TLR-Activated Gap Junction Channels
Protect Mice against Bacterial Infection
through Extracellular UDP Release
This information is current as
of June 17, 2017.
Juliang Qin, Guangxu Zhang, Xiaoyu Zhang, Binghe Tan,
Zhangsheng Lv, Mingyao Liu, Hua Ren, Min Qian and Bing
Du
J Immunol published online 18 January 2016
http://www.jimmunol.org/content/early/2016/01/15/jimmun
ol.1501629
Permissions
Email Alerts
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2016 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Subscription
Published January 18, 2016, doi:10.4049/jimmunol.1501629
The Journal of Immunology
TLR-Activated Gap Junction Channels Protect Mice against
Bacterial Infection through Extracellular UDP Release
Juliang Qin, Guangxu Zhang, Xiaoyu Zhang, Binghe Tan, Zhangsheng Lv,
Mingyao Liu, Hua Ren, Min Qian, and Bing Du
M
icrobial-derived pathogen-associated molecular patterns (PAMPs), such as LPS and Pam3CSK4, are some
of the strongest triggers of immune responses. However, numerous types of stimuli including mechanical trauma,
ischemia, stress, and environmental cues also trigger an innate
immune response through releasing pathogen-free mediators,
which are collectively termed as damage-associated molecular
patterns (DAMPs) (1). Meanwhile, as a kind of special stress to
immune cells, the invading pathogen could also induce the release
of DAMPs. In the past decades, most studies have focused on
PAMP-induced secretion of cytokines, chemokines, and IFNs,
whereas the internal relationship between DAMPs and PAMPs in
innate immune responses has not been well investigated (2).
Therefore, it is of interest to explore the function and mechanism
of DAMPs release in infectious diseases.
Central among the most widely studied DAMPs are HMGB1,
heat shock proteins, and extracellular nucleotides such as ATP and
UDP. As the first described purinergic transmission agent, ATP has
Shanghai Key Laboratory of Regulatory Biology, Institute of Biomedical Sciences,
School of Life Sciences, East China Normal University, Shanghai 200241, China
ORCID: 0000-0002-5402-6527 (B.D.).
Received for publication July 21, 2015. Accepted for publication December 16, 2015.
This work was supported by National Basic Research Program of China Grant
2012CB910404; National Natural Science Foundation of China Grants 81272369,
81172816, and 31570896; Ministry of Education of China Doctoral Fund
20130076110013; Fundamental Research Funds for the Central Universities; and
Science and Technology Commission of Shanghai Municipality Grant 15JC1401500.
Address correspondence and reprint requests to Dr. Bing Du, Institute of Biomedical
Sciences, School of Life Sciences, East China Normal University, 500 Dongchuan
Road, Shanghai 200241, China. E-mail address: [email protected]
Abbreviations used in this article: AOI, atractylenolide I; BMM, bone marrow–derived
macrophage; CBX, carbenoxolone; DAMP, damage-associated molecular pattern;
eUDP, extracellular UDP; FFA, flufenamic acid; GJC, gap junction channel; LB,
Luria–Bertani; PAMP, pathogen-associated molecular pattern; WT, wild-type.
Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1501629
been well investigated in a series of physiological functions, including different infectious diseases (3–5). However, the study of
UDP/P2Y6 became increasingly popular only after it was described as an immune mediator of microglial phagocytosis in 2007
(6). Since then, more and more evidence has shown the important
role of UDP/P2Y6 signaling in the regulation of immune responses
in bacterial infection (7–9) and even in atherosclerotic lesion
development (10). Moreover, the apoptotic cells could release
UDP as find-me signals through pannexin hemichannels that recruit motile phagocytes, leading to the prompt clearance of dying
cells (11, 12). However, whether and how UDP was released in
bacterial infection still need to be further explored.
It has been shown that injured or infected cells can release
nucleotides through exocytosis, blebbing or passage via a plasma
membrane channel. Among them, gap junction channels (GJCs)
play important roles in cell–cell communications through the direct transfer of ions, second messengers, and other molecules including Ag peptides (13, 14). Generally, each GJC contains a
serial docking of two hemichannels, which are composed of six
protein subunits called connexins and pannexins (15). Although
connexin 43 was first uncovered in heart muscle cells and plays
important roles in heart development (16, 17), connexin 43 is
expressed ubiquitously, in contrast to most connexin isoforms,
which are restrictively expressed and their malfunction results
in disorders such as deafness, skin diseases, fertility problems,
and lens cataracts (18). Multiple immune cells have also been
shown to express connexins. Among them, dendritic cells and
monocytes/macrophages express connexin and can form functional gap junctions between identical as well as different cells
(19, 20). Most notably, connexin can be upregulated when the
immune cells become exposed to inflammatory factors, but the
role of them in purinergic signaling–mediated immune regulation is poorly defined (21). Our previous study has shown that
virus-infected cells release UDP through pannexin hemichannels
that facilitate IFN-b production (22). Also, we have reported the
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Extracellular UDP (eUDP), released as a danger signal by stressed or apoptotic cells, plays an important role in a series of
physiological processes. Although the mechanism of eUDP release in apoptotic cells has been well defined, how the eUDP is
released in innate immune responses remains unknown. In this study, we demonstrated that UDP was released in both Escherichia
coli–infected mice and LPS- or Pam3CSK4-treated macrophages. Also, LPS-induced UDP release could be significantly blocked by
selective TLR4 inhibitor Atractylenolide I and selective gap junction inhibitors carbenoxolone and flufenamic acid (FFA),
suggesting the key role of TLR signaling and gap junction channels in this process. Meanwhile, eUDP protected mice from
peritonitis by reducing invaded bacteria that could be rescued by MRS2578 (selective P2Y6 receptor inhibitor) and FFA. Then,
connexin 43, as one of the gap junction proteins, was found to be clearly increased by LPS in a dose- and time-dependent manner.
Furthermore, if we blocked LPS-induced ERK signaling by U0126, the expression of connexin 43 and UDP release was also
inhibited dramatically. In addition, UDP-induced MCP-1 secretion was significantly reduced by MRS2578, FFA, and P2Y6
mutation. Accordingly, pretreating mice with U0126 and Gap26 increased invaded bacteria and aggravated mice death. Taken
together, our study reveals an internal relationship between danger signals and TLR signaling in innate immune responses, which
suggests a potential therapeutic significance of gap junction channel–mediated UDP release in infectious diseases. The Journal of
Immunology, 2016, 196: 000–000.
2
TLR-TRIGGERED UDP ENHANCES ANTIBACTERIAL IMMUNITY
protective role of UDP and P2Y6 in bacterial infection, but
whether and how UDP is released in bacterial infection are still
unknown.
In this study, we demonstrated that UDP is released from macrophages mainly through connexin-mediated GJCs during bacterial
infection. Then, extracellular UDP (eUDP) plays a nonredundant
role in promoting host survival from Escherichia coli–induced
peritonitis through activating P2Y6 and facilitating MCP-1 production. Furthermore, we also showed that TLR-activated ERK
signaling is not only involved in proinflammatory cytokine production but also can regulate innate immune responses via increasing UDP release. Taken together, our findings demonstrated a
potential therapeutic significance of TLR-activated GJCs in fighting
against bacterial infection through UDP release.
Animals
For peritoneal macrophages and bone marrow–derived macrophages
(BMMs) isolation as well as the peritonitis mouse model, female 6- to 8wk-old C57BL/6 mice were purchased from the Shanghai Laboratory
Animal Company (Shanghai, China). The P2Y6 knockout mice were prepared
as described previously (22). All mice used in these experiments were housed
under pathogen-free conditions and were maintained in accordance with institutional guidelines. All experimental protocols were approved by the Animal
Investigation Committee of East China Normal University.
Cell culture
BMMs and peritoneal macrophages were obtained as described previously
(23). The mouse macrophage cell line RAW 264.7 was obtained from the
American Type Culture Collection (Manassas, VA). BMMs and RAW
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 1. Characterization of
UDP release during bacterial infection. (A) E. coli 0111:B4 (1 3 108
CFU/ml) or PBS was injected into
the mouse abdominal cavity. Then,
eUDP was detected using Transcreener UDP2 FP Assay kit at different time points, and UDP was
calculated according to a standard
curve. (B) RAW 264.7 cells were
stimulated with LPS for 24 h at different concentrations, and then, cell
viability was appraised by the MTS
assay. (C and D) RAW 264.7 cells
were treated with LPS at different
concentrations for 12 h (C) or with
100 ng/ml LPS for the indicated
times (D), and then, cell supernatants
were collected to detect the release of
eUDP. (E) BMMs were stimulated
with 100 ng/ml LPS at the times indicated, and then, cultured cell supernatants were collected and subjected
to eUDP assay. (F) RAW 264.7 cells
were treated with 100 ng/ml LPS or
PAM3CSK4 for 12 h to detect the release of eUDP. (G) RAW 264.7 cells
were treated with 100 ng/ml LPS or
100 mM AOI for 6 h to detect the
release of eUDP. Data are presented
as mean 6 SEM (n = 3, *p , 0.05,
**p , 0.01, ***p , 0.001).
Materials and Methods
The Journal of Immunology
264.7 were maintained in DMEM containing 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin, at 5% CO2 and 95% humidity, with
drugs added at the times indicated.
MTS assay
MTS assay was performed using MTS reagent, according to the manufacturer’s instructions. Briefly, cells were seeded at a density of 1 3 104
cells/well in 96-well plates and allowed to grow overnight. Then, cells
were treated as indicated. After 24-h incubation with LPS (Sigma-Aldrich,
St. Louis, MO) and Atractylenolide I (AOI; Sigma-Aldrich), 20 ml MTS
was added to each well and incubated for 2 h at 37˚C, and then, the absorbance was measured at 490-nm wavelength using a microplate reader.
Cell viability of the no treatment group was normalized to 100%.
UDP assay
RAW 264.7 cells and BMMs were seeded into 24-well plates (Corning
Costar, Corning, NY) at 6 3 104 cells/well overnight and then changed to
phenol red-free DMEM. Subsequently, cells were infected with LPS for
the indicated amount of time after treating with or without inhibitors. As
recommended by the manufacturer of Tran screener UDP2 FP Assay Kit
(Bellbrook Labs), 15 ml supernatant was added into 384-well plate for the
fluorescence polarization assay.
BMMs and RAW 264.7 cells were stimulated with different concentrations
of LPS or inhibitors for 1 h, and total RNA was isolated by applying
TRIzol reagent (Invitrogen), according to the manufacturer’s protocol. cDNA
was synthesized with 500 ng RNA using a reverse transcription kit
(Prime Script First Strand cDNA Synthesis kit (TAKARA, Dalian, China),
according to the manufacturer’s instructions. One microliter of template
from 10-fold diluted cDNA was subjected to quantification of cytokine
expression using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA), and
the data were analyzed by the ECO Real Time PCR System (Illumina, San
Diego, CA). The sequence-specific primers are shown in Tables I and II.
FIGURE 2. Bacterial infection induces UDP
release through connexin-mediated gap junctions
and protects mice from bacterial infection. (A)
RAW 264.7 cells were pretreated with or without
1 mM CBX, 5 mM NEM, and 10 mM FFA for 1 h
before being stimulated with LPS as the indicated
time. UDP release was measured by Transcreener
UDP2 FP Assay kit. (B and C) WT (B) and P2Y6
knockout (C) mice received an i.p. injection of PBS
(300 ml), UDP (100 mM), MRS2578 (10 mM), and
FFA (10 mM) as indicated before infection with
1 3 108 CFU E. coli 0111:B4 (n = 3). Twelve hours
after i.p. injection of E. coli, peritoneal fluid was
lavaged with 3 ml PBS and then diluted 10-fold in
PBS, and 20 ml of the bacterial suspension was
cultured on solid LB medium for 12 h to count
CFU. (D) Appropriated concentration of E. coli
was treated with UDP as shown, and then, bacteria
were cultured in solid LB medium for 12 h. (E)
Mice were received an i.p. injection of PBS (300
ml), UDP (100 mM), MRS2578 (10 mM), and FFA
(10 mM) as indicated (n = 10). (F) WT (n = 8) and
P2Y6 knockout (n = 7) mice were received an i.p.
injection of PBS (300 ml) and UDP (100 mM) as
indicated. Twelve hours later, 1 3 108 CFU E. coli
0111:B4 were injected into the mouse abdominal
cavity. Then, mouse survival was checked every 2 h
for the next 48 h. Data are presented as mean 6
SEM (*p , 0.05, **p , 0.01, ***p , 0.001).
ELISA for MCP-1
For ELISA assay, RAW 264.7 cells or peritoneal macrophages were seeded
into 12-well plates at 1 3 105/well and incubated overnight. Cells were
preincubated with or without 10 mM MRS2578 for 30 min and then
stimulated with 100 mM UDP or LPS for 12 h, respectively. The concentration of MCP-1 in the supernatant was measured using the mouse
MCP-1 ELISA Set, as recommended by the manufacturer (BioLegend).
Western blotting
RAW 264.7 were seeded in 6-well plates (Corning Costar) and stimulated
with LPS at the times indicated and at different dose. The concentration of
protein was measured by bicinchoninic acid assay (Pierce) and equalized
to the same concentration with the extraction reagent. Samples were separated by 12% SDS-PAGE and transferred to polyvinylidene fluoride
membranes (Bio-Rad, Hercules, CA). After incubation with phosphoERK1/2, ERK1/2, phospho-AKT, AKT, b-actin, phospho-p65, and p65 Ab
(Cell Signaling Technology, Danvers, MA), the polyvinylidene fluoride
membranes were incubated with appropriate HRP-conjugated secondary
Abs (Sigma-Aldrich). Finally, the ECL (Pierce, Rockford, IL) method was
applied to detect those proteins.
Proliferation assay of bacteria
Transfer of a single colony from an E. coli 0111:B4 plate into 2 ml
Luria–Bertani (LB) liquid medium at 220 rpm and 37˚C for 16 h and
the bacteria was diluted 1:100 for another 2 h vigorous shaking to
prepare the E. coli in log phase. Then, the E. coli was treated with 0,
100, 500, and 1000 mM UDP, respectively, for 12 h, and then, bacteria were cultured in solid LB medium to get the single clone for
counting.
Peritonitis mouse infection model
Six- to eight-week-old C57BL/6 female mice were chosen to induce
bacteria-mediated peritonitis. Peritoneal bacteria and survival curves were
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
RNA isolation and RT-PCR
3
4
TLR-TRIGGERED UDP ENHANCES ANTIBACTERIAL IMMUNITY
Table I.
Sequence-specific primers for connexin family genes
Gene Name
Primers (59-39)
Size (bp)
Connexin 26
CGGAAGTTCATGAAGGGAGAGAT (sense)
ACGAGTCCTTTCAGGTTTTCTGG (antisense)
TCAAAATGGCTCTTTTGCCTC (sense)
CTTGGAGCTTGCGCTTTTGGG (antisense)
GGCTTGGTTTTCAGAGATAG (sense)
GAGTTGTGTTACCTGCTGC (antisense)
TGAAAGAAAGGAGATGGG (sense)
GCTTTTAAGGAAACGGAC (antisense)
TCCATCAAACCTTCCCTC (sense)
TTCTCTCTCCATAACTCCCTC (antisense)
AAACCATCTTCATCCTCTTC (sense)
GCTTTTCTGTCTACCTAAAACC (antisense)
TACTGCCCAGTCTTTGTCTGCTGC (sense)
CACACCATTATGATCTGGAAGACC (antisense)
TTTGGCAAGTCACGGCAGGG (sense)
TTGTCACTGTGGTAGCCCTGAGG (antisense)
CCCCACTCTCACCTATGTCTCC (sense)
ACTTTTGCCGCCTAGCTATCCC (antisense)
AAAGAGCAGAGCCAACCAAA (sense)
GTCCCAAACCCTAAGTGAAGC (antisense)
GGAAAGGCCACAGGGTTTCCTGG (sense)
GGGTCCAGGAGGACCAACGG (antisense)
TCCAAGTTCACCTGCAACACG (sense)
GGAGATGACCACTATCTGGAAGACC (antisense)
GGAAGGAGGATGAGAAAG (sense)
GAGAATGGAGGAGGAAAG (antisense)
GGGCATCTTGGGCTACACT (sense)
GCCGAGTTGGGATAGGG (antisense)
531
Connexin 29
Connexin 30
Connexin 31
Connexin 32
Connexin 33
Connexin 36
Connexin 40
Connexin 43
Connexin 45
Connexin 47
Connexin 50
GAPDH
detected to reflect the protective effect of UDP. To count peritoneal fluid
E. coli, mice were divided randomly into six groups and pretreated with
an i.p. injection of 300 ml PBS, 100 mM UDP (Sigma-Aldrich), 10 mM
FFA (Sigma-Aldrich), 10 mM MRS2578 (Sigma-Aldrich), 10 mM U0126
(GeneOperation, Ann Arbor, MI), and 10 mM Gap26 (GL Biochem,
Shanghai, China). Twelve hours later, each mouse was challenged with
E. coli 0111:B4 through i.p. injection. After 12 h, E. coli were lavaged
with 3 ml PBS from each mouse’s abdominal cavity and then diluted 10fold in PBS, and 20 ml bacterial suspension was cultured in solid LB
medium for 12 h. Single CFU were counted to determine peritoneal fluid
E. coli. Another six groups were divided and treated as described above,
but instead of counting peritoneal fluid E. coli, the mice were checked
every 2 h to monitor the survival.
Statistical analysis
Data are presented as mean 6 SEM (n = 3–6). Statistical significance was
evaluated with the Student t test or one-way ANOVA, followed by Dunnett’s multiple comparison. A p value , 0.05 was considered significant.
For survival curve analysis, the log-rank test was performed, and a
p value , 0.05 was considered significant.
Results
UDP is released during bacterial infection
To elucidate the potential significance of eUDP in antibacterial
immune responses, we measured the UDP release using the
Transcreener UDP2 FP Assay kit in both E. coli–infected mice and
369
364
391
386
296
311
519
313
331
111
462
261
LPS- or Pam3CSK4-treated macrophages. As shown in Fig. 1A, a
persistent increase of eUDP was observed in the peritoneal cavity
of mice challenged with E. coli 0111:B4 for 24 h. To exclude the
potential influence of LPS on cell viability, RAW 264.7 cells were
treated with gradient concentration of LPS. Little influence on cell
viability was observed in LPS-treated cells (Fig. 1B), whereas
eUDP was obviously induced by LPS in a dose (Fig. 1C)- and
time (Fig. 1D)-dependent manner in RAW 264.7 cells. This kind
of UDP release could also be observed in LPS-treated BMMs in a
time-dependent manner (Fig. 1E). Similar data can also be seen
in Pam3CSK4-treated cells (Fig. 1F). Furthermore, LPS-induced
UDP release could be rescued obviously by AOI (a selective inhibitor to TLR4) (24), suggesting the important role of TLR signaling in UDP release (Fig. 1G).
TLR triggers UDP release through GJCs
Generally, the specific channel inhibitors such as N-ethylmaleimide (NEM, a specific inhibitor to exocytosis), carbenoxolone (CBX, a nonspecific pannexin channel inhibitor), and
flufenamic acid (FFA, a specific connexin channel inhibitor) are
powerful tools for investigating the mechanism of DAMPs’ release.
In contrast to LPS-induced ATP release (25), LPS-induced UDP
release was significantly inhibited by both CBX and FFA but not
NEM, suggesting the key role of gap junctions in this process.
Table II. Sequence-specific primers for connexin 43/MCP-1
Connexin 43 for Q-PCR
MCP-1 for Q-PCR
GAPDH for Q-PCR
Q-PCR, quantitative PCR.
Primers (59-39)
Size (bp)
CGGTTGTGAAAATGTCTGCTATG (sense)
GGCACAGACACGAATATGATCTG (antisense)
CCTGCTGTTCACAGTTGC (sense)
GCTTCAGATTTACGGGTC (antisense)
ACAGTCCATGCCATCACTGCC (sense)
GCCTGCTTCACCACCTTCTTG (antisense)
87
181
266
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Connexin 46
154
The Journal of Immunology
Furthermore, FFA reduced UDP release much more than CBX,
implying that LPS-induced UDP release mainly occurs through
connexin channels (Fig. 2A).
UDP release enhances host defense against invading bacteria
in a peritonitis mouse model
FIGURE 3. LPS-mediated UDP release
through connexin 43. (A) RNA from RAW
264.7 cells was isolated to quantify expression of the connexin family using RTPCR assay. (B and C) RNA from RAW
264.7 cells and BMMs was isolated to
quantify the expression of connexin 43 using RT-PCR assay. (D and E) RNA from
dose-dependent (12 h) or time-dependent
(100 ng/ml) RAW 264.7 cells was isolated
to quantify the expression of connexin 43
using quantitative RT-PCR. (F) RAW 264.7
cells were treated with 100 ng/ml LPS at
the indicated times. Connexin 43 was detected by Western blot analysis. Data are
presented as mean 6 SEM (n = 3, *p , 0.05,
**p , 0.01, ***p , 0.001).
Connexin 43 was highly increased by LPS
As mentioned before, GJCs are composed of different connexins
proteins. Therefore, we checked the expression level of connexin
family members in RAW 264.7 cells (Tables I, II). As shown in
Fig. 3A, connexin 43 was most abundant in RAW 264.7 cells.
Interestingly, the expression of connexin 43 was also obviously
increased by LPS in RAW 264.7 (Fig. 3B) and BMMs (Fig. 3C).
Furthermore, the expression of connexin 43 could also be increased by LPS in a dose (Fig. 3D)- and time-dependent (Fig. 3E)
manner. Similarly, protein levels of connexin 43 were increased
significantly by LPS at 12 h (Fig. 3F). These data suggested the
potential role of connexin 43 in LPS-mediated immune responses.
Connexin 43 was increased through ERK signaling
To explore the mechanism of LPS-induced connexin 43 expression,
we assessed the LPS-induced signaling by Western blotting assay.
As shown in Fig. 4A and 4B, the phosphorylation of P65, AKT,
and ERK was increased by LPS in a dose- and time-dependent
manner. Then, we pretreated the cells with U0126 (inhibitor to
MEK1/2), Bay 11-7082 (inhibitor to NF-kB), and Ly294002 (inhibitor to PI3K/Akt) to appraise the influence of those signaling
pathways on LPS-induced expression of connexin 43. As shown in
Fig. 4C, the LPS-induced RNA expression of connexin 43 was
clearly reduced by U0126, which is a specific inhibitor to ERK
signaling. In contrast, little change was seen in Bay 11-7082– and
Ly294002-treated cells. Furthermore, the expression of connexin
43 at the protein level could also be reduced by U0126, suggesting
the key role of ERK signaling in LPS-induced connexin 43 expression (Fig. 4D). In addition, UDP release was also measured in
U0126- and Gap26-treated cells. (Fig. 4E) Consistent with the
inhibition of connexin 43 expression, UDP release was clearly
reduced by the ERK inhibitor U0126 and Gap26 (connexin 43
blocker peptide).
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
A series of studies has shown the protective role of UDP in bacterial
infection. Therefore, to further confirm the potential role of UDP
release in host defense against invading bacteria, we set up a mouse
peritonitis model by i.p. injection of E. coli 0111:B4 to monitor the
clearance of bacteria and mouse survival. As shown in Fig. 2B, the
total quantity of bacteria in the peritoneal cavity was reduced in
UDP-injected mice, and this kind of protection could be rescued
by the P2Y6-specific inhibitor MRS2578. In addition, if we treated
the mice with FFA to block UDP release, the invading bacteria
were also increased. Furthermore, the total quantity of bacteria in
the peritoneal cavity was increased in P2Y62/2 mice and UDPinduced clearance to bacteria also reduced obviously in P2Y62/2
mice (Fig. 2C). Although the proliferation of E. coli 0111 was
little changed by high concentration of UDP (Fig. 2D), similar
data were also observed in the mouse survival assay; the survival
of infected mice could be increased from 30 to 60% if the mice
were treated with UDP. In contrast, if we treated the mice with
FFA to block UDP release and MRS2578 to inhibit P2Y6 signaling, the mice were all dead within 31 and 38 h, respectively
(Fig. 2E). To further confirm the key role of P2Y6 in antibacterial
immune responses, we infected the wild-type (WT) and P2Y62/2
mice with E. coli 0111:B4 to monitor the mouse survival. As
shown in Fig. 2F, the survival of P2Y62/2 mice was decreased
obviously, and UDP-mediated protection also eliminated in
P2Y62/2 mice (Fig. 2F). These data further confirmed the protective role of endogenous UDP release and P2Y6 in bacterial
infection.
5
6
TLR-TRIGGERED UDP ENHANCES ANTIBACTERIAL IMMUNITY
eUDP was involved in LPS-induced MCP-1 production
As the initial step in antibacterial immune responses, chemokinemediated immune cell recruitment is important. As shown in
Fig. 5A, the expression of MCP-1 is dramatically increased by
UDP in RAW 264.7 cells. Interestingly, UDP- and LPS-induced
MCP-1 expression could also be blocked by the P2Y6-specific
antagonist MRS2578, implying that UDP/P2Y 6 signaling is
involved in LPS-induced immune responses. Accordingly, the
protein level of MCP-1 in LPS-untreated or -treated cells was
both increased obviously by UDP, and this kind of activation
could be blocked by P2Y6-specific inhibitor MRS2578 (Fig. 5B),
and similar data also confirmed in P2Y62/2 peritoneal macrophages (Fig. 5C). Also, we pretreated cells with the plasma
membrane channel inhibitors FFA, CBX, and NEM to explore
the key role of nucleotide release in LPS-induced MCP-1 production. The LPS-induced MCP-1 production was blocked by
FFA, which can also prevent LPS-induced UDP release. In
contrast, the LPS-induced MCP-1 production was poorly influenced by CBX and NEM, which are involved in pannexin
channels and exocytosis (Fig. 5D). To further confirm the role of
UDP/P2Y6 signaling in LPS-induced MCP-1 production, we
treated WT and P2Y62/2 peritoneal macrophages with LPS for
12 and 24 h. Similar to the data in RAW 264.7 cells, the RNA
(Fig. 5E) and protein (Fig. 5F) level of MCP-1 was increased by
LPS in both WT and P2Y62/2 peritoneal macrophages, whereas
both the basal level and the LPS-induced expression of MCP-1
were much lower in P2Y62/2 peritoneal macrophages. Thus,
these data further confirmed the key role of P2Y6 in LPS-induced
immune responses.
Connexin 43–mediated UDP release protects mice from
bacterial infection
To investigate the role of connexin 43–mediated UDP release in
antibacterial immunity, we pretreated the acute peritonitis mouse
model with ERK inhibitors and the connexin 43 blocking peptide.
As shown in Fig. 6A, the residual bacteria in the abdominal cavity
were significantly increased by pretreating the mice with U0126
and Gap26. Consequently, the survival of infected mice was also
decreased dramatically by U0126 and Gap26 (Fig. 6B). Thus, our
results suggest a critical role of connexin 43–mediated UDP release in the regulation of immune response and pathogen clearance in bacterial infection (Fig. 6C).
Discussion
As the first defense against invaded pathogen, innate immune cells
recognize PAMPs through pattern recognition receptors to initiate
systemic immune responses. Therefore, communication between
immune cells is a crucial part in this process. In this paper, we
demonstrated a novel, to our knowledge, communication strategy
between immune cells that relies on the formation of connexinbased gap junctions and eUDP release. First, we showed a persistent accumulation of eUDP in both the abdominal cavity of
infected mice and LPS- or Pam3CSK4-treated cell supernatant.
Consistent with our previous data, released UDP can protect mice
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 4. LPS upregulates connexin 43 expression through ERK signaling. (A and B) RAW
264.7 cells were treated with different concentrations of LPS for 30 min and with 100 ng/ml LPS at
the indicated times. Proteins involved in LPS-associated signaling and b-actin were detected by
Western blot analysis. (C) RAW 264.7 cells were
pretreated with 1 mM Bay11, 10 mM U0126, or
1 mM Ly294002 for 1 h and then exposed to 100
ng/ml LPS for 12 h. RNA from RAW 264.7 cells
was isolated to quantify the signal protein expression
by quantitative RT-PCR. Results are normalized to
the expression of b-actin. (D) RAW 264.7 cells were
pretreated with or without 10 mM U0126 for 1 h.
RAW 264.7 cells were treated with 100 ng/ml LPS
at 12 h. Connexin 43 was detected by Western blot
analysis. (E) RAW 264.7 cells were pretreated with
10 mM U0126 or Gap26 for 1 h before stimulated by
LPS. After 12 h, UDP release was measured by
Transcreener UDP2 FP Assay kit. Data are presented
as mean 6 SEM (n = 3, *p , 0.05, **p , 0.01,
***p , 0.001).
The Journal of Immunology
7
from bacterial infection through increasing MCP-1 production.
Accordingly, if we blocked endogenous UDP release by FFA or
U0126, the survival of infected mice reduced obviously, suggesting the crucial role of UDP release in antibacterial immune
responses.
Extracellular nucleotides were first termed a find-me signal from
dying cells to enhance phagocyte recruitment. Then, more and
more papers have published damage-induced nucleotide release
and its predominant role in different pathological and physiological
processes (26–29). In contrast to pathogen-induced inflammation,
sterile inflammation was activated by the detection of endogenous
signals. Among them, extracellular ATP has been well recognized
as an endogenous signaling molecule in immunity and inflammation (30). Actually, extracellular nucleotides are tightly controlled by both cell membrane channels and ectonucleotidases,
which are also involved in balancing immune responses. Thus,
extracellular nucleotide signaling and metabolism is a dynamic
area of research with important opportunities for novel treatments
for inflammatory or infectious diseases (31).
As the initiation of inflammation during infection, endogenous
nucleotides can be released through multiple channels to regulate
immune responses at different times. For example, ATP can be
released via exocytosis 30 min after challenged by bacterial infection, both in vivo and in vitro (25, 32). We also found that UDP
could be highly released through pannexin channel in 24 h after
virus infection. Therefore, it implied that the release of endogenous nucleotides is also accurately regulated by distinct infection.
Interestingly, we observed a long-term and persistent release of
UDP after bacterial infection, whereas the mechanism seems
different from viral infection. The LPS-induced UDP release can
be dramatically blocked by the connexin channel inhibitor FFA,
but only slight UDP release was reduced by the pannexin channel
inhibitor CBX, which was found to almost totally block virus
induced UDP release (Fig. 2A). It has been well accepted that
pannexin channels can be activated by caspases during apoptosis;
however, the reason why connexin channels were activated in
LPS-treated cells still needs to be further explored.
As the most important pattern recognition receptors in the innate
immune system, TLRs sense the invasion of microbes by recognizing their PAMPs and activate intracellular signaling pathways
leading to the expression of genes responsible for inflammatory
and immune responses (33). About 10 human and 12 mouse TLRs
were identified, each of which has distinct recognition patterns.
Interestingly, although the recognition patterns of each TLR are
different, the downstream signaling of each TLR is similar. TLR
ligands induce formation of homodimers or heterodimers of TLRs
to recruit MyD88 and dissociate IL-1R–associated kinase. Then,
IL-1R–associated kinase interacts with TNFR-associated factor 6
and recruits TAK1 to phosphorylate IKKb and MAPK (34). As
shown in Fig. 1F, both LPS and Pam3CSK4 can induce UDP re-
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 5. Released eUDP induces the
expression of MCP-1. (A) RAW 264.7 cells
were treated with 100 ng/ml LPS, 300 mM
UDP, and 10 mM MRS2578 for 1 h. RNA
from RAW 264.7 cells was isolated to
quantify MCP-1 expression by quantitative
RT-PCR. (B) RAW 264.7 cells were treated
with 100 ng/ml LPS, 300 mM UDP, and 10
mM MRS2578 for 24 h. Then, the cell supernatants were collected to detect MCP-1
by ELISA. (C) WT and P2Y6 knockout
peritoneal macrophages were pretreated
with different concentration of UDP for
24 h. Then, the cell supernatants were collected to detect MCP-1 by ELISA. (D)
RAW 264.7 cells were pretreated with or
without FFA, NEM, and CBX for 1 h before
LPS. RNA from RAW 264.7 cells was
isolated to quantify MCP-1 expression by
quantitative RT-PCR. (E) Peritoneal macrophages from WT and P2Y62/2 mice were
treated with 100 ng/ml LPS for 12 h. RNA
was isolated to quantify MCP-1 expression
by quantitative RT-PCR. (F) Peritoneal
macrophages from WT and P2Y62/2 mice
were treated with 100 ng/ml LPS for 24 h.
Then, the cell supernatants were collected
to detect MCP-1 by ELISA. Data are
presented as mean 6 SEM (*p , 0.05,
**p , 0.01, ***p , 0.001).
8
TLR-TRIGGERED UDP ENHANCES ANTIBACTERIAL IMMUNITY
lease, implying that the connexin-mediated UDP release through
a classical and common TLR signaling pathway. Therefore, we
pretreated the cells with U0126, Bay11, and Ly294002 to explore
the key role of ERK, NF-kB, and AKT signaling in TLR-induced
UDP release. As shown in Fig. 4C and 4D, the expression of
connexin 43 was reduced obviously by U0126 both in mRNA
and protein level, whereas LPS-induced connexin 43 was little
changed by Bay11 and Ly294002. Consequently, LPS-induced
UDP release, also inhibited by U0126 and connexin 43 blocking
peptide Gap26, suggested the fundamental role of ERK activated
connexin 43 in UDP release. More interestingly, like most other
P2Y receptors, P2Y6 is coupled with Gq to activate PLCb and
MAPKs (35). Also, protein kinase C and Erk1/2 has been found to
play an important role in P2Y6-mediated antiapoptotic functions
(36). That is to say, LPS increased ERK signaling could induce
UDP release and then eUDP bound to P2Y6 further enhanced
ERK activation, which constitutes a positive feedback loop in the
initiation of innate immune responses. These findings provide
solid evidence that eUDP could serve as a positive regulator in
macrophage mediated innate immunity.
To further elucidate the important role of eUDP and P2Y6 in
TLR mediated innate immune responses, we treated RAW 264.7
cells with UDP and the P2Y6 inhibitor MRS2578. As shown in
Fig. 5, both UDP and LPS can increase MCP-1 expression obviously. However, LPS-induced MCP-1 production could be restrained by MRS2578 or P2Y6 deficiency obviously, suggested
UDP/P2Y6 signaling also being involved in LPS mediated immune
responses. Furthermore, the blocking of connexin 43–mediated
UDP release by FFA can also decrease LPS-induced MCP-1 production. Accordingly, the clearance of invaded bacteria and mice
survival in the acute peritonitis mouse model was depressed by
U0126 and Gap26, which further confirmed the pivotal role of
connexin 43–mediated GJC in the fight against bacterial infection. Taken together, our study reveals the internal relationship
between danger signals and TLR signaling in innate immune
responses, which suggest a potential therapeutic significance of
the GJC and UDP/P2Y6-associated signaling pathway in the
prevention and control of bacterial diseases.
Disclosures
The authors have no financial conflicts of interest.
References
1. Feldman, N., A. Rotter-Maskowitz, and E. Okun. 2015. DAMPs as mediators of
sterile inflammation in aging-related pathologies. Ageing Res. Rev. 24(Pt A): 29–
39.
2. Ibrahim, Z. A., C. L. Armour, S. Phipps, and M. B. Sukkar. 2013. RAGE and
TLRs: relatives, friends or neighbours? Mol. Immunol. 56: 739–744.
3. Graziano, F., M. Desdouits, L. Garzetti, P. Podini, M. Alfano, A. Rubartelli,
R. Furlan, P. Benaroch, and G. Poli. 2015. Extracellular ATP induces the rapid
release of HIV-1 from virus containing compartments of human macrophages.
Proc. Natl. Acad. Sci. USA 112: E3265–E3273.
4. Proietti, M., V. Cornacchione, T. Rezzonico Jost, A. Romagnani, C. E. Faliti,
L. Perruzza, R. Rigoni, E. Radaelli, F. Caprioli, S. Preziuso, et al. 2014. ATPgated ionotropic P2X7 receptor controls follicular T helper cell numbers in
Peyer’s patches to promote host-microbiota mutualism. Immunity 41: 789–
801.
5. Amaral, E. P., S. C. Ribeiro, V. R. Lanes, F. M. Almeida, M. R. de Andrade,
C. C. Bomfim, E. M. Salles, K. R. Bortoluci, R. Coutinho-Silva, M. H. Hirata,
et al. 2014. Pulmonary infection with hypervirulent Mycobacteria reveals a
crucial role for the P2X7 receptor in aggressive forms of tuberculosis. PLoS
Pathog. 10: e1004188.
6. Koizumi, S., Y. Shigemoto-Mogami, K. Nasu-Tada, Y. Shinozaki, K. Ohsawa,
M. Tsuda, B. V. Joshi, K. A. Jacobson, S. Kohsaka, and K. Inoue. 2007. UDP
acting at P2Y6 receptors is a mediator of microglial phagocytosis. Nature 446:
1091–1095.
7. Ben Yebdri, F., F. Kukulski, A. Tremblay, and J. Sévigny. 2009. Concomitant
activation of P2Y(2) and P2Y(6) receptors on monocytes is required for TLR1/2induced neutrophil migration by regulating IL-8 secretion. Eur. J. Immunol. 39:
2885–2894.
8. Kim, B., H. K. Jeong, J. H. Kim, S. Y. Lee, I. Jou, and E. H. Joe. 2011. Uridine
59-diphosphate induces chemokine expression in microglia and astrocytes
through activation of the P2Y6 receptor. J. Immunol. 186: 3701–3709.
9. Zhang, Z., Z. Wang, H. Ren, M. Yue, K. Huang, H. Gu, M. Liu, B. Du, and
M. Qian. 2011. P2Y(6) agonist uridine 59-diphosphate promotes host defense
against bacterial infection via monocyte chemoattractant protein-1‑mediated
monocytes/macrophages recruitment. J. Immunol. 186: 5376–5387.
10. Garcia, R. A., M. Yan, D. Search, R. Zhang, N. L. Carson, C. S. Ryan, C. SmithMonroy, J. Zheng, J. Chen, Y. Kong, et al. 2014. P2Y6 receptor potentiates
pro-inflammatory responses in macrophages and exhibits differential roles in
atherosclerotic lesion development. PLoS One 9: e111385.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 6. Function and mechanism of released
eUDP during the bacterial infection. (A) Mice received an i.p. injection of PBS (300 ml), U0126 (10
mM), and Gap26 (10 mM) before infection with E.
coli 0111:B4 (13 108 CFU). After i.p. injection of
E. coli for 12 h, peritoneal fluid was lavaged with
3 ml PBS and then diluted 10-fold in PBS, and 20
ml of the bacterial suspension was cultured in solid
LB medium for 12 h. Data are presented as mean 6
SEM (n = 3, *p , 0.05, **p , 0.01). (B) Mice
received an i.p. injection of 300 ml PBS (same with
Fig. 2E), 100 mM UDP (same with Fig. 2E), 10 mM
U0126 (n = 9), and 10 mM Gap26 (n = 10) before
infection with E. coli 0111:B4, respectively, for
12 h, and then, 1 3 108 CFU E. coli 0111:B4 were
injected into the mouse abdominal cavity. Then, the
mice were checked every 2 h for the next 48 h
(p , 0.05 by log-rank test). (C) Model showing
the function and mechanism of released UDP
during bacterial infection.
The Journal of Immunology
24. Ji, G., R. Chen, and J. Zheng. 2014. Atractylenolide I inhibits
lipopolysaccharide-induced inflammatory responses via mitogen-activated protein kinase pathways in RAW264.7 cells. Immunopharmacol. Immunotoxicol.
36: 420–425.
25. Ren, H., Y. Teng, B. Tan, X. Zhang, W. Jiang, M. Liu, W. Jiang, B. Du, and
M. Qian. 2014. Toll-like receptor-triggered calcium mobilization protects mice
against bacterial infection through extracellular ATP release. Infect. Immun. 82:
5076–5085.
26. Gulbransen, B. D., M. Bashashati, S. A. Hirota, X. Gui, J. A. Roberts,
J. A. MacDonald, D. A. Muruve, D. M. McKay, P. L. Beck, G. M. Mawe, et al.
2012. Activation of neuronal P2X7 receptor-pannexin-1 mediates death of enteric neurons during colitis. Nat. Med. 18: 600–604.
27. Kim, J. E., and T. C. Kang. 2011. The P2X7 receptor-pannexin-1 complex decreases muscarinic acetylcholine receptor-mediated seizure susceptibility in
mice. J. Clin. Invest. 121: 2037–2047.
28. Woehrle, T., L. Yip, A. Elkhal, Y. Sumi, Y. Chen, Y. Yao, P. A. Insel, and
W. G. Junger. 2010. Pannexin-1 hemichannel‑mediated ATP release together
with P2X1 and P2X4 receptors regulate T-cell activation at the immune synapse.
Blood 116: 3475–3484.
29. Schenk, U., A. M. Westendorf, E. Radaelli, A. Casati, M. Ferro, M. Fumagalli,
C. Verderio, J. Buer, E. Scanziani, and F. Grassi. 2008. Purinergic control of
T cell activation by ATP released through pannexin-1 hemichannels. Sci. Signal.
1: ra6.
30. Bours, M. J., E. L. Swennen, F. Di Virgilio, B. N. Cronstein, and P. C. Dagnelie.
2006. Adenosine 59-triphosphate and adenosine as endogenous signaling molecules in immunity and inflammation. Pharmacol. Ther. 112: 358–404.
31. Idzko, M., D. Ferrari, and H. K. Eltzschig. 2014. Nucleotide signalling during
inflammation. Nature 509: 310–317.
32. Sakaki, H., M. Tsukimoto, H. Harada, Y. Moriyama, and S. Kojima. 2013.
Autocrine regulation of macrophage activation via exocytosis of ATP and activation of P2Y11 receptor. PLoS One 8: e59778.
33. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate
immunity. Cell 124: 783–801.
34. Kawagoe, T., S. Sato, K. Matsushita, H. Kato, K. Matsui, Y. Kumagai, T. Saitoh,
T. Kawai, O. Takeuchi, and S. Akira. 2008. Sequential control of Toll-like
receptor-dependent responses by IRAK1 and IRAK2. Nat. Immunol. 9: 684–691.
35. Malmsjö, M., M. Adner, T. K. Harden, W. Pendergast, L. Edvinsson, and
D. Erlinge. 2000. The stable pyrimidines UDPbS and UTPgS discriminate between the P2 receptors that mediate vascular contraction and relaxation of the rat
mesenteric artery. Br. J. Pharmacol. 131: 51–56.
36. Kim, S. G., Z.-G. Gao, K. A. Soltysiak, T.-S. Chang, C. Brodie, and
K. A. Jacobson. 2003. P2Y6 nucleotide receptor activates PKC to protect
1321N1 astrocytoma cells against tumor necrosis factor‑induced apoptosis. Cell.
Mol. Neurobiol. 23: 401–418.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
11. Elliott, M. R., F. B. Chekeni, P. C. Trampont, E. R. Lazarowski, A. Kadl,
S. F. Walk, D. Park, R. I. Woodson, M. Ostankovich, P. Sharma, et al. 2009.
Nucleotides released by apoptotic cells act as a find-me signal to promote
phagocytic clearance. Nature 461: 282–286.
12. Chekeni, F. B., M. R. Elliott, J. K. Sandilos, S. F. Walk, J. M. Kinchen,
E. R. Lazarowski, A. J. Armstrong, S. Penuela, D. W. Laird, G. S. Salvesen, et al.
2010. Pannexin 1 channels mediate “find-me” signal release and membrane
permeability during apoptosis. Nature 467: 863–867.
13. Orellana, J. A., P. J. Sáez, K. F. Shoji, K. A. Schalper, N. Palacios-Prado,
V. Velarde, C. Giaume, M. V. Bennett, and J. C. Sáez. 2009. Modulation of brain
hemichannels and gap junction channels by pro-inflammatory agents and their
possible role in neurodegeneration. Antioxid. Redox Signal. 11: 369–399.
14. Neijssen, J., B. Pang, and J. Neefjes. 2007. Gap junction-mediated intercellular communication in the immune system. Prog. Biophys. Mol. Biol. 94:
207–218.
15. Sáez, P. J., K. F. Shoji, M. A. Retamal, P. A. Harcha, G. Ramı́rez, J. X. Jiang,
R. von Bernhardi, and J. C. Sáez. 2013. ATP is required and advances cytokineinduced gap junction formation in microglia in vitro. Mediators Inflamm. 2013:
216402.
16. Shibata, Y., and T. Yamamoto. 1977. Gap junctions in the cardiac muscle cells of
the lamprey. Cell Tissue Res. 178: 477–482.
17. Reaume, A. G., P. A. de Sousa, S. Kulkarni, B. L. Langille, D. Zhu, T. C. Davies,
S. C. Juneja, G. M. Kidder, and J. Rossant. 1995. Cardiac malformation in
neonatal mice lacking connexin43. Science 267: 1831–1834.
18. Nicholson, B. J. 2003. Gap junctions—from cell to molecule. J. Cell Sci. 116:
4479–4481.
19. Eugenı́n, E. A., M. C. Brañes, J. W. Berman, and J. C. Sáez. 2003. TNF-a plus
IFN-g induce connexin43 expression and formation of gap junctions between
human monocytes/macrophages that enhance physiological responses. J.
Immunol. 170: 1320–1328.
20. Krenacs, T., M. van Dartel, E. Lindhout, and M. Rosendaal. 1997. Direct cell/cell
communication in the lymphoid germinal center: connexin43 gap junctions
functionally couple follicular dendritic cells to each other and to B lymphocytes.
Eur. J. Immunol. 27: 1489–1497.
21. Westphalen, K., G. A. Gusarova, M. N. Islam, M. Subramanian, T. S. Cohen,
A. S. Prince, and J. Bhattacharya. 2014. Sessile alveolar macrophages communicate with alveolar epithelium to modulate immunity. Nature 506: 503–506.
22. Li, R., B. Tan, Y. Yan, X. Ma, N. Zhang, Z. Zhang, M. Liu, M. Qian, and B. Du.
2014. Extracellular UDP and P2Y6 function as a danger signal to protect mice
from vesicular stomatitis virus infection through an increase in IFN-b production. J. Immunol. 193: 4515–4526.
23. Alatery, A., and S. Basta. 2008. An efficient culture method for generating large
quantities of mature mouse splenic macrophages. J. Immunol. Methods 338: 47–
57.
9