US 20040142330A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2004/0142330 A1 (43) Pub. Date: Nyren et al. (54) METHOD OF SEQUENCING DNA (76) Inventors: Pal Nyren, Stockholm (SE); Mostafa Ronaghi, Palo Alto, CA (US); Annika Jul. 22, 2004 Publication Classi?cation (51) Int. Cl? ..................................................... ..C12Q 1/68 (52) Us. 01. ................................................................ .. 435/6 Tallsjo, Uppsala (SE) (57) Correspondence Address: DORSEY & WHITNEY LLP INTELLECTUAL PROPERTY DEPARTMENT 250 PARK AVENUE NEW YORK, NY 10177 (US) (21) Appl. No.: 10/363,231 (22) PCT Filed: Sep. 7, 2001 (86) PCT No.: PCT/GB01/04015 ABSTRACT The present invention provides a method of identifying a base at a target position in a sample nucleic acid sequence, said method comprising: subjecting a primer hybridised to said sample nucleic acid immediately adjacent to the target position, to a polymerase primer extension reaction in the presence of a nucleotide, Whereby the nucleotide Will only become incorporated if it is complementary to the base in the target position, and determining Whether or not said nucle otide is incorporated by detecting Whether Ppi is released, the identity of the target base being determined from the identity of any nucleotide incorporated, Wherein, Where said nucleotide comprises an adenine base, an (X-ihiO triphos (30) Foreign Application Priority Data Sep. 7, 2000 (GB) ....................................... .. 0021977.4 phate analogue of said nucleotide is used, ant the Rp isomer of said analogue and/or the degradation products of said analogue are eliminated from the polymerase reaction step. Patent Application Publication com o ow Jul. 22, 2004 Sheet 1 0f 22 oom US 2004/0142330 A1 Patent Application Publication Jul. 22, 2004 Sheet 2 0f 22 US 2004/0142330 A1 2 FIG. Sdof+A5OTPitor.ns C) O O C) (0 lo O O O O 0') Light Intensify 200 100 Patent Application Publication Jul. 22, 2004 Sheet 3 0f 22 oom omw oov 0mm O O 0") o to N o o N Light Intensify om? o2 US 2004/0142330 A1 om Patent Application Publication Jul. 22, 2004 Sheet 4 0f 22 US 2004/0142330 A1 w.OI omw oov 0mm com O LO 0 0 m N Light Intensify om? oor om Patent Application Publication Jul. 22, 2004 Sheet 5 0f 22 US 2004/0142330 A1 dTP+A doTA5Pi+ftA0ToPns 600 500 O O 00 u m 00 n Llght lntensnfy 100 FIG.5 Patent Application Publication Jul. 22, 2004 Sheet 6 0f 22 US 2004/0142330 A1 wi Et 02 cm? 03 cm? O O (I) 2 Light Intensity 0 (O 0 v om Patent Application Publication Jul. 22, 2004 Sheet 7 0f 22 US 2004/0142330 A1 86990418E3PN+kinase2mu+AP+256sup Well:25 ollllllllllllI'IIIITTFIIFIIIIIIIII -GCGCGCGCATCGCATCGCé é 25' i ll OlllllllllIIIllllllllllllllllllllllll -GCGCGCATCGCGCGCATCATC FIG. 7B 86990418E3PN+kinase2mu+AP+256sup Well143 25 15 10 Patent Application Publication Jul. 22, 2004 Sheet 8 0f 22 US 2004/0142330 A1 (kitA) OpJ A TACGTA TACGTACGTACGTACGTA TACGTA (kitA) 5m B A T TACGTACGTACGTACGTACGTACGT (kitA) 10w (3 ACGTACGTACGTACGT (kitA) 20w D FIG. 8 T Patent Application Publication Jul. 22, 2004 Sheet 9 0f 22 T TA TA US 2004/0142330 A1 TACGTACGTACGTACGTA T (Super Sp) 5p! F TACGTACGTACGT T (Super Sp) 10p] G (Super Sp) 20p! H 8 cont'd Patent Application Publication Jul. 22, 2004 Sheet 10 0f 22 US 2004/0142330 A1 50 45 40 35 30 25 20 15 10 5 O ACGTACGTACGTACGTACGTACGTAOGTACGTACGTACGTACGTACGTACGTACGTACGT 40 35 30 25 20 _ 15 10 5 0 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT 25 l 20 K 10-; 5 \ “WWW \\. 0lTlllllllllllllllllllll?lllllnjlllllllllllllllllllllllwll ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTAQ'STACGTACGTACGTACGTACGTACGTACGTACGT 8 cont'd Patent Application Publication Jul. 22, 2004 Sheet 11 0f 22 US 2004/0142330 A1 6996 9026 L988 L678 1mM0tpAdPSLhlBa.rUopmeT0b7Cc2nhPaitq1gk9 68LL SEVL LQOL LZLQ SL219 6L09 9999 LL89 L967 809’? 67217 9688 N798 L9l€ ‘8982 6LVZ SZLZ LLLL LLVL 890i 60L 99$ L (D (D 800 700 600 o o no 400 300 200 100 Patent Application Publication Jul. 22, 2004 Sheet 14 0f 22 US 2004/0142330 A1 aGE£8 Patent Application Publication Jul. 22, 2004 Sheet 16 0f 22 US 2004/0142330 A1 LZLZL EOVZL SQOZL LQLH 6177M L‘EILH €L8OL 96VOL LLLOL 6988 M796 8ZZ6 9068 L898 6928 [86L 889i Sl-SL L669 6L99 L989 8709 GZLG 1.0179 6mM0ptAdPhBla.Ur0pmTbC72aohcP1itk9 6809 LLLV 89W 98W LL88 66119 L8L€ 9982 91793 [.332 606L L6Sl SLZL 996 L99 6L9 L 800 700 600 500 400 300 200 100 CD G 9 l F cont'd. Patent Application Publication Jul. 22, 2004 Sheet 17 0f 22 US 2004/0142330 A1 mm 206st‘ mMp0tAdPBahl.Ur0pTbRC72toahPE1ck9 CGTA g c €917£L 660€L QVLZL L6€ZL 120a €89LL GZSLL SLSOL LZ9OL .LQZOL H66 6996 9026 L988 1.6178 ewe 6822 98172 L802 LZLQ use 6L09 9999 LL89 L967 20911 617217 9682 M798 L8H) sesz GLVZ SZLZ LLLL 1m €9OL 60L 66 800 700 600 500 998 L 400 300 200 100 Patent Application Publication Jul. 22, 2004 Sheet 18 0f 22 US 2004/0142330 A1 Icont'd mMp0tAdPaBlh.Urp0TbRC7t2ahoPE1ck9 CGTA CT o o o O O o N (D LO Q’ 0‘) (\l " Patent Application Publication Jul. 22, 2004 Sheet 19 0f 22 US 2004/0142330 A1 LOSSL SEVSL 6608L SVLZL LGEZL L 8 0 3 ll? 63814 SLSOL LZQOL LQZOL H66 6996 9086 L988 A6178 (9 8W8 22mE25t3Q32“m20%8x50%R28 O2:8 luv 8 0 l. L c... 9 H89 L961’ 80917 W98 28%? < 8882 61.173 0 SZLZ 9 LLVL LLLL 998 com com com oom oov com com oov
© Copyright 2026 Paperzz