Human Reproduction, Vol.26, No.8 pp. 2146– 2156, 2011
Advanced Access publication on May 18, 2011 doi:10.1093/humrep/der153
ORIGINAL ARTICLE Reproductive biology
Establishment and characterization
of a spontaneously immortalized
trophoblast cell line (HPT-8) and its
hepatitis B virus-expressing clone
Lei Zhang 1†, Weilu Zhang 1†, Chen Shao 2†, Jingxia Zhang 1, Ke Men 1,
Zhongjun Shao 1, Yongping Yan 1, and Dezhong Xu 1,*
1
Department of Epidemiology, Fourth Military Medical University, Xi’an 710032, Shanxi, People’s Republic of China 2Department of Urology,
Xijing Hospital, Fourth Military Medical University, Xi’an 710033, Shanxi, People’s Republic of China
*Correspondence address. Tel: +86-29-84774955; Fax: +86-29-84774872; E-mail: [email protected]
Submitted on June 8, 2010; resubmitted on April 7, 2011; accepted on April 19, 2011
background: Most trophoblast cell lines currently available to study vertical transmission of hepatitis B virus (HBV) are immortalized
by viral transformation. Our goal was to establish and characterize a spontaneously immortalized human first-trimester trophoblast cell line
and its HBV-expressing clone.
methods: Chorionic villi of Asian human first-trimester placentae were digested with trypsin and collagenase I to obtain the primary
trophoblast cell culture. A spontaneously immortalized trophoblast cell line (HPT-8) was analyzed by scanning and transmission electron
microscopy, cell cycle analysis, immunohistochemistry and immunofluorescence. HPT-8 cells were stably transfected with the adr
subtype of HBV (HPT-8-HBV) and characterized by PCR and enzyme-linked immunosorbent assay.
results: We obtained a clonal derivative of a spontaneously immortalized primary cell clone (HPT-8). HPT-8 cells were epithelioid and
polygonal, and formed multinucleate, giant cells. They exhibited microvilli, distinct desmosomes between adjacent cells, abundant endoplasm,
lipid inclusions and glycogen granules, which are all characteristic of cytotrophoblasts. HPT-8 cells expressed cytokeratin 7, cytokeratin
18, vimentin, cluster of differentiation antigen 9, epidermal growth factor receptor, stromal cell-derived factor 1 and placental alkaline phosphatase. They secreted prolactin, estradiol, progesterone and hCG, and were positive for HLA-G, a marker of extravillous trophoblasts.
HPT-8-HBV cells were positive for HBV relaxed-circular, covalently closed circular DNA and pre-S sequence. HPT-8-HBV cells also
produced and secreted HBV surface antigen and HBV e antigen.
conclusions: We established a trophoblast cell line, HPT-8 and its HBV-expressing clone which could be valuable in exploring the
mechanism of HBV viral integration in human trophoblasts during intrauterine infection.
Key words: first-trimester / villous trophoblast / hepatitis B virus / intrauterine / primary culture
Introduction
The human placenta is made up of chorionic villi comprising the fetal
capillary, villous stroma and a layer of trophoblast cells, consisting
of syncytiotrophoblasts and cytotrophoblasts. Placental trophoblasts
play a crucial role during embryonic implantation, and the high permeability of undifferentiated trophoblasts to viral transfer makes
early pregnancy a highly susceptible period for intrauterine infections
(Bhat and Anderson, 2007).
Hepatitis caused by the hepatitis B virus (HBV) is a leading cause of
death worldwide and is highly endemic in Africa and Asia. About
†
2 billion people have been infected with HBV to date, and over
350 million people are carriers of HBV surface antigen (HBsAg).
Chronic hepatitis, cirrhosis and hepatocellular carcinoma caused by
HBV are responsible for 500 000 to 1.2 million deaths every year
(Lavanchy, 2004). The most common route of HBV transmission is
via the perinatal or intrauterine routes. It has been reported that
10– 15% of pregnant women in China are carriers of HBsAg and
HBV e antigen (HBeAg) and 5–15% of these babies are infected by
intrauterine transmission (Li et al., 1986; Xu et al., 2002; Zhang
et al., 2004). Asian women are predominantly infected with the adr
subtype of HBV.
These three authors contributed equally to this article.
& The Author 2011. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.
For Permissions, please email: [email protected]
2147
Trophoblast cell line expressing hepatitis B virus
Although the exact mechanism of intrauterine HBV infection is not
completely understood, transplacental leakage of maternal blood has
been suggested as a possible mechanism (Lin et al., 1987; Ohto
et al., 1987). We previously hypothesized that ‘cellular transfer’ of
HBV from cell to cell in the placenta may also contribute to intrauterine infection (Xu et al., 2001, 2002). Since placental trophoblasts
gate the maternal– fetal interface, they may play a crucial role in the
placental invasion of HBV and are reported to be susceptible to
HBV infection (Xu et al., 2001, 2002).
A major challenge in the biological and pathogenetic study of HBV has
been the difficulty of culturing the highly specific host cells (Feitelson,
1994). HBV-infected host cells usually contain free and replicationcompetent HBV at the early stages of infection and the virus integrates
into the host genome after a few passages. However, it has been
suggested that HBV DNA does not integrate into the trophoblast
genome, since the viral DNA does not continue to replicate with the
proliferation of trophoblasts (Wang et al., 2006a,b).
A number of groups have established trophoblast cell lines for in
vitro experimentation. These cell lines are all either immortalized by
viral transformation or arise from cancerous villi or placenta. The
HTR-8/SVneo cell line was established by transfection of parental
first-trimester human extravillous trophoblast HTR-8 cells with SV40
large T antigen (Graham et al., 1993). These cells were phenotypically
similar to the parental cells and had an extended life span. However,
HTR-8 cells transformed with the SV40 T antigen oncogene also gave
rise to a long-lived and an immortalized cell line, which both exhibited
hyperproliferative, hyperinvasive and premalignant properties (Khoo
et al., 1998). In a different study, first-trimester trophoblast cells generated by SV40 transformation showed karyotypic/phenotypic
abnormalities (Straszewski-Chavez et al., 2009). Normal placentaorigin cytotrophoblast (NPC) cells were developed from firsttrimester human placental villi (Rong-Hao et al., 1996), which
maintained the endocrine functions of normal cytotrophoblasts but
achieved replicating senescence after 50 population doublings. Since
telomerase activation via overexpression of human telomeric
reverse transcriptase is known to circumvent senescence, this strategy
was used to overcome senescence in NPC cells to generate an
immortalized cytotrophoblast cell line (Wang et al., 2006a,b). A few
other groups have successfully isolated and cultured trophoblasts in
recent years, using different strategies (Lewis et al., 1996; King et al.,
2000; Shiverick et al., 2001; Morrish et al., 2002; Wang et al., 2002;
Dunk et al., 2003). One such established cell line, TEV-1, was obtained
from Asian normal early villi and immortalized by transfection with
human papillomavirus type 16 E6/E7 genes (Feng et al., 2005).
TEV-1 cells may therefore not be suitable for the study of intrauterine
HBV infection. Our study aimed to generate a spontaneously immortalized, cytotrophoblast cell line from Asian human first-trimester
placenta and its HBV-expressing clone. This cell line may facilitate
our future investigations into the mechanism of HBV infection in
trophoblasts.
Materials and Methods
Cell lines
The human liver carcinoma cell line (HepG2) and JEG-3 choriocarcinoma
cells were obtained from the Department of Microbiology, Fourth Military
Medical University, Xi’an, China. The cells were cultured in Dulbecco’s
modified Eagle’s medium (DMEM) (Gibco, Paisley, UK) supplemented
with 10% fetal calf serum (FCS) (Gibco), 3000 mg/l L-Glutamax
(Gibco), 100 U/ml of penicillin and 100 mg/ml of streptomycin (Gibco)
and maintained at 378C in a humidified atmosphere of 5% CO2
Preparation of human first-trimester
trophoblast primary culture HPT-8
Collection of human tissue in this study was performed using protocols
approved by the Clinical Research Ethics Approval Committee of the
Fourth Military Medical University of China. Informed consent was
obtained from all study participants. Human placentae (6– 9 weeks after
amenorrhea, n ¼ 22) were obtained from women undergoing a legal termination of normal pregnancy at Xijing Hospital, Xi’an, China. Termination
of pregnancy was surgically achieved by vacuum suction as approved by
the local ethical committee. Pregnancies with medical complications or diseases were excluded. Primary cultures of trophoblasts were prepared
using a modification of a previously described method (Wang et al.,
2002). Briefly, chorionic villi were digested in 0.25% trypsin and 500 U/ml
collagenase I (Sigma, St. Louis, MO, USA) at 378C for 15 min. The cell suspension was filtered through 75-mm filters (Zhengxing Biotechnology,
Anping, China) and centrifuged at 200g for 10 min. Erythrocytes were
removed by treating with 0.84% NH4Cl at 48C for 6 min. The final cell
suspension was maintained in DMEM supplemented with 10% FCS,
2 mM glutamine, 1.75 mM HEPES (Promega, Madison, WI, USA),
100 U/ml penicillin and 100 mg/ml streptomycin at 378C in a 5% CO2
humidified atmosphere. We cloned the immortalized cells using limiting
dilution technique. Briefly, the cell suspension was limiting diluted to
1 cell/ml and plated 250 ml/well into 96-well plates. The monoclone
which developed in a single well (hypothetically one original cell in that
well) was isolated and expanded in DMEM supplemented with 10%
FCS. The HPT-8 cell line was derived from a single clone which had
survived more than 250 passages.
Construction of plasmids and transfection
The plasmids pcDNA3 and pUC19-3HBV were kind gifts from the
Department of Biochemistry and Molecular Biology, Fourth Military
Medical University and the Institute of Immunology, Shandong University
School of Medicine, China, respectively. A fragment containing three
head-to-tail repeats of the HBV genome (9600 bp) was released from
pUC19-3HBV and cloned into pcDNA3 to create pcDNA3-3HBV,
which was confirmed by sequencing. HPT-8 cells, (90% confluent) were
transfected with pcDNA3-3HBV at passages 18, 30 and 60, using Lipofectamine (Gibco) according to the manufacturer’s instructions. After a 48 h
incubation, the cells were selected in culture medium containing 1000 mg/ml
G418 (Gibco) for 4 weeks. Single clones (HPT-8-HBV) were isolated and
maintained in medium containing 300 mg/ml G418. HepG2 cells were
transfected with pcDNA3-3HBV to serve as a positive control. HPT-8
transfected with empty vector served as a negative control.
Scanning and transmission electron
microscopy
HPT-8 cells at passages 12, 18 and 32 were plated on coverslips. For scanning electron microscope (SEM), cells were washed with 0.01 M
phosphate-buffered saline (PBS, pH 7.4), fixed with 3% glutaraldehyde
for 3 h and sequentially treated with a graded series of acetonitrile solutions (50, 70, 90 and 100%). The cells were then dried under vacuum
for 2 h, mounted on aluminum stubs sputter coated with colloidal gold
and examined using a Hitachi S-520 SEM (Hitachi, Japan). For transmission
electron microscope, HPT-8 cells were collected by trypsinization and
2148
centrifuged at 200g for 10 min. Cells were fixed in 3% glutaraldehyde for
3 h and osmic acid for 2 h, and dehydrated in an acetone gradient (50, 70,
90 and 100%). Cells were then immersed in acetone-epoxy resin solution
(1:1) for 0.5 h, and embedded in Epon-812 at 658C for 24 h. Ultrathin
(60 nm) sections were stained with uranyl acetate and lead citrate. Cell
morphology was measured by a JEOL JEM-2000EX transmission electron
microscope (Tokyo, Japan).
Cell cycle analysis by flow cytometry
Passages 5, 20 or 60 HPT-8 cells were cultured in 35-mm dishes for 72 h,
trypsinized and centrifuged at 200g for 5 min. The cell pellet was resuspended and fixed in 70% ethanol at 48C overnight, centrifuged at 200g
for 10 min and resuspended in 5 ml of cold PBS. The cells were incubated
at 378C for 1 h in 1 ml of PBS containing 100 mg/ml RNase A (Invitrogen,
Carlsbad, CA, USA) and 50 mg/ml propidium iodide (Sigma), and cell
cycle analysis performed using a BECKMAN-COULTER flow cytometer
(Miami, FL, USA).
Immunocytochemical and
immunofluorescent staining
HPT-8 cells at passages 9, 10, 14, 18, 22, 26, 28, 30, 36, 40, 45, 50, 52, 56,
62, 72, 82 and 88, were grown on coverslips for 48 h, fixed with 95%
ethanol for 30 min and blocked with 5% normal human serum for 1 h.
Cells were then incubated at 48C overnight with one of the following:
mouse anti-human cytokeratin 7 (CK7), rabbit anti-human stromal cellderived factor 1 (SDF1), mouse anti-hCG, rabbit anti-human placental lactogen (hPL), rabbit anti-human a cluster of differentiation antigen 9 (CD9),
rabbit anti-human epidermal growth factor receptor (EGFR), mouse antihuman placental alkaline phosphatase (PLAP), mouse anti-human HBsAg
or rabbit anti-human hepatitis B core antigen (HBcAg; Sigma) at 1:100
dilution (except anti-PLAP, 1:60 dilution). Cells were then incubated
with biotinylated immunoglobulin (Ig) G antibody (Wuhan Boshide,
Wuhan, China) at room temperature for 60 min and streptavidin-biotinperoxidase complex (S-ABC, Wuhan Boshide) at 378C for 30 min, and
visualized after treating with 3,3′ -diaminobenzidine (DAB) solution
(Wuhan Boshide) for 10 min. Nuclei were visualized by incubating cells
in 5 mg/ml of 4(6-diamidino-2-phenylindole; DAPI) (Sigma). For immunofluorescence, the cells were blocked by incubation with 5% normal human
serum for 1 h and then incubated at 378C for 60 min with fluorescein
isothiocyanate (FITC)-labeled mouse anti-human cytokeratin 18 (CK18)
or Cy3-labeled rabbit anti-human vimentin (1:1) antibodies (Sigma) at
1:150 dilution in 1% bovine serum albumin. Slides were then washed,
dehydrated and observed under a confocal immunofluorescent microscope (ZEISS, Jena, Germany). The primary antibody was omitted and
substituted with isotype IgG in negative controls. Villous tissue sections
were used as positive controls.
Immunohistochemical detection of HLA-G
in HPT8 cells
Briefly, HPT-8 cells were grown on coverslips and fixed with 95% ethanol
for 30 min. Cells were blocked by incubation with 5% normal human
serum for 1 h and then incubated at 48C overnight with a 1:100 dilution
of rabbit anti-HLA-G (Beijing Boisynthesis Biotechnology co., China) in
0.01 M PBS (pH 7.4). Cells were washed and sequentially incubated for
60 min at room temperature with biotinylated IgG antibody (Wuhan
Boshide) and for 30 min at 378C with S-ABC (Wuhan Boshide). Protein
was visualized by incubating cells with DAB solution (Wuhan Boshide)
for 10 min. Nuclei were visualized by hematoxylin staining. Immunohistochemical experiments were performed five times to ensure reproducibility.
Zhang et al.
Flow cytometric analysis
We used flow cytometry to determine HLA-G expression in HPT-8 cells.
JEG-3 choriocarcinoma cells and HepG2 cells were used as positive and
negative controls, respectively. Non-specific binding of antibodies was
blocked by pre-incubating cells in 10% human AB-group serum at 48C
for 60 min. After washing with PBS, the cells were incubated with the
primary antibody (rabbit anti-HLA-G; Beijing Boisynthesis Biotechnology
Co.) for 1 h at 48C. Then cells were washed twice and stained with FITCconjugated goat anti-rabbit IgG (Dako Cytomation, Glostrup, Denmark)
for 30 min at 48C. Flow cytometric analysis was performed on a
FACStar flow cytometer (Becton Dickinson, Mountain View, CA, USA).
The cells were gated using forward and side scatter.
Radioimmunoassay
Passage 12 HPT-8 cells were seeded at a density of 1 × 106 cells in a
60-mm dish and cultured for 24 h. The supernatant was collected for
the determination of human prolactin, estradiol (E2), progesterone and
hCG by radioimmunoassay according to the manufacturer’s instructions
(Capintec Inc., Ramsey, NJ, USA).
Enzyme-linked immunosorbent assay
for the detection of HBsAg and HBeAg
The culture medium from HPT-8-HBV, HepG2-HBV and empty vector
transfected HPT-8 cells was collected 72 h after transfection and
assayed for the presence of HBsAg and HBeAg using diagnostic ELISA
kits (Kehua Biotechnology, Shanghai, China), according to the manufacturer’s instructions. Culture medium from untransfected cells was used
as a background for the assay.
DNA extraction and PCR
Culture medium from stably transfected HPT-8-HBV and HepG2-HBV
cells was centrifuged at 10 000g for 10 min to remove cellular debris.
HBV particles were precipitated with polyethylene glycol 8000 (Sigma)
as described (Wei et al., 1996). DNA was extracted from virus pellets,
HPT-8-HBV, HepG2-HBV and negative control cells using lysis buffer
(0.25% sodium dodecyl sulfate, 0.25 M Tris, 0.25 M EDTA) and used in
PCRs. The sequences of primers for HBV, HBV relaxed-circular DNA
(rcDNA) and HBV covalently closed circular DNA (cccDNA) were
5′ -CACTGCAGCCTG CTCGTGTTACAGGC-3′ (sense) and 5′ -CGGTC
GACGGCACTAGTAAACTGAGC-3′ (antisense) with a product of
500 bp, 5′ -CCGACCACGGGGCGCACCTCTCTTTACG-3′ (sense)
and 5′ -CTAATCTCCTCCCCCAGCTCCTCCCAGT-3′ (antisense) with
a product of 243 bp and 5′ -CCGACCACGGGGCGCACCTCTCTT
TACG -3′ (sense) and 5′ -AAGG CACAGCTTGGAGGCTTGAACA
GT-3′ (antisense) with a product of 373 bp, respectively. All PCR conditions were: initial denaturation at 948C for 5 min, then 35 cycles of 948C
for 50 s, 558C for 50 s and 728C for 55 s, followed by a final extension
step of 728C for 10 min in a PE 480 PCR system (Perkin-Elmer, Boston,
MD, USA). PCR products were separated electrophoretically on a 1%
agarose gel stained with ethidium bromide for visualization.
Quantitative fluorescent PCR
Culture medium was collected from HPT-8-HBV and HepG2-HBV cells at
48 h, 1 month or 2 months after transfection. An HBV fluorescent PCR kit
(Dalean, Shenzhen, China) was used to quantitate HBV DNA titers.
A titer of .1 × 106 copies per liter was regarded as positive.
2149
Trophoblast cell line expressing hepatitis B virus
Results
Cell cycle profile of HPT-8 cells
Morphological and karyotype
characterization of HPT-8 cells
HPT-8 cells at passages 5, 20 and 60 showed no obvious differences in their
cell cycle profiles (Fig. 4). Flow cytometry analysis showed that 58.5% cells
were in the G1-phase, 29.8% in the S-phase and 11.7% in the G2-phase.
Of the 22 chorionic villus samples, 20 of the first-trimester human
trophoblast primary cultures died after six or seven passages. Two
samples developed a clone, which became immortalized and
remained alive after 250 passages with 3 or 4 days per passage.
The spontaneously immortalized HPT-8 cells, which were derived
from a single clone, had 70– 90% viability, proliferated rapidly and
were microscopically epithelioid. HPT-8 cells formed giant multinucleated cells after aggregation (Fig. 1A). SEM analysis demonstrated
that the cells were flat and plane with an irregular polygonal appearance and a large number of microvilli on the surface (Fig. 1B). TEM
analysis showed that HPT-8 cells were characterized by the presence
of a concave nuclear envelope, prominent euchromatin, a big nucleolus and dilated cisternae of endoplasm, a large number of glycogen
granules, myeloid bodies and lipid inclusions (Fig. 1C). There were
distinct desmosomes between adjacent cells (Fig. 1D). Karyotyping
analysis showed that passage 5 HPT-8 cells had a normal karyotype
of 46,XX (Supplementary data, Fig. S1). Immunohistochemical
staining showed the expression of HLA-G in HPT-8 cells (Fig. 2).
HLA-G was consistently but weakly expressed in HPT-8 cells.
Flow cytometric analysis confirmed that HLA-G was expressed in
17.39% of the HPT-8 cells in comparison with 61.75% of the
JEG-3 cells (positive control) and 0.93% of the HepG2 cells (negative
control) (Fig. 3).
Expression of cytotrophoblast markers
in HPT-8
The phenotypic characterization of placental villi and HPT-8 cells is
summarized in Table I. Immunohistochemical staining showed the
presence of cytotrophoblast markers, CK7, CD9, SDF1, PLAP and
EGFR in the cytoplasm of HPT-8 cells (Fig. 5A). Immunofluorescent
staining showed high levels of CK18 and vimentin in the cytoplasm
of HPT-8 cells (Fig. 5B). Villous tissue was used as a positive control
for these markers (data not shown).
Hormone levels in the supernatant
of HPT-8 cells by radioimmunoassay
We used radioimmunoassay to analyze hormone levels in passage 12
HPT-8 cells. Twenty-four hours after seeding, the levels of prolactin,
E2, progesterone and hCG in the supernatant of 80% confluent
HPT-8 cells were (mean + SD, n ¼ 3 experiments) 8.97 + 1.05 mg/l,
9.7 + 0.58 ng/l, 0.44 + 0.10 and 1.06 + 0.085 mg/l, respectively.
Characterization of HPT-8-HBV cells
HPT-8 cells and HepG2 cells were transfected with pcDNA3-3HBV
(adr subtype) at 30% transfection efficiency. G418 selection medium
Figure 1 Morphological characteristics of HPT-8 cells. (A) Images of HPT-8 cells (a spontaneously immortalized trophoblast cell line) under a light
microscope showing giant multinucleated cells (×200 magnification); (B) Images of HPT-8 cells under a SEM showing the cell morphology (×1500
magnification); (C and D) Images of HPT-8 cells under TEM showing the cell ultra-structural morphology [×4000 magnification in (C) and ×20 000
magnification in (D)].
2150
Zhang et al.
Figure 2 Immunohistochemical detection of HLA-G in HPT-8 cells. HPT-8 cells were incubated with rabbit anti-HLA-G (primary antibody), then
incubated with biotinylated IgG antibody (secondary antibody). Protein was visualized by incubating cells with S-ABC, followed by DAB solution.
Nuclei were visualized by hematoxylin staining. (A) No antibody, sham-treated; (B) human choriocarcinoma JEG-3 cell line (positive control);
(C) HPT-8 cells; and (D) HLA-G-negative liver HepG2 cells. The magnification was ×100.
Figure 3 Flow cytometric analysis of HLA-G expression on HPT-8 cells (A). The JEG-3 choriocarcinoma cell line (B) was used as a positive control
for HLA-G. The HepG2 cell line (C) was used as a negative control for HLA-G. Flow cytometry showed that 17.39% of the HPT-8 cells were HLA-G
positive in comparison with 61.75% of the JEG-3 cells and 0.93% of the HepG2 cells. Green lines were isotype control.
2151
Trophoblast cell line expressing hepatitis B virus
and showed that HBV was secreted into the culture medium of
HPT-8-HBV and HepG2-HBV cells, but not parental HPT-8 cells
(Fig. 7A). Using ELISA, we demonstrated the presence of HBsAg
and HBeAg in the culture medium of HPT-8-HBV and HepG2-HBV
cells, but not in that of HPT-8 cells. However, the levels of HBsAg
and HBeAg reduced dramatically after passage 4 in HPT-8-HBV cells
(Fig. 7B and C). We titrated the HBV viral particles in the culture
supernatant of HPT-8-HBV cells and found a dramatic decrease
in viral titer from 7.2 × 107 copies/l at 48 h after transfection to
4.81 × 106 copies/l and 2.73 × 106 copies/l at 1 month and
2 months post-transfection, respectively (Fig. 7D). Although
HepG2-HBV cells had the same viral titers as HPT-8-HBV cells
(1.13 × 108 copies/l at 48 h after transfection), the titers decreased
only slightly over a month following the transfection (5.17 ×
107 copies/l after 1 month and 6.27 × 107 copies/l after 2 months)
(Fig. 7D). Each experiment was performed three times.
was used to select stably transfected HPT-8-HBV and HepG2-HBV
cells. HPT-8-HBV cells proliferated slowly after passage 4 and most
cells died after passage 6. However, HepG2-HBV cells remained
healthy even after passage 10 (data not shown), indicating that the
integration of HBV into the genome of HPT-8 cells was less efficient
than into the highly specific host HepG2 cells.
PCR amplification was used to detect the presence of HBV rcDNA
and cccDNA in HepG2-HBV and HPT-8-HBV cells at passage 2
(Fig. 6A and B). Two stably transfected cell lines were strongly positive
for the presence of HBV rcDNA and cccDNA, while parental HPT-8
cells were negative. Immunohistochemistry showed that both HBsAg
and HBcAg were found mainly in the cytoplasm of HPT-8-HBV
cells, while they were mostly distributed in the nuclei of
HepG2-HBV cells (Fig. 6C).
Characterization of supernatant
from HPT-8-HBV cells
We used PCR to amplify the unique pre-S sequences of HBV DNA in
the supernatant from HPT-8-HBV and HepG2-HBV cells at passage 2
Discussion
In this study, we report the successful isolation of trophoblasts from
Asian human first trimester placental chorionic villi. Spontaneously
immortalized HPT-8 cells were derived from a single clone, maintained
in culture and passaged more than 250 times. Since there are no
reported cytotrophoblast cell lines expressing the adr subtype of
HBV, we transfected HPT-8 cells with a construct carrying three
head-to-tail copies of the adr subtype HBV full length DNA to
produce the HBV-expressing clone of HPT-8.
Chorionic villi are mainly composed of mesenchymal cells and trophoblasts. We used collagenase I to digest the mesenchymal cells to
prevent their transformation to fibroblasts. Although most of the
primary cultures died between the fifth and seventh passages, two
samples were spontaneously immortalized and formed clones. Telomerase was recently reported to attenuate senescence and result in
immortalization of trophoblasts (Wang et al., 2006a,b; StraszewskiChavez et al., 2009). It will be interesting to investigate if the spontaneous immortalization of trophoblasts seen in our study was the
result of telomere shortening during replication.
Morphologic characterization of HPT-8 cells showed that most of
the trophoblasts had a single nucleus, and 3–5% of the cells formed
fuzed extravillous trophoblast cells (i.e. multinucleated giant cells) in
each passage. Although the mechanism for this cell fusion is not
clear, we suggest that it may represent cells undergoing in-vitro differentiation from cytotrophoblasts to syncytiotrophoblasts. The cells
were flat and plane with a polygonal appearance, excluding the
Figure 4 Cell cycle distribution of HPT-8 cells. HPT-8 cells at
passage 8, 20 or 60 were fixed and stained by propidium iodide for
fluorescence-activated cell sorter analysis. Data are mean + SD.
Table I Immunohistochemical and immunofluorescent staining of placental villi and HPT-8 cells.
Samples
Intensity of staining with primary antibodies
.......................................................................................................................................................................
CK7
CK18
Vimentin
CD9
hPL
hCG
SDF1
PLAP
EGFR
HLA-G
.............................................................................................................................................................................................
Villi
+++
++
2/+
++
+
++
+
+
+
+
HPT-8
+++
+++
+++
+++
2/+
2
++
+
+
+
The abbreviations were: CK, cytokeratin 7; CK18, cytokeratin 18; CD9, cluster of differentiation antigen 9; hPL, human placental lactogen; SDF1, stromal cell-derived factor 1; PLAP,
placental alkaline phosphatase; EGFR, epidermal growth factor receptor; HLA, human leukocyte antigen G.
+ + +, very strong staining; + +, strong staining; +, weak staining; 2/+, very weak staining; 2, no staining.
2152
Zhang et al.
Figure 5 Immunohistochemical and immunofluorescent staining of HPT-8 cells. (A) Immunohistochemistry of HPT-8 cells with CK7, CD9, SDF1,
PLAP, EGFR, hPL and hCG antibodies. DAPI staining was used to indicate the nucleus of cells; (B) Immunofluorescent images of HPT-8 cells using
CK18 and vimentin antibodies. The primary antibody was omitted and substituted with isotype IgG in negative controls. The magnification was ×400.
possibility of contamination with fibroblasts. SEM and TEM analyses of
HPT-8 cells demonstrated a large number of microvilli on the cell
surface, distinct desmosomes between adjacent cells and an abundance of endoplasm, Golgi bodies, lipid inclusions and glycogen
granules, which are all characteristic of trophoblasts (King et al.,
2000). Keratins, the skeleton proteins of epithelial cells, have been
previously reported to be present in human placental cells, and CK7
has been used as a specific trophoblast marker (Frank et al., 2001;
Maldonado-Estrada et al., 2004). CD9, another trophoblast marker,
is a glycoprotein on the cell surface which is related to trophoblast
cell migration and adhesion. The expression of both CK7 and CD9
constitute the minimum accepted requirements to characterize and
validate an extravillous cytotrophoblast cell line (King et al., 2000).
In this study, we showed high levels of expression of both CK7 and
CD9 in HPT-8 cells, strongly suggesting that HPT-8 cells are extravillous cytotrophoblasts. HPT-8 cells also contained CK18 and vimentin.
Although expression of vimentin has been considered as a feature of
non-trophoblastic cells (Manoussaka et al., 2005), it is not unusual that
the immortalized primary trophoblast cells co-express cytokeratin and
vimentin: the F3 cells obtained by Hambruch et al. (2010) were
continuously positive for zonula occludens-2 (ZO-2), cytokeratin
and vimentin, and the Swan 71 cells isolated by Straszewski-Chavez
et al. (2009) expressed CK7, vimentin and HLA-G.
Trophoblasts are known to secrete hormones, such as hCG, hPL,
prolactin, E2 and progesterone, that all play a role in supporting
normal gestation (Kurman et al., 1984; Henson et al., 1996).
Hormone characterization showed that although HPT-8 cells secreted
prolactin, E2 and progesterone, they secreted very low levels of hCG.
This is likely because only 3–5% of the HPT-8 cells formed multinucleate giant cells. These data were also consistent with previous results
showing that (i) expression levels of hCG, hCG-beta and hCG-alpha
are significantly upregulated during the process of in vitro differentiation
of cytotrophoblasts to syncytiotrophoblasts and (ii) hCG secretion in
vivo is known to be confined to the villous syncytiotrophoblast, and
not the mononuclear trophoblast cells (Kato and Braunstein, 1989).
Extravillous trophoblasts are characterized by high levels of prolactin
Trophoblast cell line expressing hepatitis B virus
2153
Figure 6 Expression of hepatitis B virus (HBV) in HPT-8-HBV cells. (A) PCR amplification of HBV rcDNA and (B) cccDNA in passage 2
HPT-8-HBV cells. HPT-8 cells transfected with empty vector were used as a negative control, while HepG2-HBV cells and pUC19-3HBV plasmid
were used as positive controls; (C) Immunohistochemical images of passage 3 HPT-8-HBV cells using HBsAg and HBcAg antibodies. HPT-8 and
HepG2-HBV cells transfected with empty vector were used as negative and positive controls, respectively. DAPI staining was used to indicate the
nucleus of cells. The magnification was ×400.
and CD9. However, we found very low levels of hPL, which is a
protein expressed in vivo in the extravillous trophoblasts, particularly
in the endovascular trophoblast (Sheth et al., 1997; Kurman et al.,
1984). Although it has been reported that extravillous trophoblast
cells in anchoring villi express negligible amounts of hPL, it would be
interesting to understand the mechanism underlying the low levels
of hPL in HPT-8 cells. We also showed that HPT-8 cells secreted
EGFR, SDF1 and PLAP, which have been previously reported in
human placental trophoblasts (Rettig et al., 1985; Wu et al., 2005).
EGFR, which is present in trophoblast cells from the blastocyst
stage, is known to promote the differentiation of trophoblast cells
into syncytiotrophoblast in vitro and may be involved in the regulation
of fetal growth and development (Lai and Guyda, 1984). Since HLA-G
is accepted as the definitive marker of extravillous trophoblast cells,
we used immunohistochemical staining and flow cytometry to characterize HPT-8 cells for the presence of HLA-G. Based on these data,
HPT-8 cells were designated as extravillous trophoblast cells.
Infection of the fetus by vertical transmission of HBV is known to
occur through the placental barrier (Ohto et al., 1987; Leikin et al.,
1996). Since trophoblast cells are the first layer of the placental barrier
and are in direct contact with the maternal circulation, investigation of
mechanisms underlying viral invasion of the feto–placental unit requires
the successful isolation and infection of trophoblast cells.
A human cytotrophoblast cell culture obtained from 6 to 10 week placentas was previously shown to be highly sensitive to HBV infection
in-vitro (Li et al., 2007). We failed to obtain an HBV-expressing clone
of HPT-8 when we infected HPT-8 cells with HBV positive serum
(data not shown). Previous studies have suggested that expression of
2154
Zhang et al.
the intact viral genome requires transfection of more than a single copy
of the genome (Lu et al., 1996). We therefore used 3 head-to-tail copies
of the adr subtype HBV full length DNA to transfect HPT-8 cells and
showed the presence of secreted HBsAg and HBeAg in stably transformed HPT-8-HBV cells. The conversion of rcDNA to cccDNA,
which is the template for the transcription of viral mRNAs (Tagawa
et al., 1986), suggested successful initiation of infection in our cell line.
The pre-S1 protein is considered the hallmark of successful HBV infection (Ryu et al., 1997). The presence of rcDNA, cccDNA and pre-S
sequence in the HPT-8-HBV cells confirmed the creation of a stably
transfected trophoblast cell line carrying the HBV genome.
HPT-8-HBV cells were immunopositive for HBsAg and HBeAg
although HBV titers decreased markedly after a few passages, when
compared with HepG2-HBV cells. This was consistent with the fact
that HepG2 hepatoma cells are highly specific host cells, which are
highly susceptible to HBV infection (Wang et al., 2006a; Sodunke
et al., 2008). HPT-8-HBV cells lost HBV DNA after passage 5 suggesting
that only early passage cells can be used to study mechanisms of viral
replication in these cells. Since the HBV genome was integrated into
the genome of HPT-8-HBV cells, the mechanism of viral DNA replication differs distinctly from the natural infection process. This cell
model can therefore not be used to study the adsorption, invasion
and exuviation of HBV.
HPT-8 cells can be used for the in vitro study of viral diseases associated with pregnancy as well as other pregnancy-associated disorders,
such as abortion and pre-eclampsia, which are associated with trophoblast dysfunction. The HBV pre-S1 protein, a surface antigen, plays a
role in targeting the virus to host cells, in viral packaging and in the
viral infection process, making HPT-8-HBV cells a useful tool to
study these processes. We previously reported the role of placental
tissue in intrauterine viral transfer (Xu et al., 2001, 2002). Our
future plans include co-culturing HPT-8-HBV cells which secrete
active HBV virus with blood endothelial cells to study the transfer of
HBV from trophoblasts to blood endothelial cells. We also aim to
investigate the mechanisms underlying the spontaneous immortalization of our primary culture.
In summary, we developed an experimental model for studying
HBV viral integration during intrauterine infection by establishing a
spontaneously immortalized, villous cytotrophoblast cell line, HPT-8,
and its HBV-expressing clone.
Supplementary data
Supplementary data are available at http://humrep.oxfordjournals.
org/.
Figure 7 HBV secretion in HPT-8-HBV cells. (A) PCR amplification of the pre-S region sequences of the HBV gene in the culture
medium of passage 2 HPT-8-HBV cells. HPT-8 cells transfected
with empty vector were used as negative control, while
pUC19-3HBV and HepG2-HBV cells were used as positive controls;
(B and C) Estimation of HBsAg and HBeAg levels in the culture
supernatant of HPT-8-HBV and HepG2-HBV cells. The culture
medium was harvested from passages 1, 2, 3 or 4 HPT-8 cells 48 h
after cells were seeded (D) Titration of HBV in the supernatant of
HPT-8-HBV and HepG2-HBV cells. Culture supernatant was collected 48 h, 1 month or 2 months after transfection.
Authors’ roles
L.Z. primary cell culture, HBV DNA transfection, molecular biology
and assay, paper writing and results discussion. W.Z. clinical sample
collection and preparation. C.S. HPT-8 characterization, data analysis
and results discussion. J.Z. primary cell culture, HBV DNA transfection, screening. K.M. data analysis and results discussion. Z.S.
HBV-related study and assay. Y.Y. study design and results discussion.
D.X. study design and results discussion.
Trophoblast cell line expressing hepatitis B virus
Acknowledgements
We thank the Department of Biochemistry and Molecular Biology,
Fourth Military Medical University and the Institute of Immunology,
Shandong University School of Medicine, China, for kindly providing
plasmids.
Funding
This work was supported by the National Natural Science Foundation
of China (No. 30230320); China Special Grant for the Prevention and
Control of Infection Diseases (2009ZX10002-027) and Natural
Science Foundation of Shanxi Province (2006C248).
References
Bhat P, Anderson DA. Hepatitis B virus translocates across a trophoblastic
barrier. J Virol 2007;81:7200 – 7207.
Dunk C, Petkovic L, Baczyk D, Rossant J, Winterhager E, Lye S. A novel in
vitro model of trophoblast-mediated decidual blood vessel remodeling.
Lab Invest 2003;83:1821 – 1828.
Feitelson MA. Biology of hepatitis B virus variants. Lab Invest 1994;
71:324– 349.
Feng HC, Choy MY, Deng W, Wong HL, Lau WM, Cheung AN,
Ngan HY, Tsao SW. Establishment and characterization of a human
first-trimester extravillous trophoblast cell line (TEV-1). J Soc Gynecol
Investig 2005;12:e21 – e32.
Frank HG, Morrish DW, Potgens A, Genbacev O, Kumpel B, Caniggia I.
Cell culture models of human trophoblast: primary culture of
trophoblast—a
workshop
report.
Placenta
2001;22(Suppl
A):S107 – S109.
Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N,
Lala PK. Establishment and characterization of first trimester human
trophoblast cells with extended lifespan. Exp Cell Res 1993;
206:204– 211.
Hambruch N, Haeger JD, Dilly M, Pfarrer C. EGF stimulates proliferation
in the bovine placental trophoblast cell line F3 via Ras and MAPK.
Placenta 2010;31:67 – 74.
Henson MC, Shi W, Greene SJ, Reggio BC. Effects of pregnant human,
nonpregnant human, and fetal bovine sera on human chorionic
gonadotropin, estradiol, and progesterone release by cultured human
trophoblast cells. Endocrinology 1996;137:2067 – 2074.
Kato Y, Braunstein GD. Discordant secretion of placental protein
hormones in differentiating trophoblasts in vitro. J Clin Endocrinol Metab
1989;68:814 – 820.
Khoo NK, Bechberger JF, Shepherd T, Bond SL, McCrae KR, Hamilton GS,
Lala PK. SV40 Tag transformation of the normal invasive trophoblast
results in a premalignant phenotype. I. Mechanisms responsible for
hyperinvasiveness and resistance to anti-invasive action of TGFbeta.
Int J Cancer 1998;77:429 – 439.
King A, Thomas L, Bischof P. Cell culture models of trophoblast II;
trophoblast cell lines-a workshop report. Placenta 2000;21(Suppl
A):S113 – S119.
Kurman RJ, Main CS, Chen HC. Intermediate trophoblast: a distinctive
form of trophoblast with specific morphological, biochemical and
functional features. Placenta 1984;5:349 – 369.
Lai WH, Guyda HJ. Characterization and regulation of epidermal growth
factor receptors in human placental cell cultures. J Clin Endocrinol
Metab 1984;58:344 – 352.
2155
Lavanchy D. Hepatitis B virus epidemiology, disease burden, treatment,
and current and emerging prevention and control measures. J Viral
Hepat 2004;11:97 – 107.
Leikin E, Lysikiewicz A, Garry D, Tejani N. Intrauterine transmission of
hepatitis A virus. Obstet Gynecol 1996;88:690 – 691.
Lewis MP, Clements M, Takeda S, Kirby PL, Seki H, Lonsdale LB,
Sullivan MH, Elder MG, White JO. Partial characterization of an
immortalized human trophoblast cell-line, TCL-1, which possesses a
CSF-1 autocrine loop. Placenta 1996;17:137 – 146.
Li L, Sheng MH, Tong SP, Chen HZ, Wen YM. Transplacental transmission
of hepatitis B virus. Lancet 1986;2:872.
Li F, Wang X, Men K, Xu D, Yan Y, Zhang J. Receptivity of human
choriocarcinoma JEGIII cells and isolated trophoblast cells to hepatitis
B virus infection and enhancement by tumor necrosis factor alpha. Jpn
J Infect Dis 2007;60:167– 172.
Lin HH, Lee TY, Chen DS, Sung JL, Ohto H, Etoh T, Kawana T, Mizuno M.
Transplacental leakage of HBeAg-positive maternal blood as the most
likely route in causing intrauterine infection with hepatitis B virus.
J Pediatr 1987;111:877– 881.
Lu X, Block TM, Gerlich WH. Protease-induced infectivity of hepatitis B
virus for a human hepatoblastoma cell line. J Virol 1996;
70:2277– 2285.
Maldonado-Estrada J, Menu E, Roques P, Barre-Sinoussi F, Chaouat G.
Evaluation of Cytokeratin 7 as an accurate intracellular marker with
which to assess the purity of human placental villous trophoblast cells
by flow cytometry. J Immunol Methods 2004;286:21 – 34.
Manoussaka MS, Jackson DJ, Lock RJ, Sooranna SR, Kumpel BM. Flow
cytometric characterisation of cells of differing densities isolated from
human term placentae and enrichment of villous trophoblast cells.
Placenta 2005;26:308 – 318.
Morrish DW, Whitley GS, Cartwright JE, Graham CH, Caniggia I. In vitro
models to study trophoblast function and dysfunction—a workshop
report. Placenta 2002;23 (Suppl A):S114 – S118.
Ohto H, Lin HH, Kawana T, Etoh T, Tohyama H. Intrauterine transmission
of hepatitis B virus is closely related to placental leakage. J Med Virol
1987;21:1 – 6.
Rettig WJ, Cordon-Cardo C, Koulos JP, Lewis JL Jr, Oettgen HF,
Old LJ. Cell surface antigens of human trophoblast and
choriocarcinoma defined by monoclonal antibodies. Int J Cancer
1985;35:469 – 475.
Rong-Hao L, Luo S, Zhuang LZ. Establishment and characterization of a
cytotrophoblast cell line from normal placenta of human origin. Hum
Reprod 1996;11:1328– 1333.
Ryu CJ, Gripon P, Park HR, Park SS, Kim YK, Guguen-Guillouzo C, Yoo OJ,
Hong HJ. In vitro neutralization of hepatitis B virus by monoclonal
antibodies against the viral surface antigen. J Med Virol 1997;52:226– 233.
Sheth NA, Suraiya JN, Sheth AR, Ranadive KJ, Jussawalla DJ. Ectopic
production of human placental lactogen by human breast tumors.
Cancer 1997;39:1693 – 1699.
Shiverick KT, King A, Frank H, Whitley GS, Cartwright JE, Schneider H.
Cell culture models of human trophoblast II: trophoblast cell lines—a
workshop report. Placenta 2001;22 (Suppl A):S104 – S106.
Sodunke TR, Bouchard MJ, Noh HM. Microfluidic platform for hepatitis B
viral replication study. Biomed Microdevices 2008;10:393– 402.
Straszewski-Chavez SL, Abrahams VM, Alvero AB, Aldo PB, Ma Y,
Guller S, Romero R, Mor G. The isolation and characterization of a
novel telomerase immortalized first trimester trophoblast cell line,
Swan 71. Placenta 2009;30:939– 948.
Tagawa M, Omata M, Okuda K. Appearance of viral RNA transcripts in the
early stage of duck hepatitis B virus infection. Virology 1986;152:477– 482.
Wang XP, Xu DZ, Li YG. In vitro culture of human trophoblasts. J Fourth
Mil Med Univ 2002;23:4.
2156
Wang AH, Men K, Yan YP, Xu DZ, Lu J, Wang XP, Zhang JX. [Hepatitis B
immunoglobulins blocking hepatitis B virus infection of trophoblast cell
culture in vitro]. Zhonghua Fu Chan Ke Za Zhi 2006a;41:165 – 168.
Wang YL, Qiu W, Feng HC, Li YX, Zhuang LZ, Wang Z, Liu Y, Zhou JQ,
Zhang DH, Tsao GS. Immortalization of normal human cytotrophoblast
cells by reconstitution of telomeric reverse transcriptase activity. Mol
Hum Reprod 2006b;12:451– 460.
Wei Y, Tavis JE, Ganem D. Relationship between viral DNA synthesis and
virion envelopment in hepatitis B viruses. J Virol 1996;70:6455– 6458.
Wu X, Jin LP, Yuan MM, Zhu Y, Wang MY, Li DJ. Human first-trimester
trophoblast cells recruit CD56brightCD16- NK cells into decidua by
Zhang et al.
way of expressing and secreting of CXCL12/stromal cell-derived
factor 1. J Immunol 2005;175:61 – 68.
Xu DZ, Yan YP, Zou S, Choi BC, Wang S, Liu P, Bai G, Wang X, Shi M.
Role of placental tissues in the intrauterine transmission of hepatitis B
virus. Am J Obstet Gynecol 2001;185:981 – 987.
Xu DZ, Yan YP, Choi BC, Xu JQ, Men K, Zhang JX, Liu ZH, Wang FS. Risk
factors and mechanism of transplacental transmission of hepatitis B
virus: a case-control study. J Med Virol 2002;67:20 – 26.
Zhang SL, Yue YF, Bai GQ, Shi L, Jiang H. Mechanism of
intrauterine infection of hepatitis B virus. World J Gastroenterol 2004;
10:437 – 438.