Erratum
Attenuation of microRNA-1 derepresses the cytoskeleton regulatory protein
twinfilin-1 to provoke cardiac hypertrophy
Qing Li, Xiao-Wei Song, Jun Zou, Guo-Kun Wang, Elena Kremneva, Xiang-Qi Li, Ni Zhu, Pekka Lappalainen,
Wen-Jun Yuan, Yong-Wen Qin and Qing Jing
Journal of Cell Science 123, 2680
© 2010. Published by The Company of Biologists Ltd
doi:10.1242/jcs.077578
There were errors published in J. Cell Sci. 123, 2444-2452.
In the Introduction, on page 2444, a comma was accidentally introduced after ‘(TWF2)’.
The correct sentence should read:
Two twinfilin isoforms exist in mammals: twinfilin-1 (TWF1) is predominantly expressed in non-muscle tissues and twinfilin-2 (TWF2)
is the most abundant isoform in skeletal muscle and the heart (Nevalainen et al., 2009; Vartiainen et al., 2003).
On page 2448, right column, the third sentence incorrectly starts “To access…”, instead of ‘To assess…’.
The correct sentence should read:
To assess whether silencing of the endogenous miR-1 would result in hypertrophy in vitro, we generated an adenoviral vector in which
a 3⬘UTR with tandem miR-1-binding sites is linked to the enhanced green fluorescent protein (EGFP) reporter gene.
The first sentence in the caption of Fig. 7 should read:
Fig. 7. Effects of overexpression of miR-1 on cardiomyocytes.
Under Materials and Methods, subsection ‘miRNA microarray’, the number of mature human miRNA probes was incorrectly given as
718.
The correct number is 719.
We and the authors apologise for the mistakes.
2444
Research Article
Attenuation of microRNA-1 derepresses the
cytoskeleton regulatory protein twinfilin-1 to provoke
cardiac hypertrophy
Qing Li1,2,*, Xiao-Wei Song3,4,*, Jun Zou1,2, Guo-Kun Wang1, Elena Kremneva5, Xiang-Qi Li1, Ni Zhu3,
Tao Sun4, Pekka Lappalainen5, Wen-Jun Yuan4,6, Yong-Wen Qin3 and Qing Jing1,3,‡
1
Key Laboratory of Stem Cell Biology and Laboratory of Nucleic Acid and Molecular Medicine, Institute of Health Sciences, Shanghai Institutes for
Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao-Tong University School of Medicine, Shanghai 200025, China
2
Graduate School of Chinese Academy of Sciences, 100049, China
3
Department of Cardiology, Changhai Hospital, Shanghai 200433, China
4
Department of Physiology, Second Military Medical University, Shanghai 200433,, China
5
Institute of Biotechnology, University of Helsinki, Helsinki 00014, Finland
6
Department of Physiology and Neurology, Ningxia Medical University, Ningxia 750004, China
*These authors contributed equally to this work
‡
Author for correspondence ([email protected])
Journal of Cell Science
Accepted 21 April, 2010
Journal of Cell Science 123, 2444-2452
© 2010. Published by The Company of Biologists Ltd
doi:10.1242/jcs.067165
Summary
MicroRNAs are involved in several aspects of cardiac hypertrophy, including cardiac growth, conduction, and fibrosis. However, their
effects on the regulation of the cardiomyocyte cytoskeleton in this pathological process are not known. Here, with microRNA microarray
and small RNA library sequencing, we show that microRNA-1 (miR-1) is the most abundant microRNA in the human heart. By applying
bioinformatic target prediction, a cytoskeleton regulatory protein twinfilin-1 was identified as a potential target of miR-1. Overexpression
of miR-1 not only reduced the luciferase activity of the reporter containing the 3⬘ untranslated region of twinfilin-1 mRNA, but also
suppressed the endogenous protein expression of twinfilin-1, indicating that twinfilin-1 is a direct target of miR-1. miR-1 was
substantially downregulated in the rat hypertrophic left ventricle and phenylephrine-induced hypertrophic cardiomyocytes, and
accordingly, the protein level of twinfilin-1 was increased. Furthermore, overexpression of miR-1 in hypertrophic cardiomyocytes
reduced the cell size and attenuated the expression of hypertrophic markers, whereas silencing of miR-1 in cardiomyocytes resulted in
the hypertrophic phenotype. In accordance, twinfilin-1 overexpression promoted cardiomyocyte hypertrophy. Taken together, our results
demonstrate that the cytoskeleton regulatory protein twinfilin-1 is a novel target of miR-1, and that reduction of miR-1 by hypertrophic
stimuli induces the upregulation of twinfilin-1, which in turn evokes hypertrophy through the regulation of cardiac cytoskeleton.
Key words: MicroRNA, miR-1, Twinfilin-1, Cardiac hypertrophy
Introduction
The heart responds to physiological stimuli, tissue injury or
endocrine disorders by undergoing hypertrophic growth to sustain
cardiac output (Frey et al., 2004). Functionally, cardiac hypertrophy
is an initial adaptive response, but prolonged hypertrophy will lead
to heart failure and sudden death (van Rooij et al., 2008b). Cardiac
hypertrophy is a complicated process accompanied with an increase
in the protein content of cardiomyocytes, the expression of fetal
cardiac genes, and reorganization of the cytoskeleton. The actin
cytoskeleton has a crucial role in the pathogenesis of
cardiomyopathy (Arber et al., 1997; Heling et al., 2000; Wei et al.,
2001). It not only contributes to morphological integrity and
mechanical resistance of the cell, but also participates in the
transmission of stress signals leading to changes in cardiac gene
expression and function (Kawamura et al., 2003).
The dynamics of the actin cytoskeleton are regulated by
multiple actin-binding proteins, which control many different
aspects of actin dynamics. Twinfilin is an evolutionarily conserved
actin-binding protein, which regulates the cytoskeletal structure
and dynamics in organisms from yeast to mammals (Goode et al.,
1998). Twinfilin binds actin monomers with high affinity and
prevents their association with actin-filament barbed ends (Ojala
et al., 2002). It also interacts with actin-filament barbed ends and
the heterodimeric capping protein, another conserved regulator
of cytoskeletal dynamics (Falck et al., 2004; Helfer et al., 2006;
Paavilainen et al., 2007). In cells, twinfilin shows diffuse
cytoplasmic localization, but also concentrates to the dynamic
cortical actin cytoskeleton (Palmgren et al., 2001). Deletion of
twinfilin in budding yeast caused enlarged cortical actin patches
and defects in the bipolar budding pattern (Goode et al., 1998).
Strong hypomorphic mutation in the Drosophila twinfilin gene
results in defects in actin-dependent development processes
(Wahlstrom et al., 2001). Two twinfilin isoforms exist in
mammals: twinfilin-1 (TWF1) is predominantly expressed in
non-muscle tissues and twinfilin-2 (TWF2), is the most abundant
isoform in skeletal muscle and the heart (Nevalainen et al., 2009;
Vartiainen et al., 2003). In cultured murine non-muscle cells,
overexpression of TWF1 leads to fewer stress fibers and the
appearance of abnormal wormlike actin-filament structures
(Vartiainen et al., 2000). In cultured neonatal rat cardiomyocytes,
TWF1 displays a punctate cytoplasmic localization and is also
enriched along myofibrils (Nevalainen et al., 2009). However,
the regulation and the function of TWF1 in heart disease are not
clear.
Journal of Cell Science
miR-1 targets TWF1 in cardiac hypertrophy
Recently, a new gene regulator, microRNA (miRNA), was
reported to have an important role in heart disease (Chen et al.,
2009; Condorelli et al., 2010; Wang et al., 2010), including cardiac
hypertrophy. miRNAs are a class of conserved, single-stranded
non-coding RNAs consisting of 18-25 nucleotides. They negatively
regulate target gene expression through mRNA cleavage or
translation repression (Bartel, 2004). Cardiac-specific deletion of
an RNase III endonuclease Dicer, which is essential for miRNA
maturation, induces sudden death and mild cardiac remodeling in
juvenile mice, and results in cardiac dysfunction with induction of
hypertrophic marker genes in the adult mice (da Costa Martins et
al., 2008). Recent studies also indicate that several miRNAs,
including miR-133 (Care et al., 2007; Luo et al., 2008), miR-208
(van Rooij et al., 2007), miR-195 (van Rooij et al., 2006) and miR1 (Care et al., 2007; Ikeda et al., 2009; Luo et al., 2008; Sayed et
al., 2007) actively participate in cardiomyocyte hypertrophy. Among
them, miR-1 is a muscle-specific miRNA, which has an important
role in cardiac development and differentiation (van Rooij et al.,
2008a; Zhao et al., 2007; Zhao et al., 2005). It also regulates
cardiac hypertrophy by controlling cardiac growth, conduction and
calcium-dependent signaling (Care et al., 2007; Ikeda et al., 2009;
Luo et al., 2008; Sayed et al., 2007). However, it is not known
whether miRNAs participate in the regulation of the cytoskeleton
during cardiac hypertrophy.
Here, we show that TWF1, a cytoskeleton regulatory protein, is
a direct downstream target of miR-1. Accompanied with the
downregulation of miR-1, levels of TWF1 were increased in cardiac
hypertrophy, both in vivo and in vitro. Overexpression of miR-1 in
cardiomyocytes inhibited the hypertrophic phenotype induced by
phenylephrine (PE), whereas silencing the endogenous miR-1
resulted in cellular hypertrophy. We further demonstrate that
upregulation of TWF1 promotes cardiomyocyte hypertrophy.
Results
miRNA expression profile of the human heart
Previous studies have provided variable results concerning the
identity of the most abundantly expressed miRNAs in the heart
(Lagos-Quintana et al., 2002; Landgraf et al., 2007). Thus, we
performed microarray-based miRNA profiling analysis with total
RNA from the human heart. Of the 719 human miRNAs probed,
only 237 were detectable. The top 23 miRNAs with signal intensity
above 4000 are presented in Fig. 1. Among them, miR-1 was most
abundant in heart. Several families including let-7, miR-26, miR126, and miR-133 were also among the enriched miRNAs in
human heart, consistent with a previous report (Landgraf et al.,
2007). A complete list of the expression profile of miRNAs in the
heart is presented in supplementary material Table S1.
Verification of heart-enriched miRNAs and identification of
miRNA sequence heterogeneity in the heart
To verify miRNAs enriched in the heart, we constructed a small
RNA library with human heart total RNA and sequenced the
obtained small RNA clones. Among the 251 sequenced clones, 113
(45%) were annotated to known miRNAs (see supplementary
material Table S2). The remaining small RNA clones corresponded
to fragments of rRNA, tRNA, mRNA and repeat sequences from
the human genome (data not shown). Among the miRNA clones,
we identified 27 distinct miRNAs, 15 of which were cloned several
times and the remaining 12 were cloned just once. Most of the
miRNAs (22/27) obtained were present in the top 50 miRNAs of
the above microarray data, suggesting the consistency of the results
2445
Fig. 1. miRNA expression profile of human heart by microarray analysis.
The signal intensity represents the average of five repeats in the array. The 23
miRNAs detected with signal intensity higher than 4000 are presented in the
figure.
obtained by the two methods. It is important to note that miR-1
accounted for 24% (27/113) of the total miRNAs clones, indicating
that miR-1 is, at least based on our study, indeed the most abundant
miRNA in the heart.
Detailed analysis of our data revealed that compared with the
mature miRNA sequences annotated in miRBase (release 13.0),
the miRNAs cloned here from the human heart showed an extensive
degree of heterogeneity, including deletions or extensions at 3⬘ and
5⬘ ends. Some of the variations are shown in Table 1. For instance,
five of 27 miR-1 clones had an AU deletion at 3⬘ end, and two
contained an extra A at the 5⬘ end. The most prevalent variation of
miR-126 was a deletion of U at the 5⬘ end. Overall, the 3⬘-end
variations (46.9% of total clones) were more abundant than those
of the 5⬘ end (21.2% of total clones); 3⬘-end deletions were
especially typical when A or U was the last nucleotide
(supplementary material Table S3).
Next, seven miRNAs presented in both microarray and cloning
data were selected for Northern blot verification with the total
RNA extracted from mouse tissues (Fig. 2 and supplementary
material Fig. S1). MiR-1 and miR-133 were found to be specific
to the heart and skeletal muscle, as reported previously (Liu et al.,
2007), and miR-125b was highly expressed in lung, heart and
stomach; miR-23b, miR-26a, miR-27b and let-7b displayed
ubiquitous expression in all detected tissues. In addition, verification
was also performed with rat tissues. Consistently with the results
obtained in mice, these miRNAs showed a similar expression
pattern in the rat tissues (data not shown).
miR-1 is specifically expressed in cardiomyocytes
Northern blot analysis revealed that miR-1 was specifically
expressed in heart and skeletal muscle (Fig. 2A). Real-time PCR
analysis also confirmed the cardiac-enriched expression of miR-1
both in rat (Fig. 2B) and mouse (data not shown). To further
investigate the expression pattern of miR-1 in various cell types of
the heart, we isolated cardiac myocytes and fibroblasts from the rat
2446
Journal of Cell Science 123 (14)
Table 1. Examples of heterogeneity in miRNA sequences
miRNA
hsa-miR-1
hsa-miR-126
Journal of Cell Science
hsa-miR-26a
Sequence (5⬘ to 3⬘)a
AUGGAAUGUAAAGAAGUAUGUAUCU
UGGAAUGUAAAGAAGUAUGUAU
UGGAAUGUAAAGAAGUAUGU
UGGAAUGUAAAGAAGUAUGUA
AUGGAAUGUAAAGAAGUAUGUAU
UGGAAUGUAAAGAAGUAUGUAUu
UGaAAUGUAAAGAAGUAUGUA
CUCGUACCGUGAGUAAUAAUGCGCC
UCGUACCGUGAGUAAUAAUGCG
CGUACCGUGAGUAAUAAUGCG
UCGUACCGUGAGUAAUAAUGC
CGUACCGUGAGUAAUAAUGC
UCGUACCGUGAGUAAUAAU
UCGUACCGUGAGUAAUAAUGCGa
CGUACCGUGAGUAAUAAUGCGu
GUUCAAGUAAUCCAGGAUAGGCUGU
UUCAAGUAAUCCAGGAUAGGCU
UUCAAGUAAUCCAGGAUAGGC
UUCAAGUAAUCCAGGAUAGG
UCAAGUAAUCCAGGAUAGGCU
AAGUAAUCCAGGAUAGGCU
cUCAAGUAAUCCAGGAUAGGCU
Number
of clones
14
5
3
2
1
1
9
8
2
1
1
2
1
7
6
2
1
1
1
Notes
Untemplated
Untemplated
Untemplated
a
The annotated mature miRNA sequence from miRBase is underlined and a
few nucleotides flanking the sequence are also shown. The untemplated
nucleotide additions or mutations in the cloned sequence are shown in lower
case letters.
heart and detected the expression of miR-1. miR-1 was detected
predominantly in cardiac myocytes, but was undetectable in cardiac
fibroblasts by Northern blot analysis (Fig. 2C). Similar results
were obtained by real-time PCR analysis (Fig. 2D). We also found
that miR-1 expression was below the detectable level in primary
cultured cardiac vascular cells, including human coronary artery
smooth muscle cells, endothelial cells (Fig. 2C), as well as in
several non-cardiac cell lines: NIH3T3, HEK293T and HeLa cells
(supplementary material Fig. S2A). Therefore our data indicated
that miR-1 is a myocyte-specific miRNA in the heart.
TWF1 is a target of miR-1
It has been established that miRNA exerts its function by repressing
the expression of its target genes. Therefore, we searched for the
potential targets of miR-1. Combined with several bioinformatic
algorithms, TWF1 was selected as a putative target of miR-1. Two
miR-1-binding sites (labeled MBS1 and MBS2 in Fig. 3A) within
the TWF1 3⬘ untranslated region (UTR) were identified using the
RNA-hybrid program (Rehmsmeier et al., 2004) (Fig. 3A). The
nucleotides complementary to the miR-1 seed sequences are highly
conserved in human, mouse and rat, indicating the generality of
the relationship between miR-1 and TWF1. There is a TWF1
homolog in mammalian cells, TWF2, which has no putative MBS
in its 3⬘ UTR. Interestingly, the two isoforms have distinct
expression patterns (Fig. 3B): TWF1 is the major isoform in nonmuscle tissues including liver, lung and kidney, but expressed at
low levels in heart and skeletal muscle, which was inversely related
to the expression pattern of miR-1; by contrast, TWF2 is strongly
expressed in cardiac and skeletal muscle and displayed no similar
relationship with miR-1.
To examine whether miR-1 regulates TWF1 expression through
its 3⬘ UTR, we generated luciferase reporters with insertion of the
mouse Twf1 or Twf2 3⬘ UTRs. Overexpression of miR-1, but not
miR-126, dramatically decreased the activity of the luciferase
Fig. 2. miR-1 is highly expressed in skeletal muscle and heart, and is
specifically expressed in cardiomyocytes but hardly detectable in nonmuscle cells. (A)Northern blot analysis of miR-1 expression in various tissues
from adult mouse. Equal loading of total RNAs is shown by U6. Sk. M,
skeletal muscle. (B)Real-time PCR analysis of miR-1 expression in various
tissues from rat (n3). U6 was used for internal control. The relative
expression level of miR-1 in the heart was normalized as 100. (C)Northern
blot analysis of miR-1 expression in indicated cell types. ECs, human
endothelial cells from coronary artery. SMCs, human smooth muscle cells
from coronary artery. Cardiac myocytes and fibroblasts were isolated from
neonatal rat hearts. (D)Real-time PCR analysis of miR-1 expression in cardiac
myocytes and fibroblasts from neonatal rat heart. U6 was used for
normalization. The expression level of miR-1 in the cardiomyocytes is shown
as 100.
reporter bearing the 3⬘ UTR of Twf1. By contrast, neither miR-1
nor miR-126 inhibited the activity of the luciferase reporter
containing the Twf2 3⬘ UTR (Fig. 4A). To figure out which one of
the two putative MBSs in Twf1 3⬘ UTR was responsible for the
expression suppression, we performed site-directed mutagenesis to
destroy the MBSs individually or simultaneously (Fig. 4B). Our
result showed that each MBS mutation could partially rescue the
luciferase activity suppressed by miR-1. Inactivation of both MBSs
almost completely rescued the suppression of the luciferase activity
by miR-1 (Fig. 4C). Therefore, the luciferase activity suppression
conferred by miR-1 was mediated mainly by the two MBSs, which
contributed equally, although the presence of additional potential
MBSs cannot be excluded.
To verify whether miR-1 could repress endogenous TWF1
protein expression, NIH3T3 cells which express high level of
endogenous TWF1 (supplementary material Fig. S2B) were
infected with lentivirus overexpressing miR-1 (Lenti-miR-1) or
miR-126 (Lenti-miR-126). Several clones stably expressing miR1 or miR-126 were established. The expression level of miR-1 in
miR-1 targets TWF1 in cardiac hypertrophy
2447
126 had no effect on the endogenous TWF2 protein level (Fig.
4E,F). Collectively, our results indicate that Twf1 is directly targeted
by miR-1 and this inhibitory effect is mediated through its 3⬘ UTR.
A mild change in the level of miR-1 did not affect the amount of
Twf1 mRNA. However, robust expression of miR-1 (at a similar
level to that in the heart) could reduce the amount of Twf1 mRNA.
Journal of Cell Science
TWF1 is increased in hypertrophic rat hearts and in
PE-induced hypertrophic cardiomyocytes
Fig. 3. Target prediction by bioinformatics. (A)Complementation between
miR-1 and its binding sites in the 3⬘ UTR of Twf1 and the target sequence
conservation across human, mouse and rat. The absolute positions of the miR1 binding sites in rat Twf1 mRNA are shown. MBS, miR-1 binding site.
(B)Real-time PCR analysis of Twf1 and Twf2 expression in indicated mouse
(left) and rat (right) tissues (n3 respectively). 28S rRNA was used as an
internal control. The expression of Twf1 in the heart was normalized as 1.
the selected miR-1-expressing clones was about 1% of that in the
rat hearts (supplementary material Fig. S3A). Real-time PCR
analysis indicated that neither Twf1 nor Twf2 mRNA levels showed
obvious change in the miR-1-expressing clones compared with
that in the control cells (Fig. 4D). However, infection of NIH3T3
cells with adenovirus expressing miR-1 (Ad-miR-1), which induced
a similar expression level of miR-1 as that in the rat heart
(supplementary material Fig. S3A), reduced the mRNA level of
Twf1 compared with that infected with the adenovirus expressing
the vector only (Ad-vector), whereas the mRNA level of Twf2 was
not affected by Ad-miR-1 infection (supplementary material Fig.
S3B). Western blot analysis showed that the protein level of TWF1
was decreased in the clones infected with Lenti-miR-1, but not in
those with Lenti-miR-126. Overexpression of either miR-1 or miR-
Previous studies have linked miR-1 to cardiac hypertrophy, and the
expression level of miR-1 was dynamically and inconstantly
regulated during the early process (Care et al., 2007; Ikeda et al.,
2009; Luo et al., 2008; Sayed et al., 2007). To address this issue,
we first verified the changes of cardiac miR-1 expression in a rat
cardiac hypertrophy model generated by abdominal aorta
constriction (AAC). After constriction for 1 week, the ratio of heart
weight to body weight was significantly increased (supplementary
material Fig. S4A), and the hearts showed apparent hypertrophic
growth compared with those of sham operated animals (Fig. 5A).
Several hypertrophic markers, including the atrial natriuretic peptide
(Nppa), skeletal muscle and cardiac -actin (Acta1 and Actc1,
respectively), and - and -myosin heavy chain (Myh6 and Myh7,
respectively) were also examined. As expected, Acta1, Myh7 and
Nppa were upregulated, whereas Myh6 was downregulated
(supplementary material Fig. S4B). With real-time PCR analysis,
the level of miR-1 in the hypertrophic left ventricle was decreased
by 36% compared with that in the sham controls (Fig. 5B). Northern
blot analysis further confirmed the downregulation of miR-1 in
hypertrophic hearts (Fig. 5C). To investigate whether the repression
of TWF1 by miR-1 could have pathological role in this process,
we detected the expression of TWF1 in hypertrophic left ventricle.
Real-time PCR analysis showed that the mRNA level of Twf1 was
slightly increased, though without statistical significance (Fig. 5D).
Also the protein level of TWF1 was increased as determined by
western blot analysis (Fig. 5E). We additionally induced the primary
cultured neonatal rat cardiomyocyte hypertrophy in vitro by
stimulation with phenylephrine (PE). After 48 hours of treatment,
the cardiomyocytes developed hypertrophy, which was made
evident by the increased cell surface area (Fig. 6A,B). Real-time
PCR analysis revealed that the expression of miR-1 in hypertrophic
Fig. 4. TWF1 is validated as a target of miR-1. (A)Luciferase
reporter assay was performed by cotransfection of luciferase
reporter containing 3⬘ UTR from either Twf1 or Twf2 with indicated
miRNA expression vectors. Luciferase activity was determined 24
hours after transfection. **P<0.01 vs vector. (B)The miR-1
complementary sequences in Twf1 3⬘ UTR were mutated by sitedirected mutagenesis. The mutated nucleotides are highlighted in
red. (C)Luciferase reporter assay was performed as in A, with
reporter containing wild-type (WT) or mutated Twf1 3⬘ UTRs,
respectively. MBS1+2-MT, mutation of both miR-1 binding sites.
*P<0.05 vs vector. **P<0.01 vs vector. (D)NIH3T3 cells were
infected with lentivirus expressing miR-1 (Lenti-miR-1) or miR126 (Lenti-miR-126), and stable expression clones were selected.
Real-time PCR analysis of the mRNA level of Twf1 and Twf2 in the
miRNA expression NIH3T3 clones. (E)The protein level of TWF1
was reduced when overexpressing miR-1, but not miR-126.
Western blot analysis was performed using antibody against TWF1,
TWF2 or GAPDH. (F)Quantitative analysis of the western blot
results in E. *P<0.05 vs mock control.
Journal of Cell Science
2448
Journal of Cell Science 123 (14)
Fig. 5. TWF1 is increased in hypertrophic rat hearts in contrast to
downregulation of miR-1. Rats were subjected to sham operation or AAC for
7 days, and then the hearts were analyzed. (A)H&E staining of representative
hearts from rats after sham operation or AAC. Scale bar: 2 mm. (B)Real-time
PCR analysis of the expression of miR-1 in sham and AAC rat hearts (n8 for
sham group; n9 for AAC group). **P<0.01 vs sham. (C)Northern blot
analysis of the expression of miR-1 in sham and AAC rat hearts, 5.8S rRNA
was used as loading control. (D)The mRNA level of Twf1 was slightly
increased in AAC rat hearts, although the increase did not display statistical
significance. (E)TWF1 was upregulated in AAC rat hearts as determined by
western blot analysis.
cardiomyocytes was decreased by 30% compared with that in the
controls (P<0.05; Fig. 6C). In agreement with the reduction of
miR-1, the endogenous TWF1 protein level was upregulated in
PE-induced hypertrophic cardiomyocytes (Fig. 6D). However, there
was no obvious change in the protein level of TWF2
(supplementary material Fig. S5). These results suggest that TWF1
is de-repressed by miR-1 during the pathogenesis of cardiac
hypertrophy.
Overexpression of miR-1 attenuates PE-induced
cardiomyocyte hypertrophy
To further investigate the possible effects of miR-1 on
cardiomyocyte hypertrophy, we infected neonatal rat
cardiomyocytes with Ad-miR-1, and examined the miR-1
expression levels. The Ad-vector was used as a control. The
infection of cardiomyocytes with Ad-miR-1 induced a tenfold
increase of miR-1 over the endogenous level as determined by
real-time PCR analysis (supplementary material Fig. S6A), and the
protein level of TWF1 was decreased (supplementary material Fig.
S7B). Neonatal cardiomyocytes were infected with Ad-miR-1 or
Ad-vector for 12 hours, followed by treatment with PE for
additional 36 hours. Overexpression of miR-1 impaired the increase
in cell size induced by PE stimulation as measured by cell surface
area (Fig. 7A,B). Furthermore, overexpression of miR-1 reduced
the basal level of cell size without PE-stimulation (supplementary
material Fig. S6B,C). The results indicate that miR-1
overexpression in cardiomyocytes affects the morphology and
structure of the cell, perhaps through the regulation of the
cytoskeleton. To determine the effect of miR-1 overexpression on
hypertrophic cardiomyocytes at the molecular level, the
hypertrophic markers, Acta1, Myh7 and Nppa were examined.
Fig. 6. TWF1 is upregulated in hypertrophic cardiomyocytes. (A)-actinin
staining shows the hypertrophy of neonatal cardiomyocytes treated with
100M phenylephrine (PE) for 48 hours. Representative confocal images are
shown. Scale bar: 10m. (B)Quantitative analysis of cardiomyocyte size.
Approximately 200 cells immunostained with anti--actinin antibody were
randomly chosen from each treatment for surface area measurement. (C)The
expression level of miR-1 was decreased in PE-treated cardiomyocytes
analyzed by real-time PCR. *P<0.05, **P<0.01 vs control. (D)TWF1 was
upregulated in PE-induced hypertrophic cardiomyocytes as determined by
western blot analysis.
Expression of all these genes was significantly reduced in AdmiR-1-infected cells (Fig. 7C). These results indicate that miR-1
overexpression could inhibit cardiomyocyte hypertrophy. To access
whether silencing of the endogenous miR-1 would result in
hypertrophy in vitro, we generate an adenoviral vector in which a
3⬘UTR with tandem miR-1-binding sites is linked to the enhanced
green fluorescent protein (EGFP) reporter gene. The complementary
sequence acts as a sponge to sequester the endogenous miR-1.
Infection of Ad-sponge (Ad-spg) rescued the luciferase activity of
the reporter suppressed by miR-1 in HEK293T cells (supplementary
material Fig. S7A), indicating that Ad-spg could silence the miR1. Then the cardiomyocytes were infected with Ad-spg. Western
blot analysis showed that the protein level of TWF1 was increased
by Ad-spg infection (supplementary material Fig. S7B).
Importantly, infection of Ad-spg significantly increased the cell
size (Fig. 7D,E) and upregulated the expression of the hypertrophic
markers (Fig. 7F). These results indicate that silencing of the
endogenous miR-1 de-represses the expression of TWF1, and
induces cardiomyocyte hypertrophy. Collectively, these data
suggests that elevated level of miR-1 inhibits cardiac hypertrophy;
however, blocking the function of miR-1 directly induces cardiac
hypertrophy, which might occur through the de-repression of
TWF1. Our results thus support the notion that miR-1 has antihypertrophic activities.
Overexpression of TWF1 provokes cardiomyocyte
hypertrophy
To test whether the increase of TWF1 is sufficient to induce cardiac
hypertrophy, we constructed an adenovirus overexpressing TWF1
(Ad-twf-1), and infected the neonatal cardiomyocytes. After
infection for 48 hours, the cell size as measured by cell surface
miR-1 targets TWF1 in cardiac hypertrophy
2449
Journal of Cell Science
Fig. 8. TWF1 overexpression in cardiomyocytes induces cellular
hypertrophy. (A)Neonatal rat cardiomyocytes were infected with
recombinant adenovirus expressing TWF1 (Ad-twf-1) or empty vector (Advector) for 48 hours. -actinin staining of cardiomyocytes indicated that
overexpression of TWF1 augmented cell size. Representative confocal images
are shown. Scale bar: 10m. (B)Quantitative analysis of cardiomyocyte size.
(C)Real-time PCR analysis of the expression of the indicated hypertrophic
markers in cardiomyocytes infected with Ad-twf-1 or Ad-vector for 48 hours.
*P<0.05, **P<0.01 vs Ad-vector.
Fig. 7. Effects of overexpression or knockdown of miR-1 or TWF1 on
cardiomyocytes. Cardiomyocytes were infected with recombinant adenovirus
expressing miR-1 (Ad-miR-1) or empty vector (Ad-vector) for 12 hours, and
treated with 20M PE for additional 36 hours, then the cells were analyzed.
(A)Overexpression of miR-1 in PE-treated neonatal rat cardiomyocytes
reduced the cell size. Representative confocal images of -actinin
immunostaining are shown. Scale bar: 10m. (B)Quantitative analysis of
cardiomyocyte size. (C)MiR-1 inhibited the expression of the indicated
hypertrophic markers in PE-stimulated neonatal rat cardiomyocytes by realtime PCR analysis. (D)Neonatal rat cardiomyocytes were infected with
recombinant adenovirus expressing miR-1 sponge (Ad-spg) or Ad-vector for 48
hours. -actinin staining of cardiomyocytes indicated that the cell size of Adspg infected cardiomyocytes was augmented. Representative images are
captured by confocal microscope. Scale bar: 10m. (E)Quantitative analysis of
cardiomyocyte size. (F)The expression of the indicated hypertrophic markers
was upregulated in cardiomyocytes infected with Ad-spg compared with that
infected with Ad-vector by real-time PCR analysis. **P<0.01 vs Ad-vector.
area was increased with Ad-twf-1 infection compared with that
with the Ad-vector infection (Fig. 8A,B). The expression of the
hypertrophic marker genes was subsequently examined in
cardiomyocytes infected with Ad-twf-1 or Ad-vector by real-time
PCR analysis. The result showed that Nppa expression was
significantly increased by Ad-twf-1 infection (Fig. 8C), indicating
that the upregulation of TWF1 directly promotes the pathogenesis
of cardiomyocyte hypertrophy.
Discussion
MiRNAs were recently shown to have a fundamental role in the
regulation of a wide range of cardiac functions. In this study, we
profiled the miRNA expression in the heart by miRNA microarray,
and obtained a collection of miRNAs expressed in human heart.
The heart-enriched miRNAs were verified using small RNA
cloning and Northern blot analyses. We revealed that miR-1 is
the most abundant miRNA in the heart and that its expression is
limited to cardiomyocytes. Importantly, our work identified an
actin-binding protein TWF1 as a direct target of miR-1, and
provided evidence that downregulation of miR-1, together with
the consequent increase in the cellular TWF1 levels, might result
in cardiac hypertrophy.
Interestingly, our work revealed that mature miRNAs in the
heart exhibit an extensive degree of sequence end polymorphism.
Such end variations have also been noted in other species or tissues
(Lagos-Quintana et al., 2002; Landgraf et al., 2007; Ruby et al.,
2006; Wu et al., 2007), but the polymorphism observed here in the
heart appears to be more dramatic than previously reported: 68.1%
of the obtained clones showed 3⬘- or 5⬘-end heterogeneity. The
miRNA end polymorphism might reflect imprecise cleavage by
Drosha or Dicer. Furthermore, the 3⬘-end polymorphism appears
more frequent than that at the 5⬘ end, which might be due to less
precise cleavage by these two enzymes or preferential degradation
at 3⬘ end. The untemplated addition of nucleotides indicates that
there are enzymes in the heart that generate end modification after
digestion by Drosha and Dicer. Notably, the end polymorphism
might affect the function of the mature miRNAs. It is clear that the
changes in the 5⬘-end seed sequence can influence target
recognition; the 3⬘-end polymorphism might affect the stability,
subcellular localization and functional efficacy of miRNA (Hwang
et al., 2007; Li et al., 2005). Recently, a new method called deep
sequencing was developed to extensively explore miRNA
discovery. This high-throughput approach can acquire large
quantities of sequence readout to identify miRNAs with low
abundance, as well as to classify sequence polymorphism for
miRNAs.
MiR-1 was identified as the most abundant miRNA in the heart.
Our data further demonstrated that miR-1 was specifically present
in cardiomyocytes, indicating that miR-1 has an essential role in
the regulation of cardiomyocyte morphology and/or function. In
the present study, we show that miR-1 was apparently
downregulated in the AAC hypertrophic rat left ventricle and PEinduced hypertrophic cardiomyocytes. Our result that
overexpression of miR-1 in cardiomyocytes attenuated the
hypertrophic phenotype, whereas the reduction of miR-1 resulted
in cellular hypertrophy, together with previous reports (Care et al.,
2007; Ikeda et al., 2009; Sayed et al., 2007), clearly indicate the
inhibitory effect of miR-1 on cardiac hypertrophy. The re-expression
of fetal genes such as Acta1, Myh7 and Nppa is characteristic of
cardiac hypertrophy, and they are used most commonly as
molecular markers of hypertrophy. The expression of these genes
Journal of Cell Science
2450
Journal of Cell Science 123 (14)
is regulated by several transcription factors, including the GATA
family members, transcriptional enhancer factor-1 (TEF-1), serum
response factor (SRF) and Nkx2-5, which can be activated by the
calcium-dependent calcineurin-NF-AT3 signal pathway, MAPK
pathway and the PI3K cascade. It has been shown that miR-1
directly targets calmodulin and Mef2a (Ikeda et al., 2009) during
cardiac hypertrophy. By negatively regulating the expression of
calmodulin and Mef2a, as well as another important transcription
factor GATA4, miR-1 could attenuate the calcineurin-NF-AT3
signal pathway and downregulate the expression of the downstream
hypertrophic markers. Since induction of the fetal genes is the
integrated result of several signal pathways, miR-1 might also
regulate the expression of other upstream signal molecules to affect
the expression of the hypertrophic markers.
As commonly accepted, miRNA exerts its function through the
regulation of several target genes. Therefore, identification of the
targets is crucial for understanding the mechanism of miRNAs in
regulating diverse biological processes. In the present study, by
using several approaches, we demonstrate that the cytoskeleton
regulatory protein TWF1 is a novel target of miR-1. First, there are
two putative MBSs in the 3⬘ UTR of TWF1 analyzed by
bioinformatic algorithms. Second, the expression level of TWF1
was low in the heart, which is inversely related with the high
expression level of miR-1. Third, overexpression of miR-1
significantly reduced the luciferase activity of the reporter
containing the 3⬘ UTR of TWF1. In addition, increased expression
of miR-1 in NIH3T3 cells reduced endogenous levels of TWF1
protein. More importantly, in hypertrophic heart and
cardiomyocytes, the upregulation of TWF1 was in accordance with
the downregulation of miR-1, but the TWF1 homolog protein
TWF2, which contains no miR-1-binding sites in the 3⬘UTR of its
mRNA did not show obvious change in the cellular hypertrophic
model. Taken together, our results suggest that in the pathological
process of cardiac hypertrophy, TWF1 is directly regulated by
miR-1. Furthermore, overexpression of TWF1 in cardiomyocytes
induced cellular hypertrophy.
TWF1 contributes to actin dynamics by sequestering actin
monomers, capping actin-filament barbed ends, and by interacting
with the heterodimeric capping protein. TWF1 promotes actinbased motility in vitro and regulates actin dynamics at the leading
edge of motile cells (Helfer et al., 2006; Vartiainen et al., 2000;
Vartiainen et al., 2003), but the exact mechanism by which the
combination of its three distinct biochemical activities drive actin
dynamics in cells is not understood. In PE-treated cardiomyocytes,
TWF1 displays mainly a diffuse cytoplasmic localization but also
concentrates to the non-sarcomeric actin filament structures at the
cell protrusions (supplementary material Fig. S8). It is thus possible
that, analogously to morphogenesis and motility of non-muscle
cells, TWF1 regulates the turnover of the cortical actin cytoskeleton
also in cardiomyocytes to promote their expansion during
hypertrophy. However, the exact molecular mechanism by which
TWF1 regulates cardiac hypertrophy warrants further investigation.
It is important to note that also TWF2 is expressed in the heart, but
its expression is not regulated by miR-1. TWF1 and TWF2 bind
actin and capping protein though conserved sites (Nevalainen et
al., 2009; Paavilainen et al., 2008) and thus competition between
these two proteins for actin or capping protein might also contribute
to the morphology of cardiomyocytes.
Recent work showed that a signature of miRNAs is dysregulated
during cardiac hypertrophy, and these tiny RNAs were reported to
regulate diverse aspects in the pathogenesis of the disease (Care et
al., 2007; Ikeda et al., 2009; Luo et al., 2008; Sayed et al., 2007;
van Rooij et al., 2007). MiR-208 influences cardiac contractility
by regulating myosin heavy chain, and miR-133 inhibits cardiac
hypertrophy by regulating the Rho signaling and automaticity of
the heart. miR-1 has also been verified to target several genes in
cardiac hypertrophy (Ikeda et al., 2009; Luo et al., 2008; Sayed et
al., 2007): calmodulin and Mef2a, which are crucial mediators of
the calcium-dependent signal pathway during cardiac hypertrophy;
growth-related genes, including those encoding RasGAP, Cdk9,
fibronectin and Rheb; and HCN2 and HCN4, which are involved
in the automaticity regulation of the heart. Our data showing that
the cytoskeleton regulatory protein TWF1 is a new target of miR1, suggest that miR-1 could prevent cardiac hypertrophy by
regulating the cytoskeleton, and thus further clarifies the function
of miR-1 during cardiac hypertrophy.
Collectively, we speculate that downregulation of miR-1 by
hypertrophic stimuli results in the increase of TWF1, which in turn
induces cardiac hypertrophy through the regulation of cardiac
cytoskeleton. Our results reveal cardiac cytoskeleton regulated by
miRNAs as a new direction for further investigation concerning
the mechanism of cardiac hypertrophy. Therefore, appropriate
manipulation of the expression of TWF1 in cardiomyocytes might
help to prevent the initiation and progression of cardiac hypertrophy.
Materials and Methods
Cell culture
Primary cultured human coronary artery smooth muscle cells, endothelial cells and
human umbilical vein endothelial cells are purchased from Cascade Biologics
(Portland, OR). The cells were maintained in cell-specific medium supplemented
with growth supplement provided by the manufacturer. HEK293T, HEK293A,
HEK293FT and NIH3T3 cells were maintained in Dulbecco’s modified Eagle’s
medium (DMEM) supplemented with 10% fetal bovine serum.
RNA preparation
The total RNA of the human heart was purchased from Ambion, Inc. The donor is
a 71 year old Caucasian male who died of head trauma. The total RNA from mouse,
rat tissues, or cultured cells, was extracted using TRIzol reagent according to the
protocol of the manufacturer (Invitrogen).
miRNA microarray
The miRNA expression profile of the human heart was determined by miRNA
microarray analysis using the human miRNA array (LC Sciences, Houston, TX),
which includes 718 mature human miRNA probes (Sanger miRBase, release 10.1).
5 g total RNA was size-fractionated (<200 nucleotides) and labeled with Cy5
fluorescent dyes. Then the labeled sample was hybridized to microarray. The
microarray data are based on five replicates for each miRNA. Results have been
deposited in the public database Gene Expression Omnibus.
Small RNA library preparation
Cloning of miRNAs was performed as described (Lagos-Quintana et al., 2002).
Human heart total RNA was separated on a 15% denaturing polyacrylamide gel, and
RNA of 18- to 25-nt range in size was recovered. A 5⬘ phosphorylated 3⬘ adaptor
oligonucleotide (5⬘-pUUUaaccgcgaattccagx: uppercase, RNA; lowercase, DNA; p,
phosphate; x, 3⬘-amino-modifier C-7) and a 5⬘ adaptor oligonucleotide (5⬘acggaattcctcactAAA: uppercase, RNA; lowercase, DNA) were ligated to the
recovered RNAs. RT-PCR was performed with 3⬘ primer (5⬘-GACTAGCTGGAATTCGCGGTTAAA-3⬘) and 5⬘ primer (5⬘-CAGCCAACGGAATTCCTCACTAAA-3⬘). After recovery, the 3⬘ ends of the PCR product were
filled in by incubating for 15 minutes at 72°C with Taq polymerase, and then this
solution was used for ligation into T vectors. Clones were randomly picked and
screened by PCR for inserts, and then subjected to sequencing.
Northern blot analysis for miRNA
Total RNA (40 g) was resolved in a 15% denaturing polyacrylamide gel, and then
electro-transferred to a Nylon membrane Hybond-N+ (Amersham Biosciences).
After UV crosslinking, the membrane was pre-hybridized for 30 minutes, and then
hybridized with -32P-labeled specific probes for 12 hours. Probes was washed twice
for 10 minutes each and exposed to X-ray film at –80°C.
Quantitative reverse-transcriptase polymerase chain reaction (RT-PCR)
The total RNA (500 ng) extracted from tissues or cells was used to generate cDNA
by using SuperScript II reverse transcriptase (Invitrogen) with special stem-loop
miR-1 targets TWF1 in cardiac hypertrophy
primer for miRNA and oligo-dT or random primer for mRNA. Real-time quantitative
PCR was performed on a LightCycler 480 quantitative PCR system (Roche) using
SYBR Green (TOYOBO Co). Primers used in the amplification reaction are as
follows (shown 5⬘ to 3⬘): 28S rRNA F, AGCAGCCGACTTAGAACTGG and R,
TAGGGACAGTGGGAATCTCG; U6 F, CTCGCTTCGGCAGCACA and R,
AACGCTTCACGAATTTGCGT; mouse Twf1 F, ATTTGCTGTCCCAGTCTTCC
and R, TACGCCTTGGAGTGTCTGGT; mouse Twf2 F, GCTCTTCGGGACAGTAAAGGA and R, CGGATCTGCTGGAGTTCTCT; rat Gapdh F,
AACGACCCCTTCATTGACCTC and R, CCTTGACTGTGCCGTTGAACT; rat
Twf1 F, ATGCCCGGATACACATGC and R, CATCCCCATTGTCTATCTCAATC;
rat Twf2 F, TCCTTGACTCTGTGGAGCAG and R, TCGCCGATCTCAATCTTCTT;
rat Acta1 F, GGTTATGCCCTGCCACAC and R, ATGTCGCGCACAATCTCAC;
rat Myh7 F, GAGCCTCCAGAGTTTGCTGAAGGA and R, TTGGCACGGACTGCGTCATC; rat Nppa F, CGGAAGCTGTTGCAGCCTA and R,
GCCCTGAGCGAGCAGACCGA.
Bioinformatic analysis
The miRanda (John et al., 2004) algorithms were used to identify potential targets
of miR-1. The RNA-hybrid program (Rehmsmeier et al., 2004) was used to predict
multiple potential miR-1 binding sites in the 3⬘ UTR of mRNA.
Construction of plasmids and site-directed mutagenesis
Journal of Cell Science
The precursor sequence for miR-1 or miR-126 was amplified by PCR using human
genomic DNA as a template, and the PCR products were cloned into the pSuper
vector to generate miRNA expression plasmids. For construction of the luciferase
reporter plasmid, the full-length 3⬘ UTR of Twf1 or Twf2 were amplified from mouse
genomic DNA by PCR, and inserted into the 3⬘ UTR of the firefly luciferase gene.
The mutated 3⬘ UTR luciferase reporter plasmids were generated by site-directed
mutagenesis using the QuikChange site-directed mutagenesis kit, according to the
manufacturer’s instructions (Stratagene).
2451
2007), and then cotransfected with VSVG and PAX2 plasmids into HEK293FT cells
to produce lentivirus overexpressing miR-1 or miR-126.
Primary cardiomyocytes culture and adenovirus infection
Neonatal rat cardiomyocytes were isolated from 1- to 3-day-old Sprague-Dawley
rats. Briefly, isolated hearts were digested with 0.2% trypsin at 37°C under 100
r.p.m. rotation. After dissociation, the cells were subjected to centrifugation to
enrich the myocytes, followed by differential preplating to separate from the nonmyocytes. Cells were plated in DMEM with 20% fetal bovine serum and BrdU at
a density of 3-5⫻105/ml. 48 hours after plating, serum was removed and the cells
were infected with recombinant adenovirus at a multiplicity of infection (MOI) of
100. 48 hours later, cells were harvest for morphology observation, and RNA or
protein analysis.
Cardiomyocyte immunochemistry and cell surface area analysis
Cells were fixed in 4% paraformaldehyde for 15 minutes and permeabilized with
0.1% Triton X-100 in PBS, followed by blocking with 5% goat serum in PBS for 1
hour at room temperature. They were then incubated with anti-actinin antibody
(Sigma) at 1:500 overnight, after washing with PBS three times, the second antibody
coupled with Alexa Fluor 555 (Molecular Probes) was added to the cells. The nuclei
were stained with 4⬘,6-diamidino-2-phenylindole (DAPI). After washing, the slides
were mounted using fluorescent mounting medium. Cell surface area was analyzed
using software AxioVision 4.7.1 (Carl Zeiss). Images were captured using an
Olympus confocal microscope (FV1000) or a Leica confocal microscope (TCS
SP5).
Statistical analysis
All experiments were performed at least three times. Data are expressed as means ±
s.e.m. For relative gene expression, the mean value of vehicle control group is
defined as 1. Unpaired Student’s t-test was used for statistical comparison of the
data. Values of P<0.05 were considered to be significant.
Luciferase assay
HEK293T cells were transfected with luciferase reporter plasmids and the miRNA
expression plasmid, and a Renilla luciferase plasmid was cotransfected as an internal
control. Cells were harvested 24 hours after transfection. Luciferase activities were
measured with a dual luciferase reporter assay kit (Promega) on a luminometer
(Lumat LB9507), as described previously (Luo et al., 2008).
Western blot analysis
Western blotting was performed as described previously (Jing et al., 2005). Antibodies
against TWF1 and TWF2 have been described previously (Vartiainen et al., 2003).
Antibody against GAPDH was obtained from GenScript.
Rat cardiac hypertrophy model
Left-ventricle hypertrophy was induced in 150-180 g male Sprague-Dawley rats by
abdominal aorta constriction (AAC), as described previously (Ruetten et al., 2005).
Briefly, rats were anesthetized with chloral hydrate (0.2 mg/g), followed by exposure
of the abdomen, and then the suprarenal abdominal aorta was isolated and tightened
with a 4-0 nylon suture against 24 gauge needle. After removing the needle, the
incision was closed. A control group underwent a sham operation involved all the
procedures except aorta constriction. After surgery, each rat was given penicillin
twice a day for the first 3 days. Rats were sacrificed 1 week after surgery. All animal
protocols were approved by the Institute of Health Sciences Institutional Animal
Care and Use Committee.
Histological analysis
For histological analysis, sham or AAC operated rat hearts were fixed with 4%
paraformaldehyde overnight, and embedded in paraffin. Paraffin sections (4 m)
were stained with hematoxylin and eosin (H&E).
Construction of adenovirus and lentivirus
Recombinant adenoviruses were constructed, propagated and titered as previously
described (He et al., 1998). Briefly, the precursor sequence for miR-1 was amplified
from rat genomic DNA, and the PCR product was inserted into the pAdTrack-CMV
vector. For generating the adenovirus expressing TWF1, the full length of mouse
Twf1 cDNA fragment was digested from the plasmid pPL144, which has been
described previously (Vartiainen et al., 2003). For the construction of the sponge
adenoviral vector, we annealed, ligated, gel purified and cloned oligonucleotides for
miR-1 binding sites with bulge (CGACACACTTGAGACATTCCA) into the
modified pEGFPC1 vector (the stop code sequence was inserted before the multiple
cloning sites) digested with BglII and HindIII, then the sequence coding for EGFP
together with the miR-1-binding sites was cloned into the pShuttle vector. Then the
pAdTrack-CMV vectors with miR-1 precursor sequence or Twf1 cDNA fragment
and the pShuttle-sponge vectors were recombinated with pAdEasy in BJ5183 to
generate the adenovirus plasmids. After digestion with PacI, the linearized adenovirus
plasmids were transfected into HEK293A cells to produce recombinant adenovirus.
Titering was performed on HEK293A cells overlaid with DMEM plus 5% FBS and
1.25% low-melt agarose. For lentivirus construction, the precursor sequence for
miR-1 or miR-126 was inserted into the modified pLentiLox 3.7 vector (Sun et al.,
We thank all members of the laboratory for helpful discussions and
comments on the manuscript. We also thank Sarah E. Stanton for
critically reading the manuscript. This work was supported in part by
the Ministry of Science and Technology (2005CB724602,
2007CB947002, 2009CB521902), National Natural Science
Foundation of China (30770457, 30828006, 30670437), Chinese
Academy of Sciences (KSCX2-YW-R-096, KSCX2-YW-R-233,
KSCX1-YW-R-64) and Shanghai Pujiang Program (05PJ14105).
Supplementary material available online at
http://jcs.biologists.org/cgi/content/full/123/14/2444/DC1
References
Arber, S., Hunter, J. J., Ross, J., Jr, Hongo, M., Sansig, G., Borg, J., Perriard, J. C.,
Chien, K. R. and Caroni, P. (1997). MLP-deficient mice exhibit a disruption of
cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell
88, 393-403.
Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116, 281-297.
Care, A., Catalucci, D., Felicetti, F., Bonci, D., Addario, A., Gallo, P., Bang, M. L.,
Segnalini, P., Gu, Y., Dalton, N. D. et al. (2007). MicroRNA-133 controls cardiac
hypertrophy. Nat. Med. 13, 613-618.
Chen, J. F., Callis, T. E. and Wang, D. Z. (2009). microRNAs and muscle disorders. J.
Cell Sci. 122, 13-20.
Condorelli, G., Latronico, M. V. and Dorn, G. W., 2nd (2010). microRNAs in heart
disease: putative novel therapeutic targets? Eur. Heart J. 31, 649-658.
da Costa Martins, P. A., Bourajjaj, M., Gladka, M., Kortland, M., van Oort, R. J.,
Pinto, Y. M., Molkentin, J. D. and De Windt, L. J. (2008). Conditional dicer gene
deletion in the postnatal myocardium provokes spontaneous cardiac remodeling.
Circulation 118, 1567-1576.
Falck, S., Paavilainen, V. O., Wear, M. A., Grossmann, J. G., Cooper, J. A. and
Lappalainen, P. (2004). Biological role and structural mechanism of twinfilin-capping
protein interaction. EMBO J. 23, 3010-3019.
Frey, N., Katus, H. A., Olson, E. N. and Hill, J. A. (2004). Hypertrophy of the heart: a
new therapeutic target? Circulation 109, 1580-1589.
Goode, B. L., Drubin, D. G. and Lappalainen, P. (1998). Regulation of the cortical actin
cytoskeleton in budding yeast by twinfilin, a ubiquitous actin monomer-sequestering
protein. J. Cell Biol. 142, 723-733.
He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W. and Vogelstein, B. (1998).
A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci.
USA 95, 2509-2514.
Helfer, E., Nevalainen, E. M., Naumanen, P., Romero, S., Didry, D., Pantaloni, D.,
Lappalainen, P. and Carlier, M. F. (2006). Mammalian twinfilin sequesters ADPG-actin and caps filament barbed ends: implications in motility. EMBO J. 25, 11841195.
Heling, A., Zimmermann, R., Kostin, S., Maeno, Y., Hein, S., Devaux, B., Bauer, E.,
Klovekorn, W. P., Schlepper, M., Schaper, W. et al. (2000). Increased expression of
Journal of Cell Science
2452
Journal of Cell Science 123 (14)
cytoskeletal, linkage, and extracellular proteins in failing human myocardium. Circ.
Res. 86, 846-853.
Hwang, H. W., Wentzel, E. A. and Mendell, J. T. (2007). A hexanucleotide element
directs microRNA nuclear import. Science 315, 97-100.
Ikeda, S., He, A., Kong, S. W., Lu, J., Bejar, R., Bodyak, N., Lee, K. H., Ma, Q., Kang,
P. M., Golub, T. R. et al. (2009). MicroRNA-1 negatively regulates expression of the
hypertrophy-associated calmodulin and Mef2a genes. Mol. Cell. Biol. 29, 2193-2204.
Jing, Q., Huang, S., Guth, S., Zarubin, T., Motoyama, A., Chen, J., Di Padova, F., Lin,
S. C., Gram, H. and Han, J. (2005). Involvement of microRNA in AU-rich elementmediated mRNA instability. Cell 120, 623-634.
John, B., Enright, A. J., Aravin, A., Tuschl, T., Sander, C. and Marks, D. S. (2004).
Human MicroRNA targets. PLoS Biol. 2, e363.
Kawamura, S., Miyamoto, S. and Brown, J. H. (2003). Initiation and transduction of
stretch-induced RhoA and Rac1 activation through caveolae: cytoskeletal regulation of
ERK translocation. J. Biol. Chem. 278, 31111-31117.
Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W. and Tuschl, T.
(2002). Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12, 735739.
Landgraf, P., Rusu, M., Sheridan, R., Sewer, A., Iovino, N., Aravin, A., Pfeffer, S.,
Rice, A., Kamphorst, A. O., Landthaler, M. et al. (2007). A mammalian microRNA
expression atlas based on small RNA library sequencing. Cell 129, 1401-1414.
Li, J., Yang, Z., Yu, B., Liu, J. and Chen, X. (2005). Methylation protects miRNAs and
siRNAs from a 3⬘-end uridylation activity in Arabidopsis. Curr. Biol. 15, 1501-1507.
Liu, N., Williams, A. H., Kim, Y., McAnally, J., Bezprozvannaya, S., Sutherland, L.
B., Richardson, J. A., Bassel-Duby, R. and Olson, E. N. (2007). An intragenic MEF2dependent enhancer directs muscle-specific expression of microRNAs 1 and 133. Proc.
Natl. Acad. Sci. USA 104, 20844-20849.
Luo, X., Lin, H., Pan, Z., Xiao, J., Zhang, Y., Lu, Y., Yang, B. and Wang, Z. (2008).
Down-regulation of miR-1/miR-133 contributes to re-expression of pacemaker channel
genes HCN2 and HCN4 in hypertrophic heart. J. Biol. Chem. 283, 20045-20052.
Nevalainen, E. M., Skwarek-Maruszewska, A., Braun, A., Moser, M. and Lappalainen,
P. (2009). Two biochemically distinct and tissue-specific twinfilin isoforms are generated
from the mouse Twf2 gene by alternative promoter usage. Biochem. J. 417, 593-600.
Ojala, P. J., Paavilainen, V. O., Vartiainen, M. K., Tuma, R., Weeds, A. G. and
Lappalainen, P. (2002). The two ADF-H domains of twinfilin play functionally distinct
roles in interactions with actin monomers. Mol. Biol. Cell 13, 3811-3821.
Paavilainen, V. O., Hellman, M., Helfer, E., Bovellan, M., Annila, A., Carlier, M. F.,
Permi, P. and Lappalainen, P. (2007). Structural basis and evolutionary origin of actin
filament capping by twinfilin. Proc. Natl. Acad. Sci. USA 104, 3113-3118.
Paavilainen, V. O., Oksanen, E., Goldman, A. and Lappalainen, P. (2008). Structure of
the actin-depolymerizing factor homology domain in complex with actin. J. Cell Biol.
182, 51-59.
Palmgren, S., Ojala, P. J., Wear, M. A., Cooper, J. A. and Lappalainen, P. (2001).
Interactions with PIP2, ADP-actin monomers, and capping protein regulate the activity
and localization of yeast twinfilin. J. Cell Biol. 155, 251-260.
Rehmsmeier, M., Steffen, P., Hochsmann, M. and Giegerich, R. (2004). Fast and
effective prediction of microRNA/target duplexes. RNA 10, 1507-1517.
Ruby, J. G., Jan, C., Player, C., Axtell, M. J., Lee, W., Nusbaum, C., Ge, H. and
Bartel, D. P. (2006). Large-scale sequencing reveals 21U-RNAs and additional
microRNAs and endogenous siRNAs in C. elegans. Cell 127, 1193-1207.
Ruetten, H., Dimmeler, S., Gehring, D., Ihling, C. and Zeiher, A. M. (2005). Concentric
left ventricular remodeling in endothelial nitric oxide synthase knockout mice by
chronic pressure overload. Cardiovasc. Res. 66, 444-453.
Sayed, D., Hong, C., Chen, I. Y., Lypowy, J. and Abdellatif, M. (2007). MicroRNAs play
an essential role in the development of cardiac hypertrophy. Circ. Res. 100, 416-424.
Sun, C., Zhang, F., Ge, X., Yan, T., Chen, X., Shi, X. and Zhai, Q. (2007). SIRT1
improves insulin sensitivity under insulin-resistant conditions by repressing PTP1B.
Cell Metab. 6, 307-319.
van Rooij, E., Sutherland, L. B., Liu, N., Williams, A. H., McAnally, J., Gerard, R.
D., Richardson, J. A. and Olson, E. N. (2006). A signature pattern of stress-responsive
microRNAs that can evoke cardiac hypertrophy and heart failure. Proc. Natl. Acad. Sci.
USA 103, 18255-18260.
van Rooij, E., Sutherland, L. B., Qi, X., Richardson, J. A., Hill, J. and Olson, E. N.
(2007). Control of stress-dependent cardiac growth and gene expression by a microRNA.
Science 316, 575-579.
van Rooij, E., Liu, N. and Olson, E. N. (2008a). MicroRNAs flex their muscles. Trends
Genet. 24, 159-166.
van Rooij, E., Marshall, W. S. and Olson, E. N. (2008b). Toward microRNA-based
therapeutics for heart disease: the sense in antisense. Circ. Res. 103, 919-928.
Vartiainen, M., Ojala, P. J., Auvinen, P., Peranen, J. and Lappalainen, P. (2000).
Mouse A6/twinfilin is an actin monomer-binding protein that localizes to the regions of
rapid actin dynamics. Mol. Cell. Biol. 20, 1772-1783.
Vartiainen, M. K., Sarkkinen, E. M., Matilainen, T., Salminen, M. and Lappalainen,
P. (2003). Mammals have two twinfilin isoforms whose subcellular localizations and
tissue distributions are differentially regulated. J. Biol. Chem. 278, 34347-34355.
Wahlstrom, G., Vartiainen, M., Yamamoto, L., Mattila, P. K., Lappalainen, P. and
Heino, T. I. (2001). Twinfilin is required for actin-dependent developmental processes
in Drosophila. J. Cell Biol. 155, 787-796.
Wang, G. K., Zhu, J. Q., Zhang, J. T., Li, Q., Li, Y., He, J., Qin, Y. W. and Jing, Q.
(2010). Circulating microRNA: a novel potential biomarker for early diagnosis of acute
myocardial infarction in humans. Eur. Heart J. 31, 659-666.
Wei, L., Wang, L., Carson, J. A., Agan, J. E., Imanaka-Yoshida, K. and Schwartz, R.
J. (2001). beta1 integrin and organized actin filaments facilitate cardiomyocyte-specific
RhoA-dependent activation of the skeletal alpha-actin promoter. FASEB J. 15, 785-796.
Wu, H., Neilson, J. R., Kumar, P., Manocha, M., Shankar, P., Sharp, P. A. and
Manjunath, N. (2007). miRNA profiling of naive, effector and memory CD8 T cells.
PLoS ONE 2, e1020.
Zhao, Y., Samal, E. and Srivastava, D. (2005). Serum response factor regulates a
muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature 436, 214220.
Zhao, Y., Ransom, J. F., Li, A., Vedantham, V., von Drehle, M., Muth, A. N.,
Tsuchihashi, T., McManus, M. T., Schwartz, R. J. and Srivastava, D. (2007).
Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking
miRNA-1-2. Cell 129, 303-317.