Biochem. J. (2013) 450, 345–350 (Printed in Great Britain)
345
doi:10.1042/BJ20121564
Pathogenic mutations causing LBSL affect mitochondrial aspartyl-tRNA
synthetase in diverse ways
Laura VAN BERGE*1 , Josta KEVENAAR*, Emiel POLDER*, Agnès GAUDRY†, Catherine FLORENTZ†, Marie SISSLER†,
Marjo S. VAN DER KNAAP* and Gert C. SCHEPER*
*Department of Child Neurology, VU University Medical Center, De Boelalaan 1117, 1081 HV Amsterdam, The Netherlands, and †Architecture et Réactivité de l’ARN, Université de
Strasbourg, CNRS, IBMC, 15 rue René Descartes, 67084 Strasbourg, France
The autosomal recessive white matter disorder LBSL
(leukoencephalopathy with brain stem and spinal cord
involvement and lactate elevation) is caused by mutations in
DARS2, coding for mtAspRS (mitochondrial aspartyl-tRNA
synthetase). Generally, patients are compound heterozygous
for mutations in DARS2. Many different mutations have been
identified in patients, including several missense mutations. In the
present study, we have examined the effects of missense mutations
found in LBSL patients on the expression, enzyme activity,
localization and dimerization of mtAspRS, which is important
for understanding the cellular defect underlying the pathogenesis
of the disease. Nine different missense mutations were analysed
and were shown to have various effects on mtAspRS properties.
Several mutations have a direct effect on the catalytic activity
of the enzyme; others have an effect on protein expression or
dimerization. Most mutations have a clear impact on at least one
of the properties of mtAspRS studied, probably resulting in a
small contribution of the missense variants to the mitochondrial
aspartylation activity in the cell.
INTRODUCTION
that mutations do not exert a strong dominant effect and DARS2
mutations probably result in a loss of function of the encoded
protein mtAspRS.
A variety of different mutations have been found so far. Almost
all LBSL patients have a mutation in a polypyrimidine tract at the
3 -end of intron 2, which is found on one allele. These mutations
affect correct splicing of the third exon, which leads to a frameshift
and a premature stop. These mutation are ‘leaky’, leading to a
decreased, but not zero, expression of full-length mtAspRS [15].
The mutation on the other allele varies: other splice site mutations,
deletions, nonsense and several different missense mutations have
been found. A number of these missense mutations were shown to
affect the catalytic activity [4]. A good understanding of the effects
of the missense mutations might reveal a possible correlation
between the mutations and the severity of the disease.
Many different missense mutations in DARS2 have been
found in LBSL patients. In the present study, we examined
the effect of a selection of these missense mutations that are
spread over the gene (Figure 1 and Supplementary Figure
S1 at http://www.biochemj.org/bj/450/bj4500345add.htm) on
expression, enzyme activity, localization and dimerization of the
mutant protein.
LBSL (leukoencephalopathy with brain stem and spinal cord
involvement and lactate elevation) is an autosomal recessive
white matter disorder [1]. Patients with LBSL suffer from
slowly progressive pyramidal, cerebellar and dorsal column
dysfunction. Signs of the disease typically start during childhood
or adolescence, but can even start during adulthood [2,3]. The
diagnosis is based on specific MRI (magnetic resonance imaging)
abnormalities in the cerebral and cerebellar white matter and
specific white matter tracts in the brain stem and spinal cord. The
disease is caused by mutations in the gene DARS2 [4]. DARS2
codes for mtAspRS (mitochondrial aspartyl-tRNA synthetase),
which is a homodimeric enzyme. This ubiquitous protein plays
an essential role in mitochondrial protein translation. mtAspRS is
responsible for attaching the amino acid aspartate to the correct
tRNA in mitochondria. The charged tRNAs are used for the
synthesis of the 13 proteins encoded by the mitochondrial genome.
Since the discovery of DARS2 mutations as the cause of
LBSL, mutations in several other mitochondrial aminoacyl-tRNA
synthetase genes (i.e. AARS2, EARS2, FARS2, HARS2, MARS2,
RARS2, SARS2 and YARS2) have been demonstrated to lead to
a variety of diseases with no apparent commonalities [5–12]. In
some cases, the mutations affect the specific tRNA synthetase
activities and sometimes mitochondrial respiratory chain activity
is reduced, but this is not apparent in all cases. Although the
central nervous system is affected in some of these diseases, only
mutations in EARS2 lead to a leukoencephalopathy [12], similar
to the situation for mutations in DARS2 and LBSL.
LBSL patients are typically compound heterozygous, although
homozygous DARS2 mutations have been described recently in
a Japanese family [13] and a German patient [14]. Relatives
that are carriers of a DARS2 mutation are unaffected, indicating
Key words: aminoacyl-tRNA synthetase, aspartylation, leukoencephalopathy, missense mutation, mitochondrion.
MATERIALS AND METHODS
Constructs
For expression in human cultured cells, constructs were made
consisting of the DARS2 coding sequence followed by a
10-amino-acid linker sequence and a FLAG (DYKDDDDK)
epitope tag or the Gluc (Gaussia luciferase) coding sequence at
the C-terminus of DARS2, generating FLAG-tagged mtAspRS
and Gluc-tagged mtAspRS respectively. The secretion signal
Abbreviations used: FBS, fetal bovine serum; GFP, green fluorescent protein; Gluc, Gaussia luciferase; HA, haemagglutinin; HEK, human embryonic
kidney; LBSL, leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation; mtAspRS, mitochondrial aspartyl-tRNA synthetase.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2013 Biochemical Society
346
Figure 1
L. van Berge and others
Position of missense mutations in mtAspRS
Two-dimensional representations of mtAspRS. Various domains and motifs, as described in [17], are indicated. Motifs 1, 2 and 3 form the catalytic platform. The positions of the mutations under
examination in the present study are indicated on top. AC-binding domain, anticodon-binding domain.
sequence at the N-terminus (amino acids 1–17) of Gluc was
excluded from the constructs (a gift from Dr R. Estévez,
Department of Physiological Sciences, University of Barcelona,
Barcelona, Spain). For bacterially expressed recombinant
proteins, the pEX14-mtAspRS-His6 plasmid was used {this
plasmid corresponds to the one encoding mtAspRS(I41) in
[16]}. The plasmid contains base pairs corresponding to amino
acids 41–645 of the coding sequence of DARS2 (excluding
the theoretical mitochondrial targeting sequence), followed by
a histidine tag. Mutations were introduced by site-directed
®
mutagenesis using the QuikChange kit (Stratagene). The primers
used for mutagenesis can be found in Supplementary Table
S1 at http://www.biochemj.org/bj/450/bj4500345add.htm. All
mutations were confirmed by sequencing.
Aminoacylation assays
Expression of recombinant proteins was induced with 200 μM
IPTG (isopropyl β-D-thiogalactopyranoside) for 20 h at 18 ◦ C
in Escherichia coli BL21(DE3) rosetta2 strains (Novagen).
Purification steps were conducted as described in [17].
Aminoacylation assays were performed at 37 ◦ C as described in
[4].
Cell culture and transfections
HEK (human embryonic kidney)-293T cells were cultured in
DMEM (Dulbecco’s modified Eagle’s medium) (Invitrogen) with
10 % (v/v) FBS (fetal bovine serum) in 5 % CO2 at 37 ◦ C. Cells
were transfected with PEI (polyethyleneimine) (Polysciences)
at 50 % confluence, with constructs expressing FLAG- and
Gluc-tagged wild-type and mutant mtAspRS. Cell lysates were
obtained 44 h after transfection by harvesting in lysis buffer
(20 mM Hepes/KOH, pH 7.4, 100 mM KCl, 10 % glycerol, 1 %
Triton X-100 and 0.1 mM EDTA) with protease inhibitor cocktail
(Roche Applied Sciences). After lysis, nuclei and cell debris were
removed by centrifugation.
Dimerization assay
HEK-293T cells were transfected with a 1:1 ratio of mutant
or wild-type FLAG- and Gluc-tagged mtAspRS constructs.
Transfected cells were harvested and lysed after 44 h.
Luminescence in the cell extracts was measured using a
luminescence reader (GENios Plus, Tecan) using the DualLuciferase Reporter Assay kit (Promega). Immunoprecipitation
was then carried out using a mouse monoclonal antiFLAG antibody (Sigma). Precipitated proteins were dissolved
in Passive Lysis Buffer (Promega). Luminescence of the
c The Authors Journal compilation c 2013 Biochemical Society
co-immunoprecipitated mtAspRS–Gluc fusion proteins was
measured. Dimerization efficiency was calculated as the amount
of Gluc activity after immunoprecipitation of FLAG- and Gluctagged complexes in comparison with the total Gluc activity in the
cell lysates before immunoprecipitation. Dimerization obtained
with wild-type proteins was set as 100 % for each experiment.
Immunocytochemistry
At 44 h after transfection, cells were stained with 200 nM
MitoTracker Red CMXRos (Invitrogen) for 20 min. Cells were
fixed in 4 % (w/v) paraformaldehyde and blocked in 5 % (v/v)
FBS. Cells were incubated with mouse anti-FLAG antibodies
(1:1000 dilution; Sigma) overnight at 4 ◦ C. After staining with
®
secondary antibodies (Alexa Fluor 488-tagged anti-mouse IgG;
1:1000 dilution; Invitrogen), coverslips were mounted on object
glasses with Vectashield Mounting Medium for Fluorescence with
DAPI (4 ,6-diamidino-2-phenylindole) (Vector Laboratories) and
photographed using a Leica DM6000B microscope.
SDS/PAGE and Western blotting
Cell lysates were run on SDS/PAGE (10 % gels) and blotted on
to PVDF membranes (Millipore). Membranes were blocked in
PBS-T (PBS containing 0.1 % Tween 20) and 5 % (w/v) non-fat
dried skimmed milk powder. Proteins of interest were detected
by incubating the membranes with the appropriate antibodies in
PBS-T containing 0.5 % non-fat dried skimmed milk powder for
either 2 h at room temperature (21 ◦ C) or overnight at 4 ◦ C. Mouse
anti-FLAG (1:5000 dilution) and mouse anti-β-actin (1:100000
dilution; Abcam) antibodies were used. After washing with PBST, alkaline phosphatase-conjugated secondary antibodies (1:5000
dilution; Sigma) were added for 1 h and the immunoreactive bands
were detected using ECF (enhanced chemifluorescence) substrate
(GE Healthcare) on a FLA-5000 image reader (Fujifilm). Western
blots were quantified using the AIDA Image Analyzer software
package.
RESULTS
Expression
To study the basic properties of mtAspRS proteins with
pathogenic missense mutations, we transfected HEK-293T
cells with plasmids containing FLAG-tagged wild-type or
mutant mtAspRS. Western blotting of cell lysates indicates
strongly reduced protein levels for the C152F, Q184K and
D560V mutant proteins (Figure 2). Similar results were
obtained with mtAspRS mutants tagged with GFP (green
Diverse effects of DARS2 mutations
Figure 2
347
Expression of mutant mtAspRS
FLAG-tagged wild-type (WT) and mutant mtAspRS were expressed in HEK-293T cells. Expression of the variants was studied by SDS/PAGE and Western blotting.
Table 1
Aminoacylation activity of recombinant proteins
Enzymatic activities were measured at 37 ◦ C in the presence of an excess of in vitro transcribed
E. coli tRNAAsp under experimental conditions as described in [4]. Experiments were carried out
at least three times.
Protein
Enzyme activity (nmol/mg per min)
Fold decrease in specific activity
Wild-type
R58G
T136S
Q184K
R263Q
D560V
L613F
L626Q
256.9
324.1
278.5
343.7
1.9
42.6
205.4
6.0
–
–
–
–
135
6
–
43
Localization
MtAspRS is encoded by the nuclear DARS2 gene. To perform its
function, the protein is, after synthesis in the cytosol, targeted into
mitochondria with the help of a mitochondria-targeting sequence.
We studied whether mutations affected the localization of mutant
mtAspRS to mitochondria using the FLAG-tagged proteins
transfected in HEK-293T cells. Mitochondria were stained with
MitoTracker (Invitrogen), and mtAspRS was detected using
immunocytochemistry with antibodies against the FLAG tag. The
images are shown in Figure 3 and Supplementary Figure S3 at
http://www.biochemj.org/bj/450/bj4500345add.htm. All mutant
proteins showed a normal mitochondrial localization, indicating
that these mutants do not affect proper targeting to mitochondria.
Dimerization
fluorescent protein) or HA (haemagglutinin), indicating that
the differences in expression levels are not due to the
FLAG tag (results not shown). In experiments where cells
were treated with cycloheximide to inhibit production of
newly synthesized proteins, we observed that the three
variants with low expression levels had reduced stability in
comparison with the wild-type protein (Supplementary Figure S2
at http://www.biochemj.org/bj/450/bj4500345add.htm). Whereas
the wild-type protein was nearly completely stable over the
treatment period, the levels of the three mutant variants were
reduced by approximately 50 %. It should be noted that, due to
the very low expression levels of C152F, Q184K and D560V,
the results of the cycloheximide experiments were variable and
difficult to quantify.
Enzyme activity
The enzyme activity of different mutant forms of mtAspRS has
been measured previously [4]. Since the previous study, it has been
found that recombinant mtAspRS with an additional seven amino
acids at the N-terminus has substantially increased expression,
stability, solubility and activity [16]. We have therefore expressed
mature wild-type and several mutant mtAspRS proteins, starting
at amino acid 41, in E. coli. Similarly to the experiments in
cultured human cells, we noticed a strongly reduced expression
of the recombinant protein with the D560V mutation in the E.
coli expression system. Purified enzymes were used for in vitro
aminoacylation assays to measure their ability to aminoacylate
tRNAAsp . The results are shown in Table 1. R263Q, L626Q and,
to a lesser degree, D560V significantly decrease the catalytic
activity of mtAspRS. R58G, T136S, Q184K and L613F do not
affect enzyme activity.
MtAspRS functions as a dimer [17] and several mutations
(C152F, Q184K, R263Q and L626Q/V) are located close
to the dimerization interface (Supplementary Figures S1 and
S4 at http://www.biochemj.org/bj/450/bj4500345add.htm). We
therefore studied whether mutations affect dimerization of
mtAspRS. We analysed both the ability of mutant proteins
to dimerize with wild-type mtAspRS as well as the ability to
form homodimers (with the same mutant protein). We studied
this by expressing FLAG-tagged mtAspRS together with Gluctagged mtAspRS in transfected HEK-293T cells, followed by
co-immunoprecipitation using antibodies against the FLAG
tag and measurement of the Gluc activity (Figure 4A). It
is important to note that, with these fusion proteins, we
observed relatively similar levels of luciferase activity in the
lysates of the cells transfected with different mutants (see
the representative experiment in Supplementary Figure S5
at http://www.biochemj.org/bj/450/bj4500345add.htm). Apparently, the expression levels of the Gluc-tagged proteins were
less affected by the different mutations than previously seen
for FLAG-, HA- or GFP-tagged variants. The combined result
of five independent dimerization experiments are presented in
Figures 4(B) and 4(C).
The C152F, Q184K, R263Q and D560V mutations significantly
decrease dimerization with the wild-type enzyme (Figure 4B).
The same variants and R58G, T136S and L626Q decrease
dimerization with the mutant enzyme (Figure 4C). Furthermore,
we tested the two combinations of missense mutants that
have been found in LBSL patients: R58G with T136S
and L613F with L626Q (Supplementary Figure S6 at
http://www.biochemj.org/bj/450/bj4500345add.htm). The ability
to dimerize was reduced when R58G was combined with
T136S, but to a similar degree as both mutations individually.
Dimerization of L613F with L626Q was not impaired.
c The Authors Journal compilation c 2013 Biochemical Society
348
L. van Berge and others
DISCUSSION
The aim of the present study was to examine the effects of
missense mutations found in LBSL patients on the expression,
enzyme activity, localization and dimerization of mtAspRS. The
outcome of the different studies is summarized in Table 2.
Three mutations strongly reduced expression of mtAspRS and,
in particular, the enzyme harbouring the D560V mutation was
almost undetectable. These mutants also showed a decreased
stability in the presence of cycloheximide, which could explain
the decreased steady-state expression level.
We studied the enzyme activity of several mutant mtAspRS
forms in aminoacylation assays, including some variants that were
analysed previously [4]. It should be noted that the activity of
the wild-type enzyme was approximately 10-fold higher than
measured previously. The difference is most likely to be due
to the presence of seven additional N-terminal amino acids in
the recombinant proteins, demonstrated to increase the stability
of the enzyme [16]. Again, we found strongly reduced activity of
R263Q, which affects an amino acid located in the catalytic core
of the protein, close to the highly conserved catalytic residue
Arg266 . L626Q also reduces catalytic activity, whereas D560V
leads to a moderately reduced activity. In contrast with the
previous study [4], we did not find a reduction in the activity of
Q184K. The reconsideration of the N-terminus of the recombinant
protein [16] might account for this.
It has been shown that the pathogenic mutation S45G, which
affects a residue located near the cleavage site, alters correct
import of the mutant protein into mitochondria [18]. None of
the mutations tested in the present study affect residues located
in the mitochondrial targeting sequence or near the cleavage
site. As expected, all of the mutant proteins co-localize with a
mitochondrial marker.
mtAspRS functions as a homodimer and some of the mutations
studied are of residues on or near the predicted dimerization
interface. We therefore studied whether the mutations affect
dimerization. Most patients are compound heterozygous; almost
all patients have a mutation in intron 2 of DARS2. This mutation
is leaky, meaning that some wild-type full-length mtAspRS can
still be formed from this allele. So, in cells of patients with
one missense mutation, three possible dimers can be formed, i.e.
wild-type–wild-type, wild-type–mutant and mutant–mutant. It is
therefore interesting to see what the effect of missense mutations
is on dimerization with the wild-type enzyme, as well as the
effect on dimerization with the same mutant enzyme. Some of
the missense mutations retain the ability to form dimers with the
wild-type protein. If the missense variant can exert a dominantnegative effect on the wild-type part of the dimer, this will lead
to a dysfunctional dimer. The only mtAspRS activity in a cell
will then be provided by dimers that consist of two wild-type
proteins, but the level of such dimers will be low because of the
aberrant splicing of intron 2/exon 3. Furthermore, dimerization
between mutant proteins is affected in several cases. In general,
we see that mutants that have a decreased ability to form dimers
also have a decreased expression. A possible explanation is that
monomers are less stable, leading to a decreased amount of
Figure 3
Localization of mutant mtAspRS to mitochondria
HEK-293T cells were transfected with wild-type (WT) and mutant constructs of FLAG-tagged
mtAspRS. Mitochondria were stained with MitoTracker and mtAspRS was detected
c The Authors Journal compilation c 2013 Biochemical Society
with anti-FLAG antibodies. A part of a transfected cell is shown to illustrate the
similar punctute staining of mtAspRS and mitochondria. Supplementary Figure S3
at http://www.biochemj.org/bj/450/bj4500345add.htm shows colour images from similar
experiments. The settings for the images were optimized for each variant to demonstrate the
localization of the proteins.
Diverse effects of DARS2 mutations
Figure 4
Dimerization is affected by missense mutations
(A) Schematic overview of the experiment. Constructs of FLAG- and Gluc-tagged wildtype and mutant mtAspRS were expressed in HEK-293T cells. The effects of mutations on
dimerization were determined by immunoprecipitation of Gluc-fusion proteins that were bound to
their FLAG-tagged counterparts. For simplicity, other possible dimers (containing two Glucor FLAG-tagged proteins) are omitted. Relative dimerization efficiencies were calculated as
described in the Materials and methods section. The asterisk (*) indicates the mutant variant of
mtAspRS. (B) Dimerization efficiency relative to wild-type (WT) protein. (C) Relative dimerization
efficiency with mtAspRS harbouring the same mutation or another mutation (in the case
of R58G + T136S and L613F + L626Q). Results in (B) and (C) are means +
− S.D. for five
independent experiments.
protein in the cells. Pathogenic mutations in other aminoacyltRNA synthetases have also been shown to affect dimerization. A
study on mutations in glycyl-tRNA synthetase that cause Charcot–
Marie–Tooth disease showed that many of these mutations either
increase or decrease dimer formation [19]. We did not identify
any mutations that increase the dimerization of mtAspRS.
There are only a few LBSL patients that are compound
heterozygous for two missense mutations. R58G and T136S
349
occur together in two patients from one family, and the L613F
and L626Q mutations are present in another patient. For these
mutations, we tested whether they affect dimerization with each
other. Formation of R58G–R58G and T136S–T136S homodimers
or R58G–T136S heterodimers is strongly decreased in all three
cases. Produced as recombinant proteins in E. coli, homodimers of
either mutant has normal aminoacylation activity and none of the
other aspects that we studied was affected. Both amino acids reside
in the anticodon-binding domain, although they are not predicted
to interact directly with the anticodon of the tRNA. It is therefore
still not completely understood how these mutations lead to LBSL.
An alternative effect of one of these two mutations could be
a potential effect on the mRNA level. Prediction software on
RNA splicing [20] suggests alternative folding of the pre-mRNA
containing the 406A>T (corresponding to p.T136S) mutation.
Owing to this alternative folding, the start of exon 5 would be
in a closed conformation, making it less accessible for the spliceosome. Sequencing of cDNA from the patient’s lymphoblasts
carrying this mutation, however, did not reveal alternative splice
products. We cannot fully exclude that the effect of 406A>T on
splicing would be more pronounced in other cell types, which is
the case for the common splice-site mutation in LBSL patients
[15]. Yet another hypothesis is that the mutations affect the partial
unfolding and refolding that these proteins undergo during the
import into mitochondria. Such an effect has been shown for single
nucleotide polymorphisms in mitochondrial phenylalanyl-tRNA
synthetase and in mitochondrial leucyl-tRNA synthetase [21].
In the case of L613F and L626Q, it is interesting to note
that L626Q decreases homodimerization, but does not decrease
dimerization with the L613F mutant protein. In the patient’s cells
where both variants are present, a relatively large part of the dimers
are expected to be dimers consisting of L613F and L626Q. Such
dimers may have reduced catalytic activity because of the low
activity of the L626Q mutant. Although L613F affects a highly
conserved residue, we could not find any effect of this mutation on
the expression, activity, localization and dimerization of mtAspRS
with this single amino acid change. Altogether, it becomes evident
that most missense mutations have a clear impact on at least one
of the properties of mtAspRS studied. Mutations either decrease
the catalytic activity (directly or through reduced dimerization) or
substantially decrease the expression of the protein. The eventual
outcome is a reduced aspartylation activity of proteins with
missense mutations. Mitochondrial protein synthesis therefore
probably relies on the reduced amount of wild-type protein that is
expressed from the other allele with a typical splice site mutation
in intron 2.
There does not seem to be an evident genotype–phenotype
correlation for LBSL and the data from the present study did
not reveal a correlation between the manner in which mtAspRS is
affected by missense mutations and disease severity. For example,
the disease course in patients with mtAspRS-R263Q or -D560V
is relatively mild, despite the substantial effects on the catalytic
activity or expression level respectively. It should be noted that
only a selection of the LBSL mutations was studied, and the
number of patients with the same mutation is very small, so
determining whether differences between the effects of different
missense mutations exist will be challenging.
Our data indicate that it will be difficult to develop a common
therapy that aims at restoring the activity of mtAspRS with
missense mutations. Probably, several different treatment options
must be explored in order to counteract the variety of different effects that the amino acid changes exert on mtAspRS. Efforts to find
a therapeutic intervention that would increase correct splicing of
exon 3 are more likely to be successful, with the major advantage
that almost all LBSL patients would benefit from such a treatment.
c The Authors Journal compilation c 2013 Biochemical Society
350
Table 2
L. van Berge and others
Effects of missense mutations in mtAspRS
+ , similar to wild-type; − , reduced compared with wild-type; − − , strongly reduced compared with wild-type; ND, not determined.
Mutation
Dimerization
DNA
Protein
Activity
Expression
Localization
Wild-type
Mutant
Comment
172C>G
406A>T
455G>T
550C>A
788G>A
1679A>T
1837C>T
1877T>A
1876C>G
R58G
T136S
C152F
Q184K
R263Q
D560V
L613F
L626Q
L626V
+
+
ND
+
−−
−
+
−−
ND
+
+
−
−
+
−−
+
+
+
+
+
+
+
+
+
+
+
+
+
+
−
−
−
−−
+
+
+
−
−
−
−−
−
−−
+
−
+
Compound heterozygous with T136S
Compound heterozygous with R58G
Compound heterozygous with intron 2 mutation
Compound heterozygous with intron 2 mutation
Compound heterozygous with intron 2 mutation
Compound heterozygous with intron 2 mutation
Compound heterozygous with L626Q
Compound heterozygous with L613F
Compound heterozygous with intron 2 mutation
AUTHOR CONTRIBUTION
Laura van Berge was involved in the design of the study, performed the experiments
and wrote the paper. Josta Kevenaar, Emiel Polder and Agnès Gaudry were involved in
performing several experiments. Marie Sissler participated in the experimental design
and data analysis and contributed to the critical revision of the paper. Catherine Florentz
contributed to the interpretation of the experimental results and critical revision of the
paper. Marjo van der Knaap contributed to conceptualization of the study and critical
revision of the paper. Gert Scheper designed and supervised the study and contributed to
writing of the paper.
FUNDING
This study was supported by the Prinses Beatrix Fonds [grant number WAR07/31], the
Centre National de la Recherche Scientifique, Agence Nationale de la Recherche [grant
number ANR-09-BLAN-0091-01/03], and partially supported by the French National
Program Investissements d’Avenir (Labex MitoCross).
REFERENCES
1 van der Knaap, M. S., van der Voorn, P., Barkhof, F., van Coster, R., Krageloh-Mann, I.,
Feigenbaum, A., Blaser, S., Vles, J. S., Rieckmann, P. and Pouwels, P. J. (2003) A new
leukoencephalopathy with brainstem and spinal cord involvement and high lactate. Ann.
Neurol. 53, 252–258
2 Labauge, P., Roullet, E., Boespflug-Tanguy, O., Nicoli, F., Le Fur, Y., Cozzone, P. J.,
Ducreux, D. and Rodriguez, D. (2007) Familial, adult onset form of leukoencephalopathy
with brain stem and spinal cord involvement: inconstant high brain lactate and very slow
disease progression. Eur. Neurol. 58, 59–61
3 Petzold, G. C., Bohner, G., Klingebiel, R., Amberger, N., van der Knaap, M. S. and
Zschenderlein, R. (2006) Adult onset leucoencephalopathy with brain stem and spinal
cord involvement and normal lactate. J. Neurol. Neurosurg. Psychiatry 77,
889–891
4 Scheper, G. C., van der Klok, T., van Andel, R. J., van Berkel, C. G., Sissler, M., Smet, J.,
Muravina, T. I., Serkov, S. V., Uziel, G., Bugiani, M. et al. (2007) Mitochondrial
aspartyl-tRNA synthetase deficiency causes leukoencephalopathy with brain stem and
spinal cord involvement and lactate elevation. Nat. Genet. 39, 534–539
5 Bayat, V., Thiffault, I., Jaiswal, M., Tetreault, M., Donti, T., Sasarman, F., Bernard, G.,
Demers-Lamarche, J., Dicaire, M. J., Mathieu, J. et al. (2012) Mutations in the
mitochondrial methionyl-tRNA synthetase cause a neurodegenerative phenotype in flies
and a recessive ataxia (ARSAL) in humans. PLoS Biol. 10, e1001288
6 Belostotsky, R., Ben-Shalom, E., Rinat, C., Becker-Cohen, R., Feinstein, S., Zeligson, S.,
Segel, R., Elpeleg, O., Nassar, S. and Frishberg, Y. (2011) Mutations in the mitochondrial
seryl-tRNA synthetase cause hyperuricemia, pulmonary hypertension, renal failure in
infancy and alkalosis, HUPRA syndrome. Am. J. Hum. Genet. 88, 193–200
7 Edvardson, S., Shaag, A., Kolesnikova, O., Gomori, J. M., Tarassov, I., Einbinder, T.,
Saada, A. and Elpeleg, O. (2007) Deleterious mutation in the mitochondrial
arginyl-transfer RNA synthetase gene is associated with pontocerebellar hypoplasia. Am.
J. Hum. Genet. 81, 857–862
Received 11 October 2012/4 December 2012; accepted 10 December 2012
Published as BJ Immediate Publication 10 December 2012, doi:10.1042/BJ20121564
c The Authors Journal compilation c 2013 Biochemical Society
8 Elo, J. M., Yadavalli, S. S., Euro, L., Isohanni, P., Gotz, A., Carroll, C. J., Valanne, L.,
Alkuraya, F. S., Uusimaa, J., Paetau, A. et al. (2012) Mitochondrial phenylalanyl-tRNA
synthetase mutations underlie fatal infantile Alpers encephalopathy. Hum. Mol. Genet. 21,
4521–4529
9 Gotz, A., Tyynismaa, H., Euro, L., Ellonen, P., Hyotylainen, T., Ojala, T., Hamalainen, R. H.,
Tommiska, J., Raivio, T., Oresic, M. et al. (2011) Exome sequencing identifies
mitochondrial alanyl-tRNA synthetase mutations in infantile mitochondrial
cardiomyopathy. Am. J. Hum. Genet. 88, 635–642
10 Pierce, S. B., Chisholm, K. M., Lynch, E. D., Lee, M. K., Walsh, T., Opitz, J. M., Li, W.,
Klevit, R. E. and King, M. C. (2011) Mutations in mitochondrial histidyl tRNA synthetase
HARS2 cause ovarian dysgenesis and sensorineural hearing loss of Perrault syndrome.
Proc. Natl. Acad. Sci. U.S.A. 108, 6543–6548
11 Riley, L. G., Cooper, S., Hickey, P., Rudinger-Thirion, J., McKenzie, M., Compton, A., Lim,
S. C., Thorburn, D., Ryan, M. T., Giege, R. et al. (2010) Mutation of the mitochondrial
tyrosyl-tRNA synthetase gene, YARS2 , causes myopathy, lactic acidosis, and
sideroblastic anemia: MLASA syndrome. Am. J. Hum. Genet. 87, 52–59
12 Steenweg, M. E., Ghezzi, D., Haack, T., Abbink, T. E., Martinelli, D., van Berkel, C. G., Bley,
A., Diogo, L., Grillo, E., Te Water Naudé, J. et al. (2012) Leukoencephalopathy with
thalamus and brainstem involvement and high lactate ‘LTBL’ caused by EARS2 mutations.
Brain 135, 1387–1394
13 Miyake, N., Yamashita, S., Kurosawa, K., Miyatake, S., Tsurusaki, Y., Doi, H., Saitsu, H.
and Matsumoto, N. (2011) A novel homozygous mutation of DARS2 may cause a severe
LBSL variant. Clin. Genet. 80, 293–296
14 Synofzik, M., Schicks, J., Lindig, T., Biskup, S., Schmidt, T., Hansel, J., Lehmann-Horn, F.
and Schols, L. (2011) Acetazolamide-responsive exercise-induced episodic ataxia
associated with a novel homozygous DARS2 mutation. J. Med. Genet. 48, 713–715
15 van Berge, L., Dooves, S., van Berkel, C. G., Polder, E., van der Knaap, M. S. and Scheper,
G. C. (2012) Leukoencephalopathy with brain stem and spinal cord involvement and
lactate elevation is associated with cell-type-dependent splicing of mtAspRS mRNA.
Biochem. J. 441, 955–962
16 Gaudry, A., Lorber, B., Neuenfeldt, A., Sauter, C., Florentz, C. and Sissler, M. (2012)
Re-designed N-terminus enhances expression, solubility and crystallizability of
mitochondrial protein. Protein Eng., Des. Sel. 25, 473–481
17 Bonnefond, L., Fender, A., Rudinger-Thirion, J., Giege, R., Florentz, C. and Sissler, M.
(2005) Toward the full set of human mitochondrial aminoacyl-tRNA synthetases:
characterization of AspRS and TyrRS. Biochemistry 44, 4805–4816
18 Messmer, M., Florentz, C., Schwenzer, H., Scheper, G. C., van der Knaap, M. S.,
Marechal-Drouard, L. and Sissler, M. (2011) A human pathology-related mutation
prevents import of an aminoacyl-tRNA synthetase into mitochondria. Biochem. J. 433,
441–446
19 Nangle, L. A., Zhang, W., Xie, W., Yang, X. L. and Schimmel, P. (2007)
Charcot–Marie–Tooth disease-associated mutant tRNA synthetases linked to altered
dimer interface and neurite distribution defect. Proc. Natl. Acad. Sci. U.S.A. 104,
11239–11244
20 Zuker, M. (2003) Mfold web server for nucleic acid folding and hybridization prediction.
Nucleic Acids Res. 31, 3406–3415
21 Banerjee, R., Reynolds, N. M., Yadavalli, S. S., Rice, C., Roy, H., Banerjee, P., Alexander,
R. W. and Ibba, M. (2011) Mitochondrial aminoacyl-tRNA synthetase single-nucleotide
polymorphisms that lead to defects in refolding but not aminoacylation. J. Mol. Biol. 410,
280–293
Biochem. J. (2013) 450, 345–350 (Printed in Great Britain)
doi:10.1042/BJ20121564
SUPPLEMENTARY ONLINE DATA
Pathogenic mutations causing LBSL affect mitochondrial aspartyl-tRNA
synthetase in diverse ways
Laura VAN BERGE*1 , Josta KEVENAAR*, Emiel POLDER*, Agnès GAUDRY†, Catherine FLORENTZ†, Marie SISSLER†,
Marjo S. VAN DER KNAAP* and Gert C. SCHEPER*
*Department of Child Neurology, VU University Medical Center, De Boelalaan 1117, 1081 HV Amsterdam, The Netherlands, and †Architecture et Réactivité de l’ARN, Université de
Strasbourg, CNRS, IBMC, 15 rue René Descartes, 67084 Strasbourg, France
Figure S1
Position of missense mutations in mtAspRS
(A) Two- and three-dimensional representations of mtAspRS. Various domains and motifs are indicated. Motifs 1, 2 and 3 (in purple) constitute the catalytic platform. AC-binding domain,
anticodon-binding domain. (B) Positions of the mutations under examination in the present study. The same colours for the different mutations, as indicated in the upper panel, are used in the
three-dimensional representations in the lower panel. The left-hand three-dimensional structure shows mtAspRS with all variants mapped on one monomer in the presence of tRNA. In the right-hand
image, a homodimer of mtAspRS is shown with all variants mapped on the grey half of the dimer. All three-dimensional representations are models of the human mtAspRS structure built based on
the crystallographic structure of the E. coli AspRS [1].
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2013 Biochemical Society
L. van Berge and others
Figure S2
Protein stability
Constructs containing wild-type (WT) and mutant FLAG-tagged mtAspRS containing the C152F,
Q184K or D560V mutations were expressed in HEK-293T cells. Transfected cells were treated
with 250 μg/ml cycloheximide. Cells were harvested at different time points (indicated on
top) and expression was studied by SDS/PAGE and Western blotting. Note that the images
were optimized for visualization of the FLAG-tagged proteins, so that direct comparison of the
expression levels between panels is not possible. The asterisk (∗) indicates a non-specific band
that becomes evident due to the settings that are required to visualize the very low expression
levels of the D560V variant.
c The Authors Journal compilation c 2013 Biochemical Society
Diverse effects of DARS2 mutations
Figure S3
Localization of mutant mtAspRS to mitochondria
HEK-293T cells were transfected with wild-type (WT) and mutant constructs of FLAG-tagged mtAspRS. Mitochondria were stained with MitoTracker (red), and mtAspRS was detected with anti-FLAG
antibodies (green). Cell nuclei were stained with DAPI (4 ,6-diamidino-2-phenylindole) (blue). Settings for the images were optimized for each variant to demonstrate the localization of the protein.
c The Authors Journal compilation c 2013 Biochemical Society
L. van Berge and others
Figure S4
MtAspRS missense mutations
Homodimers of mtAspRS with each of the mutations studied individually mapped to both monomers in three-dimensional representations. AC-binding domain, anticodon-binding domain.
c The Authors Journal compilation c 2013 Biochemical Society
Diverse effects of DARS2 mutations
Figure S5
Dimerization assay
HEK-293T cells were transfected with FLAG- and Gluc-tagged wild-type (WT) and mutant
mtAspRS-expressing constructs. Cells were lysed as described in the Materials and methods
of the main text, and the total luciferase activity in the lysate was measured [indicated by blue
bars (‘Input’)]. Subsequently, complexes were immunoprecipitated with anti-FLAG antibodies
and the resulting luciferase activity in the beads fraction (‘IP’) was measured. The percentage of
the immunoprecipitated luciferase activity of the total luciferase activity is indicated.
Figure S6
Combinations of missense mutations
Only rarely are combinations of two missense mutations found in LBSL patients. Two known examples, i.e. the combinations of R58G and T136S and L613F and L626Q, are shown on the
three-dimensional structure of mtAspRS. The arrow points to the position of Thr136 in the green half of the mtAspRS dimer. Note that Arg58 and Thr136 on the two subunits of the dimer are far apart
from each other. AC-binding domain, anticodon-binding domain.
c The Authors Journal compilation c 2013 Biochemical Society
L. van Berge and others
Table S1
Mutagenesis primers
Affected nucleotides are shown in bold and underlined
Mutation
Name
Orientation
Sequence (5 →3’)
c.172C>G
R58G-F
R58G-R
T136S-F
T136S-R
C152F-F
C152F-R
Q184K-F
Q184K-R
R263Q-F
R263Q-R
D560V-F
D560V-R
L613F-F
L613F-R
L626Q-F
L626Q-R
L626V-F
L626V-R
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
CACATGTGGAGAGTTGGGTTCGTCTCACTTAGG
CCTAAGTGAGACGAACCCAACTCTCCACATGTG
CAAGAGAATCCAAAAATGCCATCAGGTGAGATTGAAATCAAAG
CTTTGATTTCAATCTCACCTGATGGCATTTTTGGATTCTCTTG
GAGCTTCTGAATGCCTTCAAGAAGCTGCCCTTTG
CAAAGGGCAGCTTCTTGAAGGCATTCAGAAGCTC
CTTGCGTAGTTTCCAAATGAAGTATAACCTGCGACTG
CAGTCGCAGGTTATACTTCATTTGGAAACTACGCAAG
CAGATATTTTCAGGTTGCCCAATGTTATCGAGATGAAGG
CCTTCATCTCGATAACATTGGGCAACCTGAAAATATCTG
GCAACCTTACTAAAGGAGGTTGTGAAAATGCTCTCC
GGAGAGCATTTTCACAACCTCCTTTAGTAAGGTTGC
CTTCCGGGGACATGACTTCATGAGCAATACCC
GGGTATTGCTCATGAAGTCATGTCCCCGGAAG
GTCCCTCCTGAGGAACAGAAGCCCTATCATATC
GATATGATAGGGCTTCTGTTCCTCAGGAGGGAC
CTGTCCCTCCTGAAGAAGTGAAGCCCTATCATATCCG
CGGATATGATAGGGCTTCACTTCTTCAGGAGGGACAG
c.406A>T
c.455G>T
c.550C>A
c.788G>A
c.1679A>T
c.1837C>T
c.1877T>A
c.1876C>G
REFERENCE
1 Eiler, S., Dock-Bregeon, A., Moulinier, L., Thierry, J. C. and Moras, D. (1999) Synthesis of
aspartyl-tRNAAsp in Escherichia coli : a snapshot of the second step. EMBO J. 18,
6532–6541
Received 11 October 2012/4 December 2012; accepted 10 December 2012
Published as BJ Immediate Publication 10 December 2012, doi:10.1042/BJ20121564
c The Authors Journal compilation c 2013 Biochemical Society