5⬘-TCGGCCCTCTTGTATTTCGGAGAGGCAAGAG-3⬘; antisense: 5⬘GCTCTTGCCTCTCCGAAATACAAGAGGG-3⬘). PCR products were
sequence confirmed and cloned and transferred to pGL3-Basic vector,
obtaining a pGL3-PRDM1-BSAPmut vector.
A full-length human BSAP expression vector (pBSAP) was a gift
provided by Dr M. Busslinger,40 and the BSAP cDNA was extracted from
this vector and cloned into the pIRES2-EGFP (Clontech, Palo Alto, CA). To
test the effect of the pBSAP-IRES2-EGFP expression vector, we transfected
the same amount of a control plasmid consisting of pIRES2-EGFP empty
vector.
Transient transfections and luciferase assays
For transfection experiments, Daudi cells were washed and resuspended at
107 cells/mL in serum-free RPMI-1640 medium supplemented with HEPES
(N-2-hydroxyethylpiperazine-N⬘-2-ethanesulfonic acid) 25 mM. One million cells (100 ␮L) were placed in a 0.4-cm electrode gap cuvette and, after
addition of 10 ␮g pGL3-Basic or pGL3-Control plasmids or an equivalent
molar amount of test plasmid along with 1 ␮g pRL-TK Renilla luciferase
vector (Promega) (used as an internal control plasmid for differences in
transfection efficiency), were subjected to electroporation using a Gene
Pulser II apparatus (Biorad, Madrid, Spain). Electrical setting parameters
were approximately 350 ␮F (␶⬃20-30 ms) and 220 V for U266 or 240 V for
Daudi cell lines. Immediately after the pulse, the cells were transferred to a
well containing 900 ␮L antibiotic-free RPMI-1640 medium supplemented
with 20% FCS and incubated at 37°C and 5% CO2. Cells were harvested
approximately 48 hours later, washed with phosphate-buffered saline
(PBS), and lysed, and the luciferase activity was measured using a de Dual
DIRECT REPRESSION OF PRDM1 BY BSAP
3151
luciferase reporter assay kit (Promega) and a Sirius luminometer (Berthold,
Pforzheim, Germany).
For HEK293 cotransfection experiments, the Lipofectamine 2000
system (Invitrogen, Rockville, MD) was used. HEK293 cells were
grown at 37°C with 5% CO2 with 10% serum and were seeded at
2 ⫻ 105 cells in 500 ␮L medium per well in 24-well plates. Plasmids
pBSAP-IRES2-EGFP or empty pIRES2-EGFP (1 ␮g) and pGL3PRDM1 (1 ␮g) and the pRL-TK reporter vector (0.01 ␮g) were mixed
with 2 ␮L Lipofectamine 2000 reagent and added to the wells. HEK293
cells were harvested and the luciferase activity was measured 48 hours
after transfection. Each transfection experiment was undertaken in
triplicate, with at least 2 different plasmid preparations.
Western blotting
Total cell lysates from pBSAP-IRES2-EGFP– or pIRES2-EGFP–
transfected HEK293 cells (⬃ 105) or Daudi cells (⬃ 106) were prepared
in 2 ⫻ lysis buffer (125 mM Tris H-Cl, pH 7.5, ␤-mercaptoethanol 5%,
SDS 4%, glycerol 10%), separated by 10% SDS–polyacrylamide gel
electrophoresis and transferred to polyvinylidenefluoride (PVDF) membranes (Millipore, Billerica, MA). Blots were carried out as described.41
Briefly, PVDF membranes were blocked for 1 hour at 4°C with 5% dry
nonfat milk/PBS and incubated overnight at 4°C with the anti-BSAP
antibody clone 24 (BD Transduction Laboratories, Madrid, Spain) in the
same blocking buffer (1:250). After 3 15-minute washes in TBST
(25 mM Tris-HCl, pH 8, 500 mM NaCl, 25 mM KCl, 0.05% [wt/vol]
Tween-20) and 1 wash with PBS, the membrane was incubated with
secondary antibody in 5% dry nonfat milk/PBS at room temperature for
1 hour. After 3 more 15-minute washes with TBST, the specific protein
was detected by the appropriate secondary alkaline phosphatase–
conjugated antibody and a chromogenic reaction with NBT (nitroblue
tetrazolium) and BCIP (5-bromo-4-chloro-3-indoyl phosphate ptoluidine salt) (Biorad).
Preparation of nuclear extracts and gel mobility shift assays
Nuclear extracts were prepared from cell lines by hypotonic lysis followed
by high salt extraction of nuclei, as described.42 The protein concentrations
of all the extracts were determined by the bicinchoninic acid protein assay
(Pierce, Rockford, IL) with bovine serum albumin as the standard. Nuclear
extracts were stored at ⫺ 70°C until used.
For probe ⫹ 1/⫹ 104, the corresponding human PRDM1 promoter
DNA fragment was digested with HincII and XmaI and end-labeled by
Klenow filling with [␣-32P]dCTP. The human PRDM1 probe ⫹ 28/⫹ 59,
as well the cold fragments for competitions, was obtained by annealing the
complementary oligonucleotides leaving protruding ends, and labeled by
Klenow filling with [␣-32P]dCTP.
DNA-protein–binding assays were carried out in 20-␮L reactions
containing 12% glycerol, 60 mM KCl, 12 mM HEPES (pH 8), 4 mM
Tris (tris(hydroxymethyl)aminomethane)-Cl (pH 8), 1 mM EDTA
(ethylenediaminetetraacetic acid), 1 mM EGTA (ethyleneglycoltetraacetic acid), 1 mM DTT, 20 ng BSA, 1 to 5 ␮g nuclear extracts, and 1 ␮g
poly(dA-dT)(dA-dT) as a nonspecific competitor (Sigma-Aldrich, Madrid, Spain). Reactions were incubated for 10 minutes at room
temperature, the labeled probe (0.1-0.5 ng, ⬃ 2 ⫻ 104 cpm) was added,
and the incubation was continued for an additional 20-minute period.
For competition studies, 10- to 100-fold molar excess competitor DNA
was added to the reaction 10 minutes prior to the labeled probe.
Supershift assays were performed by preincubating nuclear extracts
with the antibody against BSAP (clone 24; BD Transduction Laboratories) or with a mouse IgG nonspecific antibody for 2 hours on ice before
the probe addition. DNA-protein complexes were separated on 6%
nondenaturing polyacrylamide gel in 0.5 ⫻ TBE buffer in a cold room.
The gel was vacuum-dried and visualized by autoradiography.
ChIP assays
Chromatin immunoprecipitation (ChIP) procedure43 was performed as
recommended in the manufacturer’s protocol for Kit EpiQuik (Epigentek, Brooklyn, NY). Briefly, we incubated Daudi cells or NCI-H929
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
3152
BLOOD, 1 NOVEMBER 2007 䡠 VOLUME 110, NUMBER 9
MORA-LÓPEZ et al
Table 1. Oligonucleotide primers used for ChIP assays
Specificity
Primer sequences
PRDM1 exon 1 Sense:
Fragment,
bp
188
5⬘-AAGTGCTGCCGTGACACTC-3⬘;antisense:
5⬘-CTCTACCCAGTCCACATTCTCC-3⬘
CD19 promoter Sense: 5⬘-TTGTGAGTCTGGAGGGTTCC-
177
3⬘;antisense: 5⬘-GGCATGGTGGTCAGACTCTC-3⬘
GADPH exon 4 Sense: 5⬘-CCAGGAGTGAGTGGAAGACAG-
136
3⬘;antisense: 5⬘-GGGAGATGGGGACAGGAC-3⬘
cells (⬃ 106) with 1% formaldehyde for 10 minutes at room temperature. Chromatin was sheared by sonication (Branson Sonifier-150;
(Brauson Ultrasonics, Danbury, CT) microtip probe, 6 ⫻ 15 seconds,
output control 2, hold on ice 1 minute between pulses) performed to an
average size of 200 to 1000 bp. After a spinning step to reduce debris,
immunoprecipitates of cross-linked complexes were prepared using
3 ␮g anti-BSAP antibody (SC-1974X; Santa Cruz Biotechnology, Santa
Cruz, CA). An unspecific antibody (mouse IgG) was carried out as a
control for nonspecific interactions. After incubation at 25°C for
90 minutes on a rocking platform, the bound antibody-protein-DNA
complexes (immunoprecipitates) were washed. After cross-linking
reversal and proteinase K digestion, each individual immunoprecipitate
was purified by elution. PCR reactions were performed with the
corresponding specific primers (Table 1) for 38 to 42 cycles of
amplification, and products were run on a 2% agarose gel and analyzed
by ethidium bromide staining.
Results
Identification of cis elements in PRDM1 promoter
To study the promoter regulation of the human PRDM1 gene, a
genomic fragment, containing approximately 2.3 Kbp upstream
of the initiation start sites and the first exon extracted from
sequence accession number AL358952, was analyzed with the
TFSEARCH program.44 From the many theoretic binding sites
for transcription factors, our attention was attracted to an
intriguing site for BSAP located on the first exon coding for
BLIMP1 (Figure 1A). Although the score matrix obtained for
this factor was not too high (⬃ 72.1), 2 recent works have shown
that in PAX5-deficient B cells (in mouse as animal model or in a
chicken B-cell line) the differentiation to PCs was stimulated.13,39 Moreover, the BLIMP1 transcript levels undergo a
strong induction in PAX5-deficient mature B cells. Then, we
decided to test if this possible binding site for BSAP was
conserved through the evolution, by a phylogenetic analysis of
the sequences of PRDM1 gene originating from different
mammals and from chicken (avian). The program used was
CLUSTALW and the result is shown in Figure 1B. As can be
seen, the main nucleotide positions for the BSAP consensusbinding site were well preserved between the mammal species,
and a satisfactory match exists with the theoretic consensusbinding site. However, although the chicken presents a good
match in sequences compared with mammals, its consensusbinding sequence for BSAP differs much more and lacks 4
central conserved positions for possible binding. Then, on the
basis of the theoretic BSAP-binding site in the human PRDM1
gene, we decided to test if it could, in fact, be functional in
human mature B-cell fate.
Figure 1. BSAP cis element in exon 1 of human PRDM1 gene. (A) Location of
binding sites for transcription factors in a partial sequence of human PRDM1 gene.
Theoretic binding sites for the factor are underlined, and the score obtained with the
TFMATRIX program for binding site matching is shown. Data for BSAP factor are
shaded. (B) Comparison of phylogenetic sequences in exon 1 regions between
mammals and avian species. The BSAP consensus-binding site region (shown in
bold) was obtained with the TFMATRIX program. The most conserved positions are
shaded. Capital and lowercase letters show nucleotides matching or not matching the
theoretic BSAP-binding site, respectively. Note that chicken sequence lacks
4 essential positions against 2 lacking in mammals.
Specific DNA-protein complexes are observed with B-cell
nuclear extracts
To identify if BSAP could bind to the PRDM1 promoter region,
we performed an electrophoretic mobility shift assay (EMSA)
with nuclear extracts from Daudi, Raji, Ramos, and NALM-6
(as B-cell lines), from U266, NCI-H929, RPMI-8226 (as PC cell
lines), and HEp-2 (an epithelial cell line). For this purpose, we
have used as probe a human PRDM1 gene fragment running
from a HincII site up to a SmaI site, both located in the first exon
(Figure 2A). This probe contains the theoretic BSAP-binding
site identified. The EMSA results (Figure 2B) show a different
pattern of protein complexes depending on the nuclear extract
analyzed, with 2 principal retarded complexes observed. One
complex, denoted as complex II, appears in all the nuclear
extracts tested (lymphoid and nonlymphoid cell lines), indicating an unspecific binding or a general binding factor. The other,
denoted complex I, was observed in nuclear extracts from B-cell
line but not in those from PC or HEp-2 cell lines. This
preliminary result suggested to us that probably several different
factors can bind to the PRDM1 promoter and that at least one of
them is specific in B-cell nuclear extracts.
To verify that probability and to locate more accurately
where the protein complexes bind, we decided to carry out
competition assays. To do this, we divided the fragment
corresponding to the probe into 3 smaller fragments, fragment
⫹ 1 ⫹ 27, fragment ⫹ 28 ⫹ 59, and fragment ⫹ 60 ⫹ 104
(Figure 2A), and these were assayed in competition EMSAs
with the intact probe (⫹ 1 ⫹ 104). Daudi nuclear extracts were
used. As shown in Figure 2C, the complex II formation was
Zn⫹⫹ dependent (compare lanes 2, 3), and it was not ablated by
any of the competitive fragments. The same result was obtained
in competition experiments for this complex II, when fragment
⫹ 1 ⫹ 59 or ⫹ 28 ⫹ 104 (data not shown), suggesting that the
binding site for this complex formation was not located on the
excision sequences between smaller fragments. In contrast,
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 1 NOVEMBER 2007 䡠 VOLUME 110, NUMBER 9
DIRECT REPRESSION OF PRDM1 BY BSAP
3153
Figure 2. EMSA comparing nuclear extracts from B lymphocytes and PC lines for specific binding to exon 1 of the human PRDM1 gene. (A) Schematic representation
of the fragment used as probe and the competitive fragments for EMSA. A fragment corresponding to the entire exon 1 (⫹ 1/⫹ 104) was used as probe. Three cold fragments,
divisions of exon 1 (⫹ 1/⫹ 27), (⫹ 28/⫹ 59), (⫹ 60/⫹ 104), were used for competition experiments. (B) EMSA with probe (⫹ 1/⫹ 104) and nuclear extracts from human PC
lines: U266 (myeloma), NCI-H929 (myeloma), RPMI-8226 (myeloma); from human B-cell lines: Daudi (Burkitt lymphoma), Raji (Burkitt lymphoma), Ramos (Burkitt lymphoma),
NALM-6 (pre-B-cell leukemia); or from the epithelial cell line: HEp-2 (laryngeal carcinoma). Lane marked as free probe was nuclear-extract–free. (C) Competition experiments
using the probe (⫹ 1/⫹ 104) and Daudi nuclear extracts. (Lane 1) Probe-free. (Lanes 2,3) Probe with nuclear extract without and with Zn⫹⫹ (0.5 mM) in the binding buffer,
respectively. Competition assays with the corresponding cold fragments (100 ⫻) are shown: (lane 4) ⫹ 1/⫹ 27; (lane 5) ⫹ 28/⫹ 59; and (lane 6) ⫹ 60/⫹ 104.
complex I was apparently Zn⫹⫹ independent, and the fragment
⫹ 28 ⫹ 59 showed an obvious competition (Figure 2C lane 5),
although the other 2 fragments, ⫹ 1 ⫹ 27 and ⫹ 60 ⫹ 104, did
not (Figure 2C lanes 4, 5, respectively). The combined observations that the fragment ⫹ 28 ⫹ 59 included the predicted
BSAP-binding sequence, and that only complex I was present in
B-cell lines nuclear extracts, suggest that BSAP factor could be
involved in the formation of complex I.
genomic fragment ⫺ 123 ⫹ 138, corresponding to the PRDM1
minimal promoter encompassing a small fragment of the 5⬘
upstream of exon 1 and the entire exon 1, was cloned upstream
BSAP binds to the PRDM1 gene exon 1 region
To support the last assumption and to identify the protein
responsible for complex I, we performed EMSA experiments,
but this time with a probe corresponding to the fragment
⫹ 28 ⫹ 59. In addition, the same fragment ⫹ 28 ⫹ 59, but
mutated (⫹ 28 ⫹ 59mut) in the nucleotides most conserved for
BSAP-binding site (Figure 3A), was used in competition
experiments. As can be seen in Figure 3B, the ⫹ 28 ⫹ 59 probe
showed a predominant retarded band (lane 1) corresponding to
complex I obtained with the probe ⫹ 1 ⫹ 104. As expected, the
cold fragment ⫹ 28 ⫹ 59 displaced this complex in a concentration-dependent manner (Figure 3B lanes 2-4). However, no
competition was obtained when the ⫹ 28 ⫹ 59mut fragment for
BSAP-binding site was added to the assays (Figure 3B lanes
5-7). This result demonstrated that complex I is caused by the
BSAP-binding site. However, the crucial result confirming that
the BSAP factor was able to bind to the PRDM1 promoter region
and to produce complex I required supershift assays to be
performed. These experiments, performed with the ⫹ 1 ⫹ 104
probe or with the ⫹ 28 ⫹ 59 probe, are shown in Figure 3C and
3D, respectively. A supershifted band was observed by an
antibody against BSAP (Figure 3C lane 3). Moreover, the BSAP
supershift specificity for complex I could be observed when
compared with complex II (not shifted). The supershift specificity was confirmed when the smaller probe (⫹ 28 ⫹ 59) was
used, and the antibody anti-BSAP was included in a dosedependent manner (Figure 3D). No superretarded complexes
appeared when a control nonrelated antibody was used (Figure
3C lane 4 or Figure 3D lane 6). Moreover, an attenuation of
complex I was observed, thus demonstrating that it contained
BSAP.
BSAP represses the PRDM1 promoter activity
Luciferase reporter assays were used to determine whether
BSAP could be functional for PRDM1 promoter activity. The
Figure 3. BSAP factor identification by specific binding site mutations and
supershift EMSA. (A) Sequence comparison between the BSAP consensus-binding
site and the wild-type fragment (⫹ 28 ⫹ 59) or mutated fragment (⫹ 28 ⫹ 59mut)
sequences corresponding to abolish the possible BSAP-binding site. Bold capital
letters represent the most conserved nucleotides. Capital and lowercase letters
represent the nucleotides matched and unmatched to the consensus-binding site,
respectively. Underlined letters are the mutated ones. (B) EMSA with Daudi nuclear
extracts and the fragment (⫹ 28 ⫹ 59) used as probe (lane 1). Competition
experiments were performed with the cold wild-type fragment (⫹ 28 ⫹ 59) (lanes 2-4)
or mutated fragment (⫹ 28 ⫹ 59mut) (lanes 5,6). Molar ratios of the cold fragment
were 100 ⫻ (lanes 2,5), 50 ⫻ (lanes 3,6), and 10 ⫻ (lanes 4,7) (C) Supershift
experiment with Daudi nuclear extract and probe ⫹ 1/⫹ 104. (Lanes 1 and 2) Probe
without and with extracts, respectively. Antibody against BSAP (1 ␮L) was added
to the assays (lane 3). A nonspecific antibody control (1 ␮g/␮L) was used (lane 4).
(D) Same as panel C, except probe ⫹ 28 ⫹ 59 was used and the antibody against
BSAP was added to the assays in descending concentration (0.1, 0.05, and 0.01 ␮L)
from lane 3 to lane 5. Control nonspecific antibody (lane 6).
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
3154
BLOOD, 1 NOVEMBER 2007 䡠 VOLUME 110, NUMBER 9
MORA-LÓPEZ et al
Figure 5. BSAP binds to the exon 1 of PRDM1 in vivo. Chromatin was prepared
from Daudi cells as a B-cell line expressing BSAP factor (lanes 1-2,5), and from
NCI-H929 cells as a PC cell line not expressing BSAP (lanes 3-4). ChIP analysis was
performed using a specific anti-BSAP antibody (lanes 1,3) or an unspecific antibody
isotype as negative control (lanes 2,4). Products from final PCR analysis using
primers specific to the PRDM1 promoter, CD19 promoter (as BSAP binding positive
control), and exon 4 from GADPH (as BSAP binding negative control) were resolved
by agarose gel. The input DNA for Daudi was amplified in lane 5. A representative
experiment from 3 ChIP experiments is shown. mw indicates molecular weight
marker.
expressed in HEK293-transfected cells, and hence that it could
be responsible for the repression observed, total extracts of
Daudi cells and of HEK293 cells transfected with or without
BSAP encoding cDNA were studied by Western blot. Figure 4D
shows that, except for the enhanced expression, the BSAP
protein expressed in HEK293 BSAP-transfected cells was
similar to the endogenous BSAP in Daudi cells. No BSAP
expression was observed in mock HEK293-transfected cells.
Thus, all these results show that BSAP plays a repressor role in
the regulation of PRDM1 gene expression.
In vivo association of human BSAP with PRDM1 exon 1
Figure 4. BSAP represses PRDM1 through the binding site onto the exon 1.
(A) Schematic representation showing the construction of reporter plasmids containing the putative minimal promoter of PRDM1 (pGL3-PRDM1) or with the mutated
BSAP-binding site (pGL3-PRDM1-BSAPmut). (B) Daudi cells were transiently
transfected with the pGL3-PRDM1 or pGL3-PRDM1-BSAPmut luciferase reporters.
Relative luciferase activity was normalized to pGL3-PRDM1. Error bars represent
SEM from at least 4 experiments. (C) HEK293 cells were transiently cotransfected
with the pGL3-PRDM1 luciferase reporter and with the empty pIRES2-GFP or
pBSAP-IRES2-GFP expression vectors. The relative luciferase activity from the
empty pIRES2-GFP was used as 100%. Error bars represents SEM from at least
4 experiments. (D) A Western blot from cotransfected HEK293 cells (without
endogenous BSAP expression) and Daudi cell as control of endogenous BSAP
expression is shown. A total of 105 and 106 of HEK293 and Daudi cells per well were
loaded, respectively.
of the luciferase gene and used in our reporter assays (Figure
4A). Two constructs, the putative minimal promoter luciferase
construct (pGL3-PRDM1) and another in which the BSAPbinding site was mutated (pGL3-PRDM1-BSAPmut, with the
same changes used in the competition experiment, Figure 3A),
were transfected into the Daudi cells. The promoter activity was
much lower (Figure 4B) in Daudi cells with the putative BSAP
promoter than with the mutated BSAP promoter, suggesting that
endogenous BSAP expressed by Daudi cells (Figure 4D) was
repressing the BLIMP1 expression. In addition, the construct
pGL3-PRDM1 was cotransfected with a BSAP-expressing vector in HEK293 cells (as BSAP-negative cells). Figure 4C shows
that the transcriptional activity of the basal PRDM1 promoter
was repressed. To demonstrate that BSAP protein was properly
To examine whether BSAP binds to PRDM1 promoter in vivo,
ChIP assays were performed. Human cell lines expressing
(Daudi cells) or not expressing (NCI-H929 cells) BSAP were
used for these analyses. As can be seen (Figure 5), PCR results
indicated an enrichment for the PRDM1 gene, as well as for
human CD19 promoter used as positive control, in Daudi cell
samples (but not in NCI-H929 samples) immunoprecipitated
with an antibody anti-BSAP. Thus, we conclude that BSAP
binds to PRDM1 exon 1 in vivo, providing strong evidence that
BSAP participates in the transcriptional repression of PRDM1.
Discussion
In this study, we have characterized the transcriptional repression
of the PRDM1 gene by the BSAP transcription factor. Using
specialized software to analyze the human PRDM1 gene, we
recognized a probable BSAP-binding site present on its promoter.
Considering that BLIMP1 has an essential role in leading
B lymphocytes to differentiate into PCs,22,23,45,46 we decided to
study in more detail the possible role of this binding site in the
human PRDM1 promoter. Despite continuous improvements in
sensitivity and accuracy, the computational methods for predicting
transcription factor–binding sites in gene promoter regions often
give numerous false-positive hits.47,48 The matrix score for the
consensus-binding sequence for BSAP is highly variable; the
definition of this sequence is as follows: NCNNNRNKCANNGNWGNRKRGCSRSN, where the italic letters are the most conserved positions and the bold letters are the most conserved ones
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 1 NOVEMBER 2007 䡠 VOLUME 110, NUMBER 9
for the PRDM1 gene in all mammals tested (Figure 1B). The
phylogenetic sequence analysis indicates that, in mammals, the
region encompassing the BSAP-binding site is especially preserved
compared with the adjacent sequences. This suggests that this
binding site could be functionally significant, and accordingly, the
possibility that BSAP binds to and represses the human PRDM1
promoter was examined.
The use of a PRDM1 exon 1 probe that includes the putative
BSAP-binding site in EMSA revealed that nuclear extracts from
B-cell lines showed a retarded pattern different from that
exhibited by PC and HEp-2 cell lines. A slow retarded complex
(complex II) was present in all nuclear extracts tested and
suggests that it is composed of nonlineage-dependent common
factors. It is possible that this complex II (unidentified) takes
part in the basic regulatory transcriptional activity for the
PRDM1 gene, and its identification requires further analysis.
Nevertheless, based on the finding that the BSAP is specific and
necessary for B-cell lineage activation5,11,16 and the presence of
the complex I retarded only in B-cell lines, we wished to confirm
that BSAP was binding to the PRDM1 promoter. This assumption was demonstrated by competition as well as by supershift
experiments in EMSA. Other evidence indicates that BSAP
repressed the PRDM1 by binding to the consensus sequence
located in the exon 1. First, ChIP assays revealed that BSAP
binds to the PRDM1 promoter in Daudi cell line (a BSAPpositive cell line). Secondly, when this cell line was transfected
with the mutated BSAP-binding site PRDM1 promoter, a 100%
increase in the luciferase activity was observed. Finally, we
performed cotransfection experiments using the HEK293 cell
line with a reporter gene containing the PRDM1 minimal
promoter and a human BSAP expression vector. In these assays,
a luciferase activity reduction of around 75% was observed. All
these data together demonstrate that the human PRDM1 promoter contains a binding site for BSAP and that, functionally, it
acts as a repressor of transcription. This is in disagreement with
previous data obtained in mouse LPS-treated splenic B cells
where ectopic expression of BSAP did not alter the BLIMP1
mRNA levels.25 The discrepancy between these results could be
explained either by the different cellular systems used or by
differences in the regulatory transcription of the PRDM1 gene
between murine and human species.
Recent studies, using the chicken DT40 B-cell line as a
knockout model,39 show that PAX5⫺/⫺ cells exhibit an increased
BLIMP1 and XBP-1 expression and a BCL6 down-regulation.
The XBP-1 up-regulation and the BCL6 down-regulation are
both postulated to be consequences of a direct BSAP deficiency.
This result is in accordance with that obtained by others, where a
BSAP overexpression reduced the XBP-1 minimal promoter
activity in B cells,9 but in disagreement with the observation it
remains unaffected upon conditional short-term loss of PAX5 in
mouse mature B cells.13 Shaffer et al38 were the first to postulate
that a reciprocal regulatory loop might exist whereby BCL6 and
BLIMP1 antagonize the expression of each other. Nera et al39
have suggested that PAX5 is not needed for the suppression of
BLIMP1, and that the up-regulation observed for BLIMP1
expression is due to a drop in the BCL6 expression caused by
BSAP deficiency. Simultaneous results, obtained in a conditional knockout mouse model,13 are in contrast with those
obtained with the chicken DT40 B-cell model.39 The study
described by Delogu et al13 in a mouse model did not reveal a
role for PAX5 in the regulation of BCL6 and XBP-1. However,
an up-regulation of BLIMP1 expression was observed only in
DIRECT REPRESSION OF PRDM1 BY BSAP
3155
mature B cells but not in pro-B cells. They suggest that both
BSAP and BCL6 appear to be involved in the repression of
BLIMP1 and the subsequent PC transcription program. The
discrepancy in results observed between these studies13,39 has
been considered to be due to the PAX5 deficiency being
originated in different maturational states of B cells.15 However,
the possibility of a difference in the regulation of B-cell
activation between species cannot be excluded. In this context,
the comparison of the BSAP-binding sequence of the PRDM1
promoter between human (or mouse) and chicken revealed a
significantly reduced matching of the chicken sequences (CAGCCCTCCAGTGTCTCGGAAAGGCA) with respect to the BSAPbinding consensus sequence (NCNNNRNKCANNGNWGNRKRGCSRSN). This observation may mean that differences
exist between mammals and avian species in the mechanism
regulating the B cell to PC differentiation process.
At the level of the germinal center reaction, the relationship
between the B lymphocytes and PC transcriptional programs is
one of mutual exclusion. At least 3 master regulators, BLIMP1,10
XBP-1,49 and IRF4,27 are required for PC differentiation.
Moreover, the simultaneous absence of BCL635 and PAX525 is
required too. Considering that, in germinal center mature
B cells, PAX5 and BCL6 are positive, a repression of these
factors, or alternatively, an induction in the expression of
BLIMP1, must occur to allow the PC differentiation program.
A loop between BLIMP1 and BCL6 has been suggested in which
each one must suppress to the other,36-38 even though, in
disagreement with that, an induction of both factors has been
described in human B lymphocytes after IL-21 treatment.50
BLIMP1 directly represses transcription of PAX525 and increased transcription of PRDM1 takes place in PAX5-deficient
B cells.13,39 Present data reveal for the first time that BSAP
directly mediates BLIMP1 repression. In line with our findings,
in B cells from multiple myeloma patients, the low PAX5
expression is associated with increased BLIMP1 expression.51
Before now, the mutually excluding expression patterns observed between BSAP and BLIMP1 were explained by BLIMP1dependent repression of PAX5.25 From now on, we conclude that
a reciprocal regulatory loop may exist whereby BSAP and
BLIMP1 antagonize the expression of each other, at least in
mature B cells.13 In this loop, BLIMP1 represses the crucial
transcription factors for B cells, BCL6 and PAX5, which in turn
repress BLIMP1, giving rise to a double-negative–feedback
loop ensuring irreversible changes in cell fate (Figure 6). The
transcriptional functions of these master regulators are complex,
involving both gene activation and repression.
Figure 6. Negative-feedback loop between BSAP and BLIMP1. Schematic
interaction loop that must exist between BSAP and BLIMP1 factors in the B-lymphocyte
differentiation process.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
3156
BLOOD, 1 NOVEMBER 2007 䡠 VOLUME 110, NUMBER 9
MORA-LÓPEZ et al
The results obtained in this work provide evidence of human
PRDM1 gene transcriptional regulation that ensures B cells
achieve the correct PC differentiation. A recent work had
revealed a phase prior to BLIMP-1 expression in which several
genes normally repressed by BSAP are re-expressed, suggesting
that plasma-cell differentiation is initiated by the inhibition of
PAX5 function.46 Here, we demonstrated that PRDM1 gene is
directly repressed by BSAP and therefore PAX5 repression is
required for BLIMP-1 expression and full plasma cell
differentiation.
Acknowledgments
This work was supported by grants from Fondo de Investigaciones
Sanitarias-Ministerio de Sanidad y Consumo (G03/136 and
PI052357) and by grants from Consejerı́a de Salud-Junta de
Andalucı́a (201/03 and 203/00).
The authors thank Dr Meinrad Busslinger (Research Institute of
Molecular Pathology, Vienna, Austria) for providing the human
BSAP full-length cDNA.
Authorship
Contribution: F.M.-L. designed research, did experiments, and
analyzed data; E.R. prepared samples and performed experiments;
A.C.-C. and J.A.B. designed research and wrote the paper.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Antonio Campos-Caro, Unidad de Investigación, 9a Planta, Hospital Universitario Puerta del Mar, Avda. Ana de
Viya, 21, 11009 Cádiz, Spain; e-mail: antonio.campos.exts@
juntadeandalucia.es.
References
1. Lin KI, Tunyaplin C, Calame K. Transcriptional
regulatory cascades controlling plasma cell differentiation. Immunol Rev. 2003;194:19-28.
2. Shapiro-Shelef M, Calame K. Regulation of
plasma-cell development. Nat Rev Immunol.
2005;5:230-242.
3. Busslinger M. Transcriptional control of early B
cell development. Annu Rev Immunol. 2004;22:
55-79.
Ig high producer cell with plasma cell phenotype. J Immunol. 1997;158:3197-3204.
15. Nera KP, Lassila O. Pax5: a critical inhibitor of
plasma cell fate. Scand J Immunol. 2006;64:190199.
16. Cobaleda C, Schebesta A, Delogu A, Busslinger
M. Pax5: the guardian of B cell identity and function. Nat Immunol. 2007;8:463-470.
4. Horcher M, Souabni A, Busslinger M. Pax5/BSAP
maintains the identity of B cells in late B lymphopoiesis. Immunity. 2001;14:779-790.
17. Mullighan CG, Goorha S, Radtke I, et al. Genome-wide analysis of genetic alterations in
acute lymphoblastic leukaemia. Nature. 2007;
446:758-764.
5. Nutt SL, Eberhard D, Horcher M, Rolink AG, Busslinger M. Pax5 determines the identity of B cells
from the beginning to the end of B-lymphopoiesis.
Int Rev Immunol. 2001;20:65-82.
18. Souabni A, Jochum W, Busslinger M. Oncogenic
role of Pax5 in the T-lymphoid lineage upon ectopic expression from the immunoglobulin heavychain locus. Blood. 2007;109:281-289.
6. Kozmik Z, Wang S, Dorfler P, Adams B, Busslinger M. The promoter of the CD19 gene is a
target for the B-cell-specific transcription factor
BSAP. Mol Cell Biol. 1992;12:2662-2672.
19. Yu D, Allman D, Goldschmidt MH, Atchison ML,
Monroe JG, Thomas-Tikhonenko A. Oscillation
between B-lymphoid and myeloid lineages in
Myc-induced hematopoietic tumors following
spontaneous silencing/reactivation of the EBF/
Pax5 pathway. Blood. 2003;101:1950-1955.
7. Rinkenberger JL, Wallin JJ, Johnson KW, Koshland ME. An interleukin-2 signal relieves BSAP
(Pax5)-mediated repression of the immunoglobulin J chain gene. Immunity. 1996;5:377-386.
8. Singh M, Birshtein BK. NF-HB (BSAP) is a repressor of the murine immunoglobulin heavychain 3⬘ alpha enhancer at early stages of Bcell differentiation. Mol Cell Biol. 1993;13:36113622.
9. Reimold AM, Ponath PD, Li YS, et al. Transcription factor B cell lineage-specific activator protein
regulates the gene for human X-box binding protein 1. J Exp Med. 1996;183:393-401.
10. Shapiro-Shelef M, Lin KI, McHeyzer-Williams LJ,
Liao J, McHeyzer-Williams MG, Calame K.
Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma
memory B cells. Immunity. 2003;19:607-620.
11. Nutt SL, Heavey B, Rolink AG, Busslinger M.
Commitment to the B-lymphoid lineage depends
on the transcription factor Pax5. Nature. 1999;
401:556-562.
12. Mikkola I, Heavey B, Horcher M, Busslinger M.
Reversion of B cell commitment upon loss of
Pax5 expression. Science. 2002;297:110-113.
13. Delogu A, Schebesta A, Sun Q, Aschenbrenner
K, Perlot T, Busslinger M. Gene repression by
Pax5 in B cells is essential for blood cell homeostasis and is reversed in plasma cells. Immunity. 2006;24:269-281.
14. Usui T, Wakatsuki Y, Matsunaga Y, Kaneko S,
Koseki H, Kita T. Overexpression of B cell-specific activator protein (BSAP/Pax-5) in a late B
cell is sufficient to suppress differentiation to an
20. Krenacs L, Himmelmann AW, Quintanilla-Martinez L, et al. Transcription factor B-cell-specific
activator protein (BSAP) is differentially expressed in B cells and in subsets of B-cell lymphomas. Blood. 1998;92:1308-1316.
21. Sadakane Y, Zaitsu M, Nishi M, et al. Expression
and production of aberrant PAX5 with deletion of
exon 8 in B-lineage acute lymphoblastic leukaemia of children. Br J Haematol. 2007;136:297300.
22. Turner CA Jr, Mack DH, Davis MM. Blimp-1, a
novel zinc finger-containing protein that can drive
the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell. 1994;77:297-306.
23. Shapiro-Shelef M, Lin KI, Savitsky D, Liao J, Calame K. Blimp-1 is required for maintenance of
long-lived plasma cells in the bone marrow. J Exp
Med. 2005;202:1471-1476.
24. Lin Y, Wong K, Calame K. Repression of c-myc
transcription by Blimp-1, an inducer of terminal B
cell differentiation. Science. 1997;276:596-599.
25. Lin KI, Angelin-Duclos C, Kuo TC, Calame K.
Blimp-1-dependent repression of Pax-5 is required for differentiation of B cells to immunoglobulin M-secreting plasma cells. Mol Cell Biol.
2002;22:4771-4780.
26. Shaffer AL, Shapiro-Shelef M, Iwakoshi NN, et al.
XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases protein synthesis in plasma cell differentiation. Immunity. 2004;21:81-93.
27. Klein U, Casola S, Cattoretti G, et al. Transcrip-
tion factor IRF4 controls plasma cell differentiation and class-switch recombination. Nat Immunol. 2006;7:773-782.
28. Yan J, Jiang J, Lim CA, Wu Q, Ng HH, Chin KC.
BLIMP1 regulates cell growth through repression
of p53 transcription. Proc Natl Acad Sci U S A.
2007;104:1841-1846.
29. Tam W, Gomez M, Chadburn A, Lee JW, Chan
WC, Knowles DM. Mutational analysis of
PRDM1 indicates a tumor-suppressor role in
diffuse large B-cell lymphomas. Blood. 2006;
107:4090-4100.
30. Liu YY, Leboeuf C, Shi JY, et al. Rituximab plus
CHOP (R-CHOP) overcomes PRDM1-associated
resistance to chemotherapy in patients with diffuse large B-cell lymphoma. Blood. 2007;110:
339-344.
31. Dent AL, Shaffer AL, Yu X, Allman D, Staudt LM.
Control of inflammation, cytokine expression, and
germinal center formation by BCL-6. Science.
1997;276:589-592.
32. Ye BH, Cattoretti G, Shen Q, et al. The BCL-6
proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nat Genet. 1997;
16:161-170.
33. Cattoretti G, Chang CC, Cechova K, et al. BCL-6
protein is expressed in germinal-center B cells.
Blood. 1995;86:45-53.
34. Shaffer AL, Yu X, He Y, Boldrick J, Chan EP,
Staudt LM. BCL-6 represses genes that function
in lymphocyte differentiation, inflammation, and
cell cycle control. Immunity. 2000;13:199-212.
35. Reljic R, Wagner SD, Peakman LJ, Fearon DT.
Suppression of signal transducer and activator of
transcription 3-dependent B lymphocyte terminal
differentiation by BCL-6. J Exp Med. 2000;192:
1841-1848.
36. Vasanwala FH, Kusam S, Toney LM, Dent AL.
Repression of AP-1 function: a mechanism for
the regulation of Blimp-1 expression and B lymphocyte differentiation by the B cell lymphoma-6 protooncogene. J Immunol. 2002;169:
1922-1929.
37. Tunyaplin C, Shaffer AL, Angelin-Duclos CD, Yu
X, Staudt LM, Calame KL. Direct repression of
prdm1 by Bcl-6 inhibits plasmacytic differentiation. J Immunol. 2004;173:1158-1165.
38. Shaffer AL, Lin KI, Kuo TC, et al. Blimp-1 orchestrates plasma cell differentiation by extinguishing
the mature B cell gene expression program. Immunity. 2002;17:51-62.
39. Nera KP, Kohonen P, Narvi E, et al. Loss of Pax5
promotes plasma cell differentiation. Immunity.
2006;24:283-293.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 1 NOVEMBER 2007 䡠 VOLUME 110, NUMBER 9
40. Nutt SL, Morrison AM, Dorfler P, Rolink A, Busslinger M. Identification of BSAP (Pax-5) target
genes in early B-cell development by loss- and
gain-of-function experiments. EMBO J. 1998;17:
2319-2333.
41. Towbin H, Staehelin T, Gordon J. Electrophoretic
transfer of proteins from polyacrylamide gels to
nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A. 1979;76:43504354.
42. Schreiber E, Matthias P, Muller MM, Schaffner W.
Rapid detection of octamer binding proteins with
‘mini-extracts,’ prepared from a small number of
cells. Nucleic Acids Res. 1989;17:6419.
43. Orlando V, Strutt H, Paro R. Analysis of chromatin
DIRECT REPRESSION OF PRDM1 BY BSAP
structure by in vivo formaldehyde cross-linking.
Methods. 1997;11:205-214.
44. Heinemeyer T, Wingender E, Reuter I, et al. Databases on transcriptional regulation: TRANSFAC,
TRRD and COMPEL. Nucleic Acids Res. 1998;
26:362-367.
45. Kallies A, Nutt SL. Terminal differentiation of lymphocytes depends on Blimp-1. Curr Opin Immunol. 2007;19:156-162.
46. Kallies A, Hasbold J, Fairfax K, et al. Initiation of
plasma-cell differentiation is independent of the
transcription factor Blimp-1. Immunity. 2007;26:
555-566.
47. Li X, Zhong S, Wong WH. Reliable prediction of
transcription factor binding sites by phylogenetic
3157
verification. Proc Natl Acad Sci U S A. 2005;102:
16945-16950.
48. Holloway DT, Kon M, DeLisi C. Integrating
genomic data to predict transcription factor binding. Genome Inform. 2005;16:83-94.
49. Reimold AM, Iwakoshi NN, Manis J, et al. Plasma
cell differentiation requires the transcription factor
XBP-1. Nature. 2001;412:300-307.
50. Ozaki K, Spolski R, Ettinger R, et al. Regulation
of B cell differentiation and plasma cell generation
by IL-21, a novel inducer of Blimp-1 and Bcl-6.
J Immunol. 2004;173:5361-5371.
51. Borson ND, Lacy MQ, Wettstein PJ. Altered
mRNA expression of Pax5 and Blimp-1 in B cells
in multiple myeloma. Blood. 2002;100:46294639.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2007 110: 3150-3157
doi:10.1182/blood-2007-05-092262 originally published
online August 6, 2007
Human BSAP and BLIMP1 conform an autoregulatory feedback loop
Francisco Mora-López, Elena Reales, José A. Brieva and Antonio Campos-Caro
Updated information and services can be found at:
http://www.bloodjournal.org/content/110/9/3150.full.html
Articles on similar topics can be found in the following Blood collections
Hematopoiesis and Stem Cells (3432 articles)
Immunobiology (5489 articles)
Signal Transduction (1930 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.