Journal of Pediatric Surgery 49 (2014) 520–524
Contents lists available at ScienceDirect
Journal of Pediatric Surgery
journal homepage: www.elsevier.com/locate/jpedsurg
Rotavirus particles in the extrahepatic bile duct in experimental biliary atresia
Christina Oetzmann von Sochaczewski a,⁎, Isabel Pintelon b, Inge Brouns b, Anika Dreier a,
Christian Klemann a, Jean-Pierre Timmermans b, Claus Petersen a, Jochen Friedrich Kuebler a
a
b
Department of Pediatric Surgery, University Hospital of Hannover, Hannover, Germany
Laboratory of Cell Biology & Histology, Department of Veterinary Sciences, University of Antwerp, Antwerp, Belgium
a r t i c l e
i n f o
Article history:
Received 31 May 2013
Received in revised form 10 August 2013
Accepted 27 September 2013
Key words:
Biliary atresia
Mouse model
Rotavirus
Obstruction
Liver
Extrahepatic bile duct
a b s t r a c t
Background: Biliary atresia (BA) is the most common indication for liver transplantation in children. The
experimental model of BA, induced by rotavirus infection in neonatal mice, has been widely used to
investigate the inflammatory aspects of this disease. We investigated the kinetics and the localization of the
viral infection in this murine model.
Methods: In this study 399 animals were employed for a detailed investigation of rhesus rotavirus (RRV)induced BA. RRV kinetics was analyzed by rtPCR and its (sub) cellular localization investigated using whole
mounts which were further processed for confocal and electron microscopy.
Results: The BA mouse model resulted in up to 100% induction of atresia following RRV injection. The kinetics
of RRV infection differed between liver and extrahepatic bile ducts. While the virus peak up to day 10
postinfection was similar in both organs, the virus remained detectable in extrahepatic bile duct cells up to
day 21. Interestingly, RRV particles were localized not only in cholangiocytes but also in cells of the
subepithelial layers, potentially macrophages.
Conclusions: RRV remains present in the extrahepatic bile duct cells after an initial virus peak. Viral particles
were detected in subepithelial cells in contrast to the described tropism toward cholangiocytes.
© 2014 Elsevier Inc. All rights reserved.
Biliary atresia (BA) is the most common cause of chronic
progressive liver disease in childhood and is the leading indication
for pediatric liver transplantation worldwide. The etiology of BA
remains unknown, but one leading hypothesis proposes a virus as the
triggering event leading to BA [1,2]. In BA patients, several viral strains
have been detected in liver or blood samples [3,4]; however,
simultaneous screening of BA patients for all common hepatotropic
viruses, yielded positive results for only 30%–55% of patients
undergoing the Kasai procedure [5–7]. Experimental BA is induced
by postpartum intraperitoneal infection of BALB/c mice with rhesus
rotavirus (RRV) [8,9]. RRV is widely prevalent in the population as the
most common cause for diarrhea in infants and children and has been
one of the viruses identified in livers of patients with BA [7,10,11]. In
this experimental model, the virus is cleared in the liver, prior to the
development of the full clinical picture of BA, but triggers an
inflammatory reaction that causes the fibrosing destruction of the
extrahepatic bile ducts [8,9,12,13]. Most studies describing experimental and clinical BA have focused on liver tissues. However, we
hypothesized, that there are differences in the virus kinetics between
liver and extrahepatic biliary tissue. Therefore we assessed the
dynamics of the viral load in both tissues and used electron
⁎ Corresponding author. Department of General Surgery, Dr. Horst Schmidt Klinik,
Wiesbaden, Germany. Tel.: + 49 176 61124081.
E-mail address: [email protected] (C. Oetzmann von Sochaczewski).
0022-3468/$ – see front matter © 2014 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.jpedsurg.2013.09.064
microscopy to localize the viral particles in the extrahepatic bile
ducts of affected animals.
1. Methods
1.1. Biliary atresia animal model
In total, 399 newborn BALB/c mice were divided into two groups
and injected within the first 24 h postpartum. The control group
(n = 102) was injected with 50 μl saline. Two hundred ninety-seven
animals were infected intraperitoneally with 50 μl containing
2.5 × 10 6 pfu RRV [14]. Animals dying within 72 h because of the
injection were excluded as described in the Results section. Animals
were evaluated every other day for weight, cholestasis and furcovered skin up to day 21 postinfection. BA was scored at the time
point of preparation of liver and extrahepatic bile ducts.
The extrahepatic bile duct samples were used either for wholemount preparation (infected n = 95, control n = 80) and immunohistochemistry imaged by means of confocal microscopy, rtPCR
(infected n = 96, control n = 0) or electron microscopic analysis
(infected n = 19, control n = 4). Animals used in a second study
were included in the numbers for whole-mount samples and analyzed
here only for clinical symptoms. A minimum of four animals were
sacrificed daily for whole-mount analysis from day 1 to day 10 and
additionally on day 12 and day 14 postinfection. A group of eight
animals was analyzed by rtPCR at various time points. Samples were
C. Oetzmann von Sochaczewski et al. / Journal of Pediatric Surgery 49 (2014) 520–524
521
collected daily around the expected peak of infection and less
frequently at early and late time points (Fig. 3). Extrahepatic bile
ducts were sampled for electron microscopy at days 1, 2, 3, 5, 8, 10, 12,
and 14 postinfection.
All experiments of this study were approved by the government
and performed according to the national regulations for the
protection of animal models (registration number 11-0360).
1.2. Virus production
RRV strain MMU 18006 was grown in MA-104 African green
monkey kidney cells and assayed for concentration by infectious
plaque assay as previously described [8,9].
1.3. Whole mount of bile ducts
Bile duct whole mounts were immersion-fixed 30 min after
isolation with 4% paraformaldehyde (in 0.1 M phosphate buffer;
pH 7.4). Immunohistochemical incubations were carried out at room
temperature on free-floating bile ducts. All primary and secondary
antisera were diluted in phosphate-buffered saline (PBS; 0.01 M;
pH 7.4) containing 10% normal horse serum, 0.1% bovine serum
albumin, 0.05% thimerosal, 0.01% NaN3 1% and Triton-X-100. Prior to
incubation with the primary antisera, whole mounts were incubated
for 1 h with the antibody diluent. Whole mounts were incubated
overnight with a monoclonal primary antibody raised in rat against
the endothelial marker CD31 (1:50; Abcam ab56299, Cambridge, UK).
To visualize immunoreactivity for CD31, whole mounts were
further incubated for 4 h with Cy3-conjugated donkey antirat
immunoglobulins (DARa-Cy3; 1:200; Jackson ImmunoResearch,
712-165-150, West Grove, PA). Whole mounts were then incubated
for a consecutive night with a second primary antibody against RRV
(1/2000; Sh Pc; Abcam ab35417) followed by a 4-h secondary
incubation with FITC-conjugated donkey antisheep immunoglobulins
(DASh-FITC; 1:200; Jackson ImmunoResearch, 713-095-003).
High-resolution images were obtained using a microlens-enhanced dual spinning disk confocal microscope (UltraVIEW VoX;
PerkinElmer, Seer Green, UK) equipped with 488-nm and 561-nm
diode lasers for excitation of FITC and Cy3, respectively. Images were
processed and analyzed using Volocity software.
Fig. 1. Development of RRV-induced biliary atresia in mice during the first 21 days
postinfection. (A) RRV-infected animals show reduced weight gain. (B) Most infected
animals show cholestasis from day 5 on followed by an oily fur around day 10. (C) The
majority of all animals develop BA between day 12 and day 14. The high incidence
observed at days 9 and 10 may be overrepresented because of the small group size.
Relative RNA levels were quantified using the StepOne Software
Version 2.0 (Applied Biosystems) and Excel 2007 (Microsoft).
2. Results
2.1. Biliary atresia model
Mice (n = 297) were infected with 2.5 × 10 6 pfu RRV within 24 h
of life to induce BA.
1.4. Transmission electron microscopy
Bile ducts were immersion-fixed after isolation in 2.5% glutaraldehyde solution for 30 min, rinsed in 0.1 M sodium cacodylatebuffered (pH 7.4) and postfixed in 1% OsO4 solution for 2 h. After
dehydration in an ethanol gradient (70% ethanol for 20 min, 96%
ethanol during 20 min, 100% ethanol for 2 × 20 min), whole mounts
were embedded in EMbed 812 (Electron Microscopy Sciences,
Hatfield, PA). Ultrathin sections were stained with 2% uranyl acetate
and lead citrate, and examined in a Tecnai G2 Spirit Bio Twin
Microscope (FEI, Eindhoven, the Netherlands) at 120 kV.
1.5. Quantitative RT-PCR
Liver and bile duct were sampled independently in each
experimental animal. RNA was isolated using the RNeasy Mini Kit
(Qiagen) according to the manufacturer's instructions. RNA of 1 μg
was transcribed to cDNA with the RNA-to-cDNA Kit (Applied
Biosystems). qPCR was performed in technical triplicates on a Step
One Plus cycler (Applied Biosystems) using the Maxima Sybr Green/
Rox qPCR mastermix (Fermentas) according to standard protocol. The
primers CACCAGCGGTAGCGGCGTTAT and TTGCTTGCGTCGGCAAGTACTGA were employed to detect RRV and the signal was normalized
against GAPDH in a second reaction with the primer pair CCCCAGCAAGGACACTGAGCAAG and TGGTATTCAAGAGAGTAGGGAGGGC.
2.1.1. Lethality
Perinatal mortality—defined as death within the first three days
postinfection—resulted in the loss of 28 animals (9.4%). After day 3, 9
infected animals (3.0%) died with a majority of 9 animals deceased
from days 15 to 17. In the placebo-injected control group (n = 102) 9
animals (8.8%) died of perinatal mortality while no animals were lost
after day 3 postinfection.
2.1.2. Clinical symptoms
Infected individuals showed a delayed weight development
compared to healthy controls, although results were not significant
in this study (Fig. 1A). Three animals (1.0%) cleared the infection as
documented by a weight gain and loss of clinical symptoms. The
majority of the infected mice developed cholestasis starting from day
3 to day 6 postinfection complemented by an oily fur starting from
day 8 to day 11 (Fig. 1B).
2.1.3. Development and incidence of BA
Microscopic and histological evaluation of bile ducts of infected
animals showed the first complete atresia on day 8 (day 8: 1/9).
Throughout the following days evidence of BA increased significantly
(day 9: 5/10, day 10: 6/10, day 12: 10/14). All infected animals
sacrificed after day 14 showed BA (day 14: 44/44, day 17: 8/8, day 21:
8/8; Fig. 1C). A subset of the dissected bile ducts was prepared for
522
C. Oetzmann von Sochaczewski et al. / Journal of Pediatric Surgery 49 (2014) 520–524
Fig. 2. Whole-mount preparation of extrahepatic bile duct stained for the endothelial marker CD31 (red) and RRV vp6 antigen (green). (A) Early time point (day 2 postinfection)
shows isolated virus particles. (B) Middle time point during disease development (day 5 postinfection) indicates that the virus is present in high numbers throughout the tissue but
then starts to reduce (day 7 postinfection) (C).
electron microcopy to evaluate morphological modifications during
disease development. As the disease progresses in infected animals,
the lumen of the extrahepatic bile duct decreases. At day 14
cholangiocytes are ultimately lost when the bile duct becomes
completely obstructed (data not shown).
2.1.4. Localization and kinetics of RRV
An overview picture of RRV spread was obtained by double
staining a second subset of the dissected bile duct whole mounts for
viral protein 6 (VP6, green) and the endothelial marker CD31 and
subsequently making 3D reconstructions of stacks of confocal images.
Only scattered cells were infected on day 2 postinfection (Fig. 2A). The
peak of infected cells was observed around day 5 (Fig. 2B), while the
number of infected cells was reduced at day 7 (Fig. 2C). The onset and
kinetics of virus replication were similar in liver and bile ducts up to
day 7, suggesting a synchronous infection of both organs (Fig. 3).
Interestingly, RRV was cleared from liver cells from day 11 on
(Fig. 3B), while it replicated in the bile duct at high levels up to day 10
and remained detectable at 10–30 times lower levels until day 21
(Fig. 3A).
The wall of the extrahepatic bile duct of uninfected animals
consisted of cholangiocytes (the innermost layer), subepithelial
structures of connective tissue, myofibroblasts, smooth muscle cells
and blood vessels and the outermost mesothelial layer of the serosa
(Fig. 4A). Electron microscopical analysis demonstrated virus particles
in cholangiocytes on day 5 (data not shown). Interestingly, groups of
RRV particles could be observed in several cells in the subepithelial
layers as identified by location (Fig. 4A–D).
Although identification of the exact cell type is difficult based only
on electron microscopy without immune labeling, the protrusions
observed in these cells would indicate that these cells have the ability
to migrate (Fig. 5). Possible cell types could include macrophages,
myofibroblasts or stellate cells.
3. Discussion
We closely documented the progressive development of experimental BA after its induction by perinatal infection of BALB/c mice
with rhesus rotavirus. In the first days, no clinical or histological
changes were observed, apart from a few animals that died likely of
the stress and/or traumatic impact of the infecting procedure. This
early lethality was not directly related to the virus infection, as it was
similar in the placebo control group (9.4% vs. 8.8%, respectively). The
first sign of BA was jaundice, which mice developed in the second half
of the first week of life. Throughout this period, histological sections of
the bile duct revealed increasing stenosis of the lumen of the
extrahepatic bile ducts, which, however, remained open, suggesting
that the jaundice was caused by hepatic affection rather than by
changes of the extrahepatic biliary system. BA developed in the
second week, with the earliest atretic animal detected on day 8 up to
day 14, at which time all dissected animals showed a complete
obstruction of the extrahepatic bile duct (Fig. 1).
It is not clear how exactly the fibrosing stenosis in the extrahepatic
bile ducts is triggered in this model. Several authors, who investigated
viral and inflammatory factors in the pathogenesis of BA, predominantly worked with liver tissue samples which are easily available in
the murine experimental model as well as in human patients [11,15].
However, less data are available on the changes in the extrahepatic
biliary tissue. To investigate the pathogenesis of the bile duct
destruction in experimental BA, we focused on the kinetics of the
RRV infection which we correlated to the different stages of the
disease. The amount of viral RNA increased during the first days in
both liver and bile duct tissue in a similar fashion. However, the viral
infection peaked prior to the clinical development of BA at the end of
the first week, as seen in both liver and bile duct tissue. Thereafter, the
hepatic virus load declined and no viral RNA could be detected
anymore by rtPCR in the liver after day 12. These observations are in
accordance with those of a number of published studies, in which the
peak of replication in both tissues was reported at day 5 to day
8 [12,13]. Although the overall kinetics were similar in liver and bile
duct tissues up to day 10, reduced amounts of viral RNA persisted in
the extrahepatic biliary system throughout the observation period.
This finding suggests that there are differences in the kinetics of RRV
infection between the extrahepatic bile duct and the liver.
Both whole-mount immunohistochemistry and electron microscopy were used to localize the virus infection at a (sub)cellular level.
Using double staining for CD31 and virus antigen VP6, we observed a
virus cluster localized in the lumen of the extrahepatic bile duct, with
some spots of viral antigen localized in the wall structure. It is well
known that RRV has a tropism for cholangiocytes and infection of
cholangiocytes has been postulated as an initial step in the
inflammatory reaction in experimental BA [12,13,16]. These findings
are further supported by our observation of viral particle clusters
within the cholangiocytes at days 5 and 8. Interestingly, viral particles
were also detected in several cells in the subepithelial layers, in
addition to the epithelial layer (Fig. 4). The exact nature of these cells
remains to be identified, but the protrusions observed suggest that
these cells are migrating cells, most likely macrophages. It is known
that there is a proliferation of CD68-positive macrophages in the livers
of BA patients [17] and the expression of macrophage-associated
antigens has been correlated to a poor outcome [18]. Moreover,
immunohistochemical analysis of tissue exudates of the bile duct wall
at the porta hepatis showed a high number of macrophages, but an
absence of lymphocyte infiltration [19]. Although these data are in
C. Oetzmann von Sochaczewski et al. / Journal of Pediatric Surgery 49 (2014) 520–524
523
Fig. 3. Kinetics of RRV infection evaluated by quantitative PCR of RRV gene VP6 relative to GAPDH expression. Numbers of positive (product detectable in PCR) and negative tested
animals (copy numbers below detection limit) are given on top of each chart. Each data point reflects the average of virus presence in positive animals quantified in the bile duct (A)
and liver (B). Error bars indicate standard error.
Fig. 4. Ultrathin sections of extrahepatic bile duct at day 8 using transmission electron microscopy. Black arrows point at RRV particles. (A) Overview picture showing a section of the
bile duct with an increasingly obstructed lumen (L) in the center. The lumen is surrounded by cholangiocytes. The cell marked by a black box was selected for higher amplification in
panels B, C and D. (D) Groups of viral particles possibly forming a viroplasm are visible within the cell.
524
C. Oetzmann von Sochaczewski et al. / Journal of Pediatric Surgery 49 (2014) 520–524
primary affection of the extrahepatic biliary system and to better
understand the pathogenesis of BA.
References
Fig. 5. Subepithelial cell 5 days post-RRV infection. The black arrow points at RRV
particles. Cell protrusions are indicated by black triangles.
contrast to the findings of strong influx of T cells in the livers of mice
during experimental BA, some studies have suggested that also in
experimental BA, macrophages may play an important role: Macrophages were shown to be susceptible to infection by RRV in tissue
culture [20] and have been described to support the inflammatory
reaction in livers of mice subjected to experimental BA [21]. The
appearance of these subepithelial virus-laden cells correlated with the
development of stenosis and atresia of the extrahepatic bile ducts in
our model, suggesting that these cells could indeed contribute to the
destruction of the extrahepatic bile duct. Based on the well-known
tropism of rotavirus to cholangiocytes, cholangiocytes have been in
the focus of the research regarding the initiation of the inflammatory
response in BA, with in vivo and in vitro studies [22–24]. Our results
suggest that macrophages might also be an interesting candidate and
further studies should explore the possibilities of altering macrophage
functions in order to alleviate the course of experimental BA.
Despite a number of limitations, such as the inability of
conventional electron microscopy to detect the virus in every state
of its cycle, our study provides a detailed description of the different
stages of development of experimental BA that might be instrumental
in furthering our knowledge of this challenging disease. We clearly
demonstrated in this study that, following a comparable virus peak in
liver and extrahepatic bile ducts, the virus is cleared from the liver
while it remains detectable in the extrahepatic bile ducts, supporting
our hypothesis of differences in the viral kinetics in hepatic and biliary
tissues. Detection of viral particles in subepithelial cells was not
previously reported and is in contrast to the observed tropism toward
cholangiocytes. These findings could help to better understand the
[1] Landing BH. Considerations of the pathogenesis of neonatal hepatitis, biliary and
choledochal cyst—the concept of infantile obstructive cholangiopathy. Prog
Pediatr Surg 1974;6:113–39.
[2] Hertel P, Estes M. Rotavirus and biliary atresia: can causation be proven?
Gastroenterology 2012;28:10–7.
[3] Morecki R, Glaser JH, Cho S, et al. Biliary atresia and retovirus type 3 infection. N
Engl J Med 1982;307:481–4.
[4] Richardson SC, Bishop RF, Smith AL. Reovirus serotype 3 infection in infants with
extrahepatic biliary atresia or neonatal hepatitis. Gastroenterol Hepatol 1994;9:264–8.
[5] Schukfeh N, Al-Gamrah A, Petersen C, et al. Detection of hepatotropic viruses has no
impact on the prognosis after Kasai procedure. J Pediatr Surg 2012;47:1828–32.
[6] Rauschenfells S, Krassmann M, Al-Masri AN, et al. Incidence of hepatotropic
viruses in biliary atresia. Eur J Pediatr 2009;168:469–76.
[7] Tyler KL, Sokol RJ, Oberhaus SM, et al. Detection of reovirus RNA in hepatobiliary
tissues from patients with extrahepatic biliary atresia and choledochal cysts.
Hepatology 1998;27:1475–82.
[8] Petersen C, Biermanns D, Kuske M, et al. New aspects in a murine model for
extrahepatic biliary atresia. J Pediatr Surg 1997;32:1190–5.
[9] Riepenhoff-Talty M, Schaekel K, Clark HF, et al. Group A rotavirus produce
extrahepatic biliary obstruction in orally inoculated newborn mice. Pediatr Res
1993;33:393–4.
[10] Ramig RF. Pathogenesis of intestinal and systemic rotavirus infection. J Virol
2004;78:10213–20.
[11] Riepenhoff-Talty M, Gouvea V, Evans MJ, et al. Detection of group C rotavirus in
infants with extrahepatic biliary atresia. J Infect Dis 1996;174:8–15.
[12] Feng N, Kim B, Fenaux M, et al. Role of interferon in homologous and heterologous
rotavirus infection in the intestines and extraintestinal organs of suckling mice.
J Virol 2008;82:7578–90.
[13] Shivakumar P, Campbell KM, Sabla GE, et al. Obstruction of extrahepatic bile ducts
by lymphocytes is regulated by IFN gamma in experimental biliary atresia. J Clin
Invest 2004;114:322–9.
[14] Czech-Schmidt G, Verhagen W, Szavay P, et al. Immunological gap in the infectious
animal model for biliary atresia. J Surg Res 2001;101:62–7.
[15] Allen SR, Jafri M, Donelly B, et al. Effect of rotavirus strain on the murine model of
biliary atresia. J Virol 2007;81:1671–9.
[16] Feng N, Sen A, Wolf M, et al. Roles of VP4 and NSP1 in determining the distinctive
replication capacities of simian rotavirus RRV and bovine rotavirus UK in the
mouse biliary tract. J Virol 2011;85:2686–94.
[17] Tracy Jr TF, Dillon P, Fox ES, et al. The inflammatory response in pediatric biliary
disease: macrophage phenotype and distribution. J Pediatr Surg 1996;31:121–5.
[18] Kobayashi H, Puri P, O'Brian DS, et al. Hepatic overexpression of MHC class II
antigens and macrophage-associated antigens (CD68) in patients with biliary
atresia of poor prognosis. J Pediatr Surg 1997;32:590–3.
[19] Schweizer P, Petersen M, Jeszberger N, et al. Immunohistochemical and molecular
biological investigations regarding the pathogenesis of extrahepatic biliary
atresia. (Part 1: immunohistochemical studies). Eur J Pediatr Surg 2003;13:7–15.
[20] Mohanty S, Ivantes C, Mourya R, et al. Macrophages are targeted by rotavirus in
experimental biliary atresia and induce neutrophil chemotaxis via Mip2/Cxcl2.
Pediatr Res 2010;67:345–51.
[21] Mack CL, Tucker RM, Sokol RJ, et al. Armed CD4+ Th1 effector cells and activated
macrophages participate in bile duct injury in murine biliary atresia. Clin Immunol
2005;115:200–2009.
[22] Barnes BH, Tucker RM, Wehrmann F, et al. Cholangiocytes as immune modulators
in rotavirus-induced murine biliary atresia. Liver Int 2009;29:1253–61.
[23] Coots A, Donnelly B, Mohanty SK, et al. Rotavirus infection of human cholangiocytes
parallels the murine model of biliary atresia. J Surg Res 2012;177:275–81.
[24] Mohanty SK, Donnelly B, Bondoc A, et al. Rotavirus replication in the cholangiocyte
mediates the temporal dependence of murine biliary atresia. PLoS One 2013;8:
e69069.