Binding of a cellular factor to the 3h untranslated region of the RNA

Journal
of General Virology (1998), 79, 1715–1723. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Binding of a cellular factor to the 3« untranslated region of the
RNA genomes of entero- and rhinoviruses plays a role in virus
replication
Kenneth H. Mellits, Janet M. Meredith, Jonathan B. Rohll, David J. Evans and Jeffrey W. Almond
School of Animal & Microbial Sciences, The University of Reading, Whiteknights, Reading RG6 6AJ, UK
The presence of cellular factors that bind to the 3«
untranslated region (UTR) of picornaviruses was
investigated by electrophoretic mobility shift assays
(EMSAs). A cellular factor(s) that binds specifically
the 3« UTR of polio-, coxsackie- and rhinoviruses
was detected. Furthermore, this factor(s) is distinct
from those which bind to the 5« terminal 88 nt (the
‘ cloverleaf ’) of poliovirus. Mutations within the 3«
Introduction
The entero- and rhinoviruses are closely related members
of the family Picornaviridae. They possess single-stranded
messenger-sense RNA genomes of approximately 7500 nt and
have a common genetic organization consisting of a 5«
untranslated region (UTR) of approximately 750 nt, a single
open reading frame (ORF) occupying about 90 % of the
genome, a 3« UTR of approximately 50–90 nt, and a 3«terminal poly(A) tract (Kitamura et al., 1981 ; Racaniello &
Baltimore, 1981 ; Stanway et al., 1983). The single ORF
encodes a polyprotein which is processed in the infected cell to
produce virus structural and non-structural proteins (Wimmer
et al., 1993). The roles of a number of these proteins in virus
replication are known, but our understanding of the precise
mechanism of virus replication and the function of all the viral
and cellular proteins involved remains incomplete.
The 5« and 3« UTRs of the genomes have important cisacting functions in the replication of the RNAs. Evidence to
date suggests that the 5« UTR contains elements which are
involved in RNA replication. In particular, a ‘ cloverleaf ’
structure (CL) of poliovirus formed by the 5«-terminal 88 nt of
the RNA has been shown to bind viral proteins 3AB and 3CD,
and a host protein of 36 kDa, originally identified as the Cterminal fragment of the eukaryotic elongation factor, EF-1α
Author for correspondence : Jeffrey Almond.
Fax ­44 118 931 6537. e-mail j.w.almond!reading.ac.uk
UTR which decrease the affinity of the RNA for the
cellular factor in EMSAs decrease RNA replication
and virus viability. Revertants of these mutants
display changes which are predicted to stabilize the
RNA secondary structure of the 3« UTR. These results
indicate that binding of a cellular factor to the UTR
plays a role in virus replication and that RNA
secondary structure is important for this function.
(Harris et al., 1994). In addition, proteins of molecular mass
36 kDa that bind to the poliovirus CL and to stem–loop IV of
the 5« UTR have been identified as the poly(rC) binding
proteins (PCBP1 and PCBP2) (Blyn et al., 1995 ; Gamarnik &
Andino, 1997). Recently, a role for these cellular polypeptides
in poliovirus translation has been demonstrated (Blyn et al.,
1997). The bulk of the remainder of the 5« UTR constitutes an
internal ribosome entry site which allows cap-independent
translation, allowing viral protein synthesis in infected cells
where cellular translation is shut-off via the activity of the viral
protease 2A (for review see Jackson, 1988 ; Jackson & Kaminski,
1995).
In contrast to our knowledge of the 5« UTR, comparatively
little is known about the role of the 3« UTR in virus replication.
We have previously shown that the 3« UTR plays a role in the
replication of enteroviruses since mutations predicted to
destroy stem–loop structures in this region have a deleterious
effect on virus replication (Rohll et al., 1995). Others have
found evidence of tertiary structural interactions that seem to
be essential for viability (Mirmomeni et al., 1997 ; Pilipenko et
al., 1996). Determination of the precise structures required for
virus function, however, is complicated by the fact that it is
possible to construct viable chimeras of poliovirus containing
3« UTRs from related viruses with very different primary and
predicted secondary structures. Moreover, a virus containing a
deletion encompassing most of the 3« UTR of human
rhinovirus 14 (HRV14) is viable, although it replicates poorly
(Todd & Semler, 1996).
0001-5307 # 1998 SGM
BHBF
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
+ EMSA. Standard conditions for CL EMSAs were adapted from a
previous report (Clarke et al., 1994) and performed as follows. First, 20 µg
S10 cellular extract (Barton et al., 1995), 600 ng tRNA and reaction buffer
BHBG
Primer
ACGGGCCCGCGGCCGCTAATACGACTCACTATAGGGTTAAAACAGC
GTCCGTCTAGAAGCTTACGTAAAACAGGCGTACAAAGG
CATCTGCAGCGGCCGCTTAATACGACTCACTATAGGGTTTTAGTAACCCTACCTCAG
GTCTAGAAGCTTAATATTTTTTTTTCTCCGAATTAAAGAAAAATTTACC
GCGAATTCGCGGCCGCTTAATACGACTCACTATAGGGTTTTAAATTAGAGACAATTTG
GCATCTAGAAGCTTAATATTTTCCGCACCGAACGCGG
GTCTAGAAGCTTAATATTTTTTTTTCTCCGATATAAAGAAAAATTTACC
GTCTAGAAGCTTAATATTTTTTTTTCTCCCTTATAAAGAAAAATTTACC
GTCTAGAAGCTTAATATTTTCCCTACAACAGTATGACCC
CATCTGCAGCGGCCGCTTAATACGACTCACTATAGGGTTTTAGTAATTTTTCTTTAATTCGG
GTCTAGAAGCTTAATATTTTTTTTTCTCCGAAUUAAAG
TACCATCTGCAGTTAATACGACTCACTATAGGGTAGGTTAACAATATAGACACTTAAT
GTCTAGAAGCTTAATATTATAAACTCCTACTTC
TACCATCTGCAGTTAATACGACTCACTATAGGGTAGGTTAACACTTGTTACACTTAAT
GTCTAGAAGCTTAATATTTATTACTCCTACTTC
TTCGCGAGGTTAACGTCGACTTTTTTTTTTTTTT
TGAGATCGGTCGACGGAGTGTGCCAATCGG
GCTTTGTTGCTCCCAGAGTACTC
+ T7 transcription and purification of UTR RNA. To produce
RNA as a probe for EMSAs, standard T7 reactions were performed.
Reaction mixes contained 10 mM DTT, 500 µM UTP, GTP and CTP,
1 µg linearized template, 12 µM ATP and 25 µCi [α-$#P]ATP
(3000 Ci}mM ; Amersham), T7 RNA polymerase and buffer as supplied
by the manufacturer (Promega). A MEGAshortscript kit (Ambion) was
used to produce large quantities of non-radioactive, competitor RNA.
Both radioactive and non-radioactive RNAs were loaded onto 10 %
polyacrylamide}urea gels and purified as previously described (Mellits
et al., 1990).
Table 1. Oligonucleotides used in this study
+ Construction of plasmids. Plasmids based on a version of the
vector pEMBL 18­ modified to contain a polylinker for cloning
(designated pEMBLINK18­) were constructed by amplification of the
desired UTR sequences by PCR. Positive-sense primers included a
restriction site for cloning upstream of a T7 promoter region. A
restriction endonuclease site for linearization prior to in vitro transcription
and a downstream additional restriction endonuclease site for cloning
were utilized in the negative-sense primers. The CL was amplified from
the PV3 full-length cDNA using oligonucleotides 05-0007 and 34-0060
(Table 1). The product was digested with NotI and HindIII and cloned into
the pEMBLINK18­ polylinker. This plasmid was linearized with SnaBI
before being used as a template in a T7 reaction. The 3« UTRs of PV3,
CB4 and the mutants 286 and 287 were amplified from the UTR of their
respective full-length cDNAs. The mutant ∆X sequence was amplified
from its corresponding replicon (Rohll et al., 1995). The primers used
were : 3«PV3, 34-0061 and 34-0062 ; 3«CB4, 34-0064 and 34-0063 ; 286,
34-0061 and 01-0286 ; 287, 34-0061 and 01-0287 ; and ∆X, 34-0061 and
01-0282 (Table 1). The mutant ∆Y sequence was constructed by annealing
oligonucleotides 01-0283 and 01-0284 and overhangs were filled in
using Klenow DNA polymerase ; the resultant insert was cloned into
pEMBLINK18­, as above.
The rhinovirus 3« UTR constructs were introduced into
pEMBLINK18­ using PstI and HindIII restriction sites. The wild-type
HRV14 3« UTR was amplified from the full-length cDNA using primers
34-0083 and 34-0076 (Table 1). Rhinovirus 3« mutants, mut 6 and mut 4,
were amplified from the corresponding replicons using primers 34-0083
and 34-0076 for mut 6 (loop sequence CCUGC ; see Rohll et al., 1995) and
01-0280 and 01-0281 for mut 4 (Table 1).
Full-length PV3 with mutant 3« UTRs were constructed by transferring the XbaI–SalI fragment (nt 6265 to the 3« terminus), from the
relevant poliovirus replicon into the PV3 cDNA (Rohll et al., 1995).
Sequence
Methods
05-0007
34-0060
34-0061
34-0062
34-0064
34-0063
01-0286
01-0287
01-0282
01-0283
01-0284
34-0083
34-0076
01-0280
01-0281
06-0051
34-0086
34-0003
Function or description
Evidence has also accumulated that the 3« UTR of poliovirus
binds viral proteins 3AB and 3CD, and a host protein(s) of
34–36 kDa (Harris et al., 1994 ; Todd et al., 1995). Here, we
report an interaction between the 3« UTRs of poliovirus type
3 (PV3), HRV14 and coxsackievirus B4 (CB4) with a cellular
factor(s) as detected by electrophoretic mobility shift assay
(EMSA). Mutations which reduce the binding to the cellular
factor(s) have a deleterious effect on virus replication
suggesting that the interaction plays an important role in the
virus replication cycle, possibly at the level of negative-strand
RNA synthesis.
CL plus-sense primer, includes T7 promoter and NotI site
CL minus-sense primer, includes HindIII and SnaBI sites
3«PV3 plus-sense primer, includes T7 promoter and NotI site
3«PV3 minus-sense primer, includes HindIII and SspI sites
3«CB4 plus-sense primer, includes T7 promoter and NotI site
3«CB4 minus-sense primer, includes HindIII and SspI sites
3«PV3 minus-sense primer to mutate 2 nt in kissing interaction
3«PV3 minus-sense primer to mutate 4 nt in kissing interaction
3«PV3 ∆X minus-sense primer
3«PV3 ∆Y plus-sense primer
3«PV3 ∆Y minus-sense primer
3«HRV14 plus-sense primer, includes T7 promoter and PstI site
3«HRV14 minus-sense primer, includes HindIII and SspI sites
3«HRV14 mut 4 plus-sense primer
3«HRV14 mut 4 minus-sense primer
3«-end minus-sense primer
PV3 plus-sense primer to amplify the 3« UTR
PV3 plus-sense primer to sequence the 3« UTR
K. H. Mellits and others
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
Enterovirus 3« UTR RNA binds cellular factor
(a)
(c)
(b)
(d)
Fig. 1. Predicted RNA secondary structure of T7 RNA transcripts : (a) CL of PV3 ; (b) 3« UTR of PV3 ; (c) 3« UTR of CB4 ; and
(d) 3« UTR of HRV14. Bases which are added as a result of cloning are shown in bold, and are superimposed on the wild-type
RNA secondary structure.
[final concentration, 10 mM Tris–HCl, pH 7±2, 0±1 M KCl, 3 mM
Mg(OAc) , 1 mM EDTA] were mixed in a tube and allowed to incubate
#
for 5 min at 22 °C. Competitor RNA and 0±1 ng radiolabelled RNA were
added so that the final reaction volume was 7±5 µl and samples were
placed at 30 °C for 15 min. Finally, 1 µl sterile glycerol was added and
samples were fractionated for 1±5 h on 6 % native polyacrylamide gels at
200 V and dried. Radiolabelled bands were quantified using a
PhosphorImager (Molecular Dynamics). 3« UTR EMSAs were performed
as above except that cellular extract, tRNA (calf thymus ; Boehringer
Mannheim) and the probe were titrated so that 80 % of the probe was in
a bound form. Thus, 6 µg extract and 150 ng tRNA were added for PV3,
4±6 µg extract and 120 ng tRNA for CB4, and 10 µg extract and 250 ng
tRNA for HRV14. This ensured comparable molar quantities for the
different probes for a given amount of cellular extract.
+ In vitro transcription and transfection of recombinant
viruses. In vitro transcription of full-length constructs was carried out as
described previously (Van der Werf et al., 1986). Samples of the
transcription reaction mixtures were fractionated by agarose gel
electrophoresis to analyse and quantify yields. Similar quantities of RNA
from each reaction were used, typically 2–4 µg from a reaction containing
1 µg template DNA. Tenfold serial dilutions of RNA were transfected to
obtain plaques (Evans & Minor, 1991), with the modification that the
transfection buffer was HBSS (10¬ stock contains 50 g HEPES, 80 g
NaCl, 3±7 g KCl and 1±25 g}l Na HPO \2H O, pH 7±05), plus final
#
%
#
concentrations of 1 g}l glucose and 0±5 g}l DEAE dextran.
+ Sequencing of recovered viruses. Viruses were plaque-purified
and RNA-extracted as described previously (Evans & Minor, 1991). The
RNA sequence of the 3« UTR of recovered viruses was assessed by direct
sequencing of PCR products obtained from reverse-transcribed PCRs.
The primer used for reverse transcription and negative-sense synthesis
was 06-0051, that for positive-sense synthesis was 34-0086, and that for
sequencing was 34-0003 (Table 1).
Results
The 3« UTRs of entero- and rhinovirus interact
specifically with a distinct cellular factor
Previous studies on the 3« UTR and the extreme 5« 88 nt of
the 5« UTR of poliovirus (the CL structure) have provided
evidence that both these regions interact with viral proteins
3AB and 3CD (Harris et al., 1994 ; Xiang et al., 1995). The CL
has also been shown to bind to a cellular factor of 36 kDa (p36),
which was observed to promote binding of the viral protein
3CD (Andino et al., 1993). Recently, UV cross-linking
experiments have suggested that a cellular factor(s) of a similar
size (approximately 34–36 kDa) binds to the 3« UTR and is
found at increased levels in infected cells (Roehl & Semler,
1995). Whether the 3« and 5« UTRs bind the same factor or
whether there are distinct factors of similar molecular masses is
not clear.
To study the interaction between cellular factors and the
CL of PV3 and the 3« UTRs of PV3, CB4 and HRV14, we first
cloned the UTRs together with a promoter for T7 RNA
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
BHBH
K. H. Mellits and others
polymerase into the vector pEMBLINK18­ (see Methods).
The predicted RNA secondary structures of the resultant
transcripts as predicted by the program RNAFOLD (Zucker &
Stiegler, 1981) are shown in Fig. 1. We looked for evidence of
factor(s) binding to either the 5« or 3« UTRs using EMSAs on
S10 extracts prepared from uninfected HeLa cells. We observed
that the extracts contained factors that bound to both the CL
of PV3 and the 3« UTRs of PV3, HRV14 and CB4, as shown by
a retardation of the electrophoretic mobility of the probe in the
presence of HeLa cell extract (Fig. 2 a, b and c, lanes 1, 2). The
complex formation with the CL has been examined in detail.
The complex is sensitive to the addition of protease K, SDS
and RNase A (data not shown). The addition of 33-, 100- and
333-fold molar excess of unlabelled tRNA does not disrupt
complex formation, whereas the addition of corresponding
molar excesses of unlabelled CL significantly reduces the
amount of radiolabelled probe in the complex (Fig. 2 a, lanes
3–8). The addition of a similar molar excess of PV3, CB4 or
HRV14 3« UTRs does not compete for radiolabelled CL in the
complex (Fig. 2 a, lanes 9–14 ; and data not shown).
We then examined the complexes formed with the
radiolabelled 3« UTR probes of CB4, HRV14 and PV3.
Retarded complex(s) were detected (Fig. 2 b, lanes 1, 2 ; c, lanes
1–3 ; and data not shown) that, like those formed with the CL,
were sensitive to addition of protease K, SDS and RNase A.
The CB4 3« UTR probe forms several complexes of which the
slowest migrating is most prevalent and specific as it is not
disrupted by 10-, 33-, 100- or 333-fold molar excess of tRNA
(Fig. 2 b, lanes 3–6) or 10-, 33-, 100- or 333-fold molar excess
of CL (Fig. 2 b, lanes 11–14), but is disrupted by addition of
non-radiolabelled CB4 RNA 3« UTR (Fig. 2 b, lanes 7–10). The
HRV14 3« UTR probe forms two distinct complexes with the
cellular extract ; complex b is of higher affinity and is faster
migrating and complex a probably represents a low-affinity
binding complex, since free probe can be first competed from
complex b and then from complex a (Fig. 2 c ; and data not
shown). Complex b formation could not be dissociated by
excess tRNA or excess CL RNA, but was dissociated by
homologous RNA (Fig. 2 c). Similar results were obtained using
the 3« UTR of PV3 as a probe. These results suggest that HeLa
cells contain a cellular factor(s) that specifically recognizes the
3« UTRs that is separate and distinct from the factor(s) which
bind to the CL.
Mutations in the 3« UTRs of entero- and rhinovirus
affect host factor binding
We have previously reported the construction of a
PV3}HRV14 chimera which possessed the body of the PV3
and the 3« UTR of HRV14. This chimera is viable and its
replication is similar to that of wild-type poliovirus (Rohll et al.,
1995). This indicates that the 3« UTRs of PV3 and HRV14 are
functionally interchangeable and suggests that they interact
with the same cellular factor. To investigate this, competition
BHBI
experiments were performed that were similar to those
described above. We demonstrated that non-labelled poliovirus 3« UTR competes equally as well as HRV14 3« UTR for
formation of the HRV14 complex, indicating that they do
indeed interact with a common factor (Fig. 3, compare lanes
4–7 with lanes 8–11). The relevance of this interaction to virus
replication was investigated by studying a series of mutants.
Mutations introduced into the HRV14 sequence were designed
to better define the RNA structure required for factor binding.
Fig. 4 (a, b) illustrates two mutants, mut 4 and mut 6, which
contain perturbations in the stem and hairpin loop of the 3«
UTR, respectively. Structure modelling suggests that, although
mut 4 has an altered primary sequence, its secondary structure
remains intact. However, mut 6, which was designed to replace
sequences in the hairpin loop, is predicted by modelling to
have a rearranged RNA secondary structure (Fig. 4 c). In our
previous study, both of these mutations were shown to have
dramatically reduced replication potential in a replicon version
of the chimera (Rohll et al., 1995). We therefore analysed these
replication deficient mutants for their ability to compete for
binding with the host cell factor(s) in EMSAs, and quantified
the results. As illustrated in Fig. 4 (d), RNAs constructed from
these mutants had a reduced ability to compete with wild-type
probe for the cellular factor suggesting that their affinity for
the factor was significantly reduced. Greater than 3-fold of the
mutated RNA was required to displace 50 % of the bound
radiolabelled probe compared to the wild-type RNA.
We next examined the interaction of the cellular factor with
the PV3 3« UTR by analysing mutants in which one or other
of the stem–loops of this double stem–loop structure (Fig.
5 a, b) had been deleted (mutants ∆Y and ∆X). These mutations
severely decreased the replication capacity of a PV3 replicon
(Rohll et al., 1995). To determine whether these deletions
affected the interaction with the cellular factor, the RNAs
derived from these mutants were used as competitors in the
EMSA. As can be seen from Fig. 5 (c), the RNAs were much less
able to compete for the binding of the cellular factor than wildtype PV3 3« UTR. Approximately 10-fold more mutant RNA
was required for a 50 % displacement of the labelled probe,
indicating that the mutants had reduced affinity for the host
cell factor.
It has been reported by others that mutations which affect
tertiary interactions (‘ kissing ’ mutants) in the 3« UTR of
poliovirus destroy virus viability (Mirmomeni et al., 1997 ;
Pilipenko et al., 1996). We, therefore, constructed similar
mutations aimed at disrupting the tertiary interaction, to assess
whether the non-viability correlated with a decreased affinity
for the cellular factor in the EMSAs (Fig. 6 a, b, c). We
reconstructed a mutant described by Pilipenko et al. (1996)
which disrupts tertiary or kissing interactions (mutant 286)
(Fig. 6 b) as well as a more drastic mutation further destroying
the kissing interaction (mutant 287) (Fig. 6 c). Quantification of
the EMSAs shows that non-labelled RNAs prepared from
these mutants were again less able than wild-type RNA to
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
Enterovirus 3« UTR RNA binds cellular factor
(a)
(b)
Fig. 3. EMSA comparing the ability of 3« UTRs of HRV14 and PV3 to
compete. HRV14 3« UTR incubated alone (lane 1), in the presence of
HeLa cell S10 extract (lane 2) or in the presence of HeLa S10 extract and
333-fold molar excess, relative to probe, of tRNA (lane 3), or 10-, 33-,
100- and 333-fold molar excess of HRV14 3« UTR (lanes 4–7) and PV3
3« UTR (lanes 8–11).
compete, suggesting that these mutations also cause a
reduction in affinity for the cellular factor (Fig. 6 d).
Taken together, the experiments discussed above suggest
that mutations in the 3« UTR that alter the RNA secondary and
tertiary structure affect the affinity for the cellular factor in the
EMSAs and decrease replication potential for the virus
replicons.
(c)
Mutations which alter binding to the cellular factor
also affect plaque viability
Fig. 2. EMSAs comparing the ability of 5« and 3« UTRs to compete for
each other. (a) Radiolabelled CL incubated alone (lane 1), in the presence
of HeLa cell S10 extract (lane 2), or in the presence of HeLa S10 extract
and 33-, 100- and 333-fold molar excess, relative to probe, of tRNA
(lanes 3–5), CL (lanes 6–8), and the 3« UTRs of PV3 and CB4 (lanes
9–11 and 12–14, respectively). (b) Radiolabelled CB4 3« UTR incubated
alone (lane 1), in the presence of HeLa cell S10 extract (lane 2), or in the
presence of HeLa S10 extract and 10-, 33-, 100- and 333-fold molar
excess, relative to probe, of tRNA (lanes 3–6), CB4 3« UTR (lanes 7–10)
and CL (lanes 11–14). (c) Radiolabelled HRV14 incubated alone (lane 1),
in the presence of HeLa cell S10 extract (lanes 2 and 3) or in the
presence of HeLa S10 extract and 10-, 33-, 100- and 333-fold molar
To assess the effects of 3« UTR mutations on virus viability,
the debilitated mutants ∆Y and ∆X of poliovirus and mut 6 of
rhinovirus were reconstructed into a full-length infectious
clone of PV3. Transfection of RNA from the mutants ∆Y and
∆X produced virus that caused pinprick-size plaques on HeLa
cells indicating that these mutations, consistent with their
effects on the replicons, had a deleterious effect on virus
replication (Fig. 5, compare d with e and f ). Similarly, mut 6,
which caused a perturbation of the loop of HRV14 3« UTR, had
a drastic effect on virus viability. The infectivity of the RNA
was much reduced compared with wild-type T7 RNA with
plaque titre}µg of RNA being approximately 10−$-fold lower,
suggesting that reversion mutations had occurred. In this case,
however, the plaques were almost wild-type size. Two
excess, relative to probe, of tRNA (lanes 4–7), HRV14 3« UTR (lanes
8–11) and CL (lanes 12–15).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
BHBJ
K. H. Mellits and others
(a)
(b)
(e)
(c)
(d)
Fig. 4. EMSA comparing the ability of the mutants, mut 4 and mut 6, to
compete for wild-type HRV14 3« UTR complex. Stem mutations mut 4
(a) and mut 6 (b) are shown superimposed on the wild-type RNA
secondary structure. (c) Predicted RNA secondary structure of mut 6.
(d) Quantification of EMSA ; the per cent bound is calculated as the
c.p.m. remaining in the specific complex divided by the total counts.
Values are normalized to control, no competitor, set at 100 % bound.
U, tRNA ; +, HRV14 ; ^, 6A ; D, mut 4. (e) Location of the two
revertant sequences is indicated.
independent plaques from the transfection experiment were
therefore isolated and sequenced. Both recovered viruses
displayed single U ! C transitions in the apical stem of the
HRV14 structure and, in both cases, the predicted effect of
reversions is to stabilize the RNA, forming G–C rather than
G–U pairs. This has the overall effect of reforming the wildtype RNA structure, albeit using different sequences (Fig. 4 e).
Discussion
The objectives of this study were to obtain further
information on the role of the 3« UTR in the replication of
entero- and rhinoviruses. In particular, we wished to determine
whether cellular factors known to bind the CL were distinct
from those which bind to the 3« UTRs of these viruses and, if
so, whether they play a role in virus replication. Proteins
binding to the terminal 5« and 3« regions are likely to be
involved in positive- and negative-strand RNA synthesis,
respectively, and the viral polymerase precursor, 3CD, along
with the viral protein 3AB have been shown to complex with
both regions. The data presented here suggest strongly that
the factor(s) which binds the 3« UTR is distinct from those that
BHCA
bind the CL. This was indicated by EMSA competition
reactions (Fig. 2) which established that excess 3« UTR RNA
was unable to compete for binding to cellular the factor(s)
bound to CL ; reciprocally, excess CL did not compete for
factors bound to radiolabelled 3« UTR probes.
The factors that bind to CL have been characterized
previously in some detail. The eukaryotic elongation factor EF1α was identified by microsequencing after being isolated from
a complex with the CL (Harris et al., 1994). Other studies have
identified two closely related cellular poly(rC) binding proteins,
PCBP1 and PCBP2, which were originally identified as binding
to stem–loop IV of poliovirus 5« UTR, as also being capable of
binding the CL (Blyn et al., 1995 ; Gamarnik & Andino, 1997).
These proteins also play a role in regulation of translation
during poliovirus translation (Blyn et al., 1997).
UV cross-linking studies have previously identified a
presumed cellular factor of approximately 34–36 kDa that
binds to the 3« UTR of rhinovirus and poliovirus (Todd et al.,
1995). Competition experiments suggest that the same factor
binds the 3« UTRs of both rhinovirus and poliovirus. Using
identical extracts to those used in our EMSA, we also detected
complexes by UV cross-linking with the 3« UTRs of any of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
Enterovirus 3« UTR RNA binds cellular factor
(a)
(d)
(c)
(b)
(e)
(f)
Fig. 5. Phenotype of the ∆Y and ∆X mutations of PV3 3« UTR. Predicted RNA secondary structure of (a) ∆Y and (b) ∆X.
(c) Quantification of EMSA comparing the ability of the mutants, ∆Y and ∆X, to compete for wild-type PV3 3« UTR complex.
U, tRNA ; +, PV3 ; ^, ∆X ; D, ∆Y. Plaque phenotype of T7 produced virus of (d) wild-type PV3, (e) ∆Y and (f ) ∆X.
PV3, CB4 and HRV14, suggesting that these RNAs all bind to
the same factor. We additionally can detect complexes of 60
and 70 kDa, which also bind to PV3, CB4 and HRV14 3« UTRs
(unpublished results). It is intriguing that 3« UTRs of apparently
such different structures and sequences can bind the same
factor and substitute for each other in chimeric genomes, given
that mutations in either of these can adversely affect cellular
factor binding and virus viability.
Our experiments additionally suggest that the binding of
cellular factors to the 3« UTR is essential for virus replication.
This conclusion is based on an analysis of mutations engineered
in both the poliovirus and rhinovirus 3« UTRs. We observed
that mutations which debilitated replicative capacity from a
poliovirus replicon or a poliovirus}rhinovirus recombinant
replicon, also severely affected plaque phenotype when built
into the corresponding full-length infectious cDNA clone
(Rohll et al., 1995) (Fig. 5 d, e, f). When used as competitor
RNAs, mutant 3« UTRs were less effective than the wild-type
in competing for binding with radiolabelled 3« UTR probe (Fig.
4 d ; Fig. 5 c). This suggests that structures which retain the
capacity to bind effectively to the cellular factor are important
for virus viability and that the mutant RNAs, which had a
lower affinity for the cellular factor than wild-type, had
impaired virus replication. This was a consistent finding among
mutants previously described from our laboratory and known
to debilitate virus replication, and among kissing mutants
described by others (Pilipenko et al., 1996) (Fig. 6) that alter
regions of the structure believed to be important for tertiary
RNA interactions. Thus, it is likely that the 3« secondary and
tertiary structure is required for efficient binding to the cellular
factor. Our analysis of one of the HRV14 mutants (mut 6)
showed that plaques could be recovered at approximately
10−$-fold of the wild-type efficiency. Analysis of two of these
plaques showed reversion mutations had occurred in the apical
stem of the HRV14 3« UTR. Predicted RNA folds on the
revertant sequence suggested structures in which the overall
stem–loop architecture had been restored (Fig. 4 e). Our results
suggest that a minimal stem–loop is required for efficient
entero- and rhinovirus replication. These results contrast with
those of Todd & Semler (1996), who suggest that the 3«-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
BHCB
K. H. Mellits and others
(a)
(b)
(c)
(d)
Fig. 6. EMSA comparing the ability of mutants 286 and 287 to compete
with wild-type PV3 for 3« UTR complex. (a) Proposed tertiary
interactions between stem–loop X and Y of wild-type PV3 3« UTR.
Mutations disrupting tertiary interactions, (b) 286 and (c) 287 are
shown superimposed on the wild-type PV3 RNA secondary structure.
(d) Quantification of EMSAs. U, tRNA ; +, PV3 ; ^, 286 ; D, 287.
terminal GTTTTAT(An) is the minimal sequence required for
negative-strand synthesis.
The fact that the 5« and 3« UTRs bind similar viral proteins
but apparently different cellular factors suggests that the
cellular factors may modulate the activity of the viral
polymerase. This could play a role for example in the regulation
of positive versus negative RNA synthesis during virus
replication. The identity of the 3« binding cellular factor and its
precise role in virus replication is currently under investigation.
We acknowledge the excellent technical assistance of Moy Robson,
Daniel Bailey, Yasmin Chaudhry, Emma Boulton and Thomas Lamb. This
project was funded by the Medical Research Council programme grant
no. G9006199.
BHCC
References
Andino, R., Rieckhof, G. E., Achacoso, P. L. & Baltimore, D. (1993).
Poliovirus RNA synthesis utilizes an RNP complex formed around the 5«end of viral RNA. EMBO Journal 12, 3587–3598.
Barton, D. J., Black, E. P. & Flanegan, J. B. (1995). Complete
replication of poliovirus in vitro : preinitiation RNA replication complexes
require soluble cellular factors for the synthesis of VPg-linked RNA.
Journal of Virology 69, 5516–5527.
Blyn, L. B., Chen, R. Y., Semler, B. L. & Ehrenfeld, E. (1995). Host-cell
proteins binding to domain-IV of the 5« noncoding region of poliovirus
RNA. Journal of Virology 69, 4381–4389.
Blyn, L. B., Towner, J. S., Semler, B. L. & Ehrenfeld, E. (1997).
Requirement of Poly(rC) binding protein 2 for translation of poliovirus
RNA. Journal of Virology 71, 6243–6246.
Clarke, P. A., Peery, T., Ma, Y. L. & Mathews, M. B. (1994). Structural
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
Enterovirus 3« UTR RNA binds cellular factor
features of adenovirus-2 virus-associated RNA required for binding to
the protein-kinase DAI. Nucleic Acids Research 22, 4364–4374.
Evans, D. J. & Minor, P. D. (1991). Growth and characterization of
poliovirus antigen chimeras. Practical Molecular Virology 8, 257–263.
Gamarnik, A. V. & Andino, R. (1997). Two functional complexes formed
by KH domain containing proteins with the 5« noncoding region of
poliovirus RNA. RNA 3, 882–892.
Harris, K. S., Xiang, W., Alexander, L., Lane, W. S., Paul, A. V. &
Wimmer, E. (1994). Interaction of poliovirus polypeptide 3CDpro with
the 5« and 3« termini of the poliovirus genome. Identification of viral and
cellular cofactors needed for efficient binding. Journal of Biological
Chemistry 269, 27004–27014.
Jackson, R. J. (1988). RNA translation. Picornaviruses break the rules.
Nature 334, 292–293.
Jackson, R. J. & Kaminski, A. (1995). Internal initiation of translation in
Eukaryotes – the picornavirus paradigm and beyond. RNA 1, 985–1000.
poliovirus cDNA and determination of the complete nucleotide sequence
of the viral genome. Proceedings of the National Academy of Sciences, USA
78, 4887–4891.
Roehl, H. H. & Semler, B. L. (1995). Poliovirus infection enhances the
formation of 2 ribonucleoprotein complexes at the 3« end of viral
negative-strand RNA. Journal of Virology 69, 2954–2961.
Rohll, J. B., Moon, D. H., Evans, D. J. & Almond, J. W. (1995). The 3«untranslated region of picornavirus RNA – features required for efficient
genome replication. Journal of Virology 69, 7835–7844.
Stanway, G., Cann, A. J., Hauptmann, R., Hughes, P., Clarke, L. D.,
Mountford, R. C., Minor, P. D., Schild, G. C. & Almond, J. W. (1983).
Kitamura, N., Semler, B. L., Rothberg, P. G., Larsen, G. R., Adler, C. J.,
Dorner, A. J., Emini, E. A., Hanecak, R., Lee, J. L., Van der Werf, S.,
Anderson, C. W. & Wimmer, E. (1981). Primary structure, gene
The nucleotide sequence of poliovirus type 3 leon 12 a1b : comparison
with poliovirus type 1. Nucleic Acids Research 11, 5629–5643.
Todd, S. & Semler, B. L. (1996). Structure–infectivity analysis of the
human rhinovirus genomic RNA 3«-noncoding region. Nucleic Acids
Research 24, 2133–2142.
Todd, S., Nguyen, J. H. C. & Semler, B. L. (1995). RNA-protein
interactions directed by the 3« end of human rhinovirus genomic RNA.
Journal of Virology 69, 3605–3614.
organisation and polypeptide expression of poliovirus RNA. Nature 291,
547–553.
Van der Werf, S., Bradley, J., Wimmer, E., Studier, F. W. & Dunn, J. J.
(1986). Synthesis of infectious poliovirus RNA by purified T7 RNA
Mellits, K. H., Peery, T., Manche, L., Robertson, H. D. & Mathews,
M. B. (1990). Removal of double-stranded contaminants from RNA
polymerase. Proceedings of the National Academy of Sciences, USA 83,
2330–2334.
Wimmer, E., Hellen, C. U. T. & Cao, X. M. (1993). Genetics of poliovirus.
Annual Review of Genetics 27, 353–436.
Xiang, W., Harris, K. S., Alexander, L. & Wimmer, E. (1995). Interaction
between the 5«-terminal cloverleaf and 3AB}3CDpro of poliovirus is
essential for RNA replication. Journal of Virology 69, 3658–3667.
Zucker, M. & Stiegler, P. (1981). Optimal computer folding of large
RNA sequences using thermodynamics and auxiliary information. Nucleic
Acids Research 9, 133–148.
transcripts – synthesis of adenovirus VA RNA I from a T7 vector. Nucleic
Acids Research 18, 5401–5406.
Mirmomeni, M. H., Hughes, P. J. & Stanway, G. (1997). An RNA
tertiary structure in the 3« untranslated region of enteroviruses is
necessary for efficient replication. Journal of Virology 71, 2363–2370.
Pilipenko, E. V., Poperechny, K. V., Maslova, S. V., Melchers, W. J. G.,
Bruins Slot, H. J. & Agol, V. I. (1996). Cis-acting, oriR, involved in the
initiation of (®)strand poliovirus RNA : a quasi-globular multi-domain
RNA structure maintained by tertiary (‘ kissing ’) interactions. EMBO
Journal 15, 5428–5436.
Racaniello, V. R. & Baltimore, D. (1981). Molecular cloning of
Received 6 November 1997 ; Accepted 20 March 1998
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 02:51:36
BHCD