188s Biochemical Society Transactions (1997) 25
The E. coli cAMP receptor protein can be used in a eukaryotic
system as a repressor activated by CAMP.
VOLPE FILIPPO.
Glaxo Wellcome, Cell Biology Unit, Gunnelswood Road,
Stevenage, Herts, SGI 2NY
Prokaryotic regulatory elements have been utilised to control gene
expression in higher eukaryotic cells [l]. For instance, insertion of
the E. coli lac operator sequence between the transcription start
site and either the ATG or TATA box of a eukaryotic promoter
appear to block gene expression in the presence of the lac
repressor. The cAMP receptor protein (CRP) is another element of
the E. coli lac operon that positively regulates transcription of the
genes necessary to metabolise lactose. In the absence of glucose as
a carbon source the intracellular concentration of cAMP is
upregulated. The CRP protein is able to bind cAMP and
undergoes a conformational change that allows the recognition of a
specific DNA sequence, consequently stimulating transcription via
interaction with the RNA polymerase. I thought to utilise the
capacity of CAMP-CRP complex to bind a specific DNA sequence
in order to repress transcription from a eukaryotic promoter in
which the CRP DNA target sequence has been introduced between
the TATA box and the transcription initiation site. Although the
use of such a molecular switch would not be of general use, due to
the pleiotropic effect of high cAMP concentrations, it could be
used to indirectly measure intracellular CAMP. Indeed the
activation of a Gi linked receptor in a eukaryotic cell expressing E.
coli CRP could positively control the expression of a reporter gene
repressed by the CRP-CAMP complex. Two plasmids respectively
containing the enhancer/promoter of the major IE gene of HCMV,
pCMV-SAP, and the RSV promoter, pRSV-SAP. both controlling
the expression of thermoresistant secreted alkaline phosphatase
(SAP) were modified to accommodate the perfect palindrome
AAATGTGTCTAGATCACATTT, consensus DNA-site for the
CRP [2]. The modified plasmids were called pCMV-CRP-SAP
and pRSV-CRP-SAP. The modification of the DNA sequence
between the TATA box and the transcription initiation site could
affect the modified promoter activity. Therefore run-off
experiments were carried out utilising nuclear extract from HeLa
cells in the presence of lOOng of pCMV-SAP, pCMV-CRP-SAP,
EcoRI digested, and "P labeled rUTP. Under these conditions a
220 bp transcript was expected. The reaction was stopped after Ihr
and following phenol extraction and precipitation steps the
transcripts were analysed by electrophoresis through 6%
acrylamide gels. In fig.1 lanes 1 and 7 show that the promoter
activity is not effected by the introduction of the CRP consensus
sequence. Lanes 2 and 3 show that transcription is not impaired by
the presence of CRP purified protein or by cAMP alone,
meanwhile when CRP and cAMP (400 and 200 pm) are present
I
2
3
4
5
6
7
8
9
appears to partially inhibit transcription from the wild type
promoter pCMV-SAP (lane 6) suggesting an aspecific effect.
A bicistronic mammalian vector [3] expressing the E. coli crp and
the neomycin phosphotransferase genes was made and a CHO cell
line expressing the crp gene was generated. Equal amounts of
protein extract from different (3418 positive clones were tested for
their capacity to bind in the presence of 400 pm cAMP to a labeled
oligonucleotide containing the consensus sequence for the CRP
protein. The complexes were analysed on a DNA retardation gel as
shown in fig.11. Four different CHO clones are able to bind to the
oligonucleotide probe (lanes 4, 5, 6, 7) as purified CRP or total
protein extract from E. coli (lanes 1 and 3), meanwhile protein
extract from wild type CHO cells failed to do so (lane 2).
Fig.11 Gel retardation assay
Since it is likely that the strength of the signal reflects different
levels of expression for the CRP protein in different CHO clones,
clone 3 was transfected with either pRSV-CRP-SAP or pRSVSAP. The transfected cells were grown either in the presence of 10
pm forskolin (an adenyl cyclase agonist) or in its absence. After
overnight incubation supernatant was tested for thermoresistant
alkaline phosphatase. Above 50% inhibition of SAP was observed
for cells transfected with pRSV-CRP-SAP when grown in the
presence of forskolin and therefore in the presence of high cAMP
levels, shown in fig 111. These preliminary results suggest that in a
CHO cell line expressing the E. coli CRP protein it is possible to
control transcription from a promoter containing the CRP
consensus sequence through an increase of cAMP concentration.
Further characterisation of this cell line is needed.
"6
0.2
0
F
F
Fig.111 SAP assay
In particular it will be necessary to establish if there is a linear
relationship between cAMP concentration (via forskolin
stimulation) and inhibition of transcription. The CRF' protein has
been widely studied and a number of mutants have been described.
Mutants with increased affinity for CAMP [4] will be of particular
value. The introduction of a signal for nuclear localisation within
the crp sequence should improve the system.
Acknowledgements
I would like to thank Dr J Krakow for kindly providing purified
CRP protein. Dr N. Sharp for the original construct containing the
wild type CMV and RSV promoters. Mr S. Rees for the bicistronic
mammalian expression vector.
Fig.1 Transcription assay from wild type and modified IE CMV
promoter with nuclear extract of HeLa cells
together transcription is completely blocked (lanes 4 and 5 ) .
Transcription is resumed in the presence of CRP plus 2 pm cAMP
lanes 8 and 9. Furthermore CRP-CAMP (400 pm) complex
References
I. Gossen M., Bonin A.L. and Bujard H.(1994) Tibtech 12,58-62
2. Ebright R.H., Ebright Y.W. and Gunasekera A.
(1 989)17,10295-I 0305
3. Rees S., Coote J., Stables J., Goodson S. Harris S. and Lee
M.G. (1996) Biotechniques 20,2-7
4. Ren Y.L., Garges S., Adhya S. and Krakow J. (1990) Nucleic
Acid Res. 18,50127-50132