882-883
©1993 Oxford University Press
Nucleic Acids Research, 1994, Vol. 22, No. 5
A method for locating O6-methylguanine residues in DNA
Chia-Woan Wong and Benjamin F.L.Li*
Chemical Carcinogenesis Laboratory, Institute of Molecular and Cell Biology, National University of
Singapore, Kent Ridge, Singapore 0511, Singapore
Received January 5, 1994; Accepted January 28, 1994
The formation of C^-alkylguanine residues in DNA is a crucial
event in the initiation of carcinogenesis by SN1 type alkylating
agents (1). A method that enables the precise location of
C^-alkylguanine residues in DNA is, therefore, an important
tool to study its preferential formation or repair in the background
of diversed DNA sequences, i.e. genomic DNA. Although the
sequence specific formation of this lesion in DNA has been
studied using oligonucleotides containing radio-labelled guanine
residues (2), this approach is limited to short sequences. Here
we report a method for locating O6-methylguanine (m6G)
residues in DNA by chemical sequencing. If this methodology
could be used in conjunction with ligation mediated PCR (see
genomic sequencing of 5-methylcytosine, refs 3 and 4), it might
have the potential to locate the positions of m6G residues in DNA
fragments (of interest) obtained from cells after exposure to
alkylating agents. This method was developed from our (5) and
reported (6) observations that the lesion in DNA is susceptible
to acidic depurination. The procedure for identifying this lesion,
on the sequencing ladder, as an acid labile band during chemical
sequencing is described.
C-
1GGCT
A
2 +G G C T
A
3GGCT
A
4GGCT
u
LJ.
!
LI
12 1 2 1 2 1
I
U 1 1 ! LY V
3 4 3 4 3 4 3 4 3 4 3 4
MATERIALS AND METHODS
C)g silica and spin filter-cartridge (1000 MW cut-off) were
obtained from Millipore (USA). Dimethylsulphate (DMS), formic
acid, hydroxylamine hydrochloride (NH2OH.HC1), piperidine,
potassium permanganate (KMnO4) and triethylamine were from
Aldrich (USA). 7-32ATP was from Amersham (UK). The
procedure for Maxam and Gilbert chemical sequencing (7) was
followed but with some modifications. Oligonucleotides (0.01
O.D. at 260 nm) containing m6G were labelled with 7-32ATP
using T4 polynucleotide kinase and gel purified as previously
described (8). Labelled oligonucleotides (aliquoted to 20000
cpm/condition and dried) were cleaved with freshly prepared
chemicals at 25°C as follows;
1. A + G, 30 fi] of 66% formic acid for 45 mm.
2. G, 30 >tl of 0.1 M DMS in 1 M KH2PO4 (pH 3.75) for 10 min.
3. C, 30 y\ of 4 M NH2OH.HC1 (neutralised to pH 6.0 with triethylamine)
for 20 min,
4. T, 30 fil of 0.4 mM KMnO,, in 1 M KH2PO4 (pH 3.75) for 8 min.
After the required incubation time, water (250 /xl) was added
to each sample. The mixture was transferred to a filter-cartridge
containing Qg silica (10 mg). The suspension was vortexed for
1 min to allow for the binding of the oligonucleotides to the C|g
silica. The silica was then pelleted onto the filter after removal
of the aqueous phase by spinning the filter-cartridge at 6000 rpm
* To whom correspondence should be addressed
Figure 1. Autoradiographs of localisation of O'-methylguanine (m6G) residues
in oligonucleotides by chemical sequencing. 5' y^P labelled oligonucleotides are;
1 = 5' TATACGTATA, 2 = 5' TATACm6GTATA. 3 = 5' CCCGTTTAAATATACGTATACCCGGGTACC and 4 =• 5' CCCGTTTAAATATACm6GTATACCCGGGTACC. Lanes labelled A + G. G. C and T in panel a and
c represent the specific chemical cleavages of the corresponding base residues
as described in Materials and Methods for the 5' 732P labelled ohgonucleotides
1,2,3 and 4 The arrowed intense band represents m6G. Panels b and d represent
the comparison of the normal and m6G containing ohgonucleotides towards the
cleavage by various concentrations of formic acid and diphenylamine (made to
10 mg/ml using various formic acid solutions); I = 66% formic acid. II = 66%
formic acid with diphenylamine. Ill = 33% formic acid. IV = 33% formic acid
with diphenylamine and V = 5% formic acid. After treatment with 30 /il of the
above solutions at 25°C for 25 min (note that the time for A + G cleavage using
66% formic acid in panels a and c is 45 min). the samples were processed using
C| 8 silica and analysed as described in Materials and Methods The autoradiographs were obtained after overnight exposure at -80"C.
Nucleic Acids Research, 1994, Vol. 22, No. 5 883
Figure 2. The effect of E.coli. Ada protein (ref. 11) on the chemical cleavage
of O*-methylguanine (rr>6G) containing oligonucleotides by formic acid. 5' 7 P
labelled oligonucleotides are; 5 = 5' CCCGTTTAAATATACGlTATACGCG^AGCTCGCG (G}_ and G^ represent replacements by m6G found in 6 and
7), 6 = 5' CCCGTTTAAATATACm6GTATACGCGAGCTCGCG, 7 = 5'
CCCGTTTAAATATACGTATACGCm6GAGCTCGCG. The labelled lanes
represent samples after the following treatments; a. 66% formic acid for 25 min
at 25°C and processed as described in Materials and Methods, b. 1 gM of
oligonucleotides 5, 6 and 7 were treated with 5 QM of Ada protein (ref. 11) for
10 min at 37°C before heat inactivation at 80°C (for 5 min). The samples were
then adjusted to 66% of formic acid (by addition of neat formic acid) and processed
as described in a. c. Salmon sperm DNA (0.1 O.D. at 260 nm) was included
in the oligonucleotides before the addition of Ada protein as described in b. d.
Complementary oligonucleotides (3 gM) were annealled to substrates 5, 6 and
7 before the addition of Ada protein as described in b. The arrowed band represents
m6G. The autoradiographs were obtained after overnight exposure at -80°C.
(Eppendorf centrifuge, Germany) for 5 min. The Cig silica was
further washed with 2 x250 /xl of water (by spinning as above).
150 /tl of prewarmed (50°C) solution of piperidine/water/acetonitrile (10:45:45, v/v) was added to the semi-dried silica. After
vortexing for 30 sec, the cartridge was incubated at 50°C for
5 min before spun at 8000 rpm for 5 min. The filtrate was
transferred to a 1.5 ml screw-capped eppendorf and heated at
90°C for 30 min 03-elimination). The heat treated filtrate
(containing the cleaved oligonucleotide) was dried under vaccum
and re-dried after resuspension in water (50 /tl) before analysed
on a 20% polyacrylamide urea sequencing gel (using 10000
cpm/lane). The recovery of the labelled oligonucleotides using
this C| 8 silica immobilisation protocol is usually ^90%.
aromaticity of the purine ring. Therefore, the acid catalysed
depurination of m6G may be a result of the preferential
protonation, i.e. increase in basicity, or possible change in the
aromaticity, i.e. the enol isomer, of the residue. This is supported
by subsequent experimental data showing that the intensities of
the m6G bands are inversely proportional to the concentrations
of formic acid used (see the decrease in intensities of the arrowed
m6G bands in Figure 1 panels b and d) and the addition of
nucleophile, i.e. diphenylamine for nucleophilic substitution at
the glycosidic bond, does not seem to increase the cleavage.
Nevertheless, these data also show that the 66% formic acid
treatment (25 min at 25°C) would be an optimal condition for
the selective cleavage of the m6G residues in oligonucleotides
2 and 4 since these residues appear as distinctively intense bands
(see condition I in panel 2b and d) as compared to G (see
oligonucleotides 1 and 3) on the sequencing ladder.
If further confirmation of the above findings are required, the
repair enzyme O6-methylguanine-DNA methyltransferase
(MGMT), which specifically restores m6G to G (10), should be
the useful tool. One would expect to see the disappearance of
the acid labile band, i.e. due to the presence of m6G, when the
DNA substrate was treated with MGMT before the acid
treatment. It is apparent in Figure 2 that the acid labile bands
are efficiently removed by the Ada protein (ref 11) when the
substrates are in double stranded form (see arrowed bands in d
lanes), whereas less efficient removal were observed for single
stranded substrates, especially, for oligonucleotide 6 which
contains the m6G residue at the centre (see b lanes for the
comparison of oligonucleotides 6 and 7).
Although this methodology has the potential to locate m6G
residues in DNA, its application to study sequence specific
formation of m6G in DNA by alkylating agents has two
complications: 1. the presence of other major lesions that are
susceptible towards spontaneous depurination, i.e. N7-methylguanine and N3-methyladenine, and 2. m6G residues are formed
at low level. It would be possible to overcome these problems,
for example, 1. the other major lesions in the DNA can be
removed by repair synthesis using bacterial cell extracts, in which
MGMT activities were depleted by preincubation with m6G
oligonucleotide (11), obtained from ada+ strain alter adaptive
response (10) and 2. the use of antibodies towards m6G for the
enrichment of m6G containing DNA by immunoprecipitation.
ACKNOWLEDGEMENTS
We thank Dr Edward Manser for reading the manuscript. This
research is supported by the National University of Singapore.
RESULTS
It is apparent in Figure la (for 5' TATACGTATA = 1 and 5'
TATACm6GTATA = 2) and lc (for 5' CCCGTTTAAATATACGTATACCCGGGTACC = 3 and 5' CCCGTTTAAATATACm6GTATACCCGGGTACC = 4) that the 4 oligonucleotides were cleaved as predicted by the reagents for A + G, G,
C and T residues. However, the bands correspond to the m6G
residues in the A + G tract, which represents acid catalysed
depurination, are more intense (see arrowed bands). Furthermore,
the m6G residues were also shown to be reactive towards DMS,
i.e. formation of N7-methylguanine derivative (see the
corresponding bands in the G tracts). These results agree with
the observation that alkylation of purine increases its stacking
property (9), which may arise from the increase in basicity or
REFERENCES
1
2
3.
4.
5.
6.
7.
8.
9.
Pegg.A E. (1984) Cancer Invest. 2. 223-231.
Richardson.F.C, el al. (1989) /. Biol. Chem. 264, 838-841.
Rubin.C.M. and Schmid.C.W. (1980) Nucleic Acids Res. 8, 4613-4619.
Mueller.P.R. and Wold.B. (1989) Science 246. 780-786.
Li.B.F.L and Swarm.P.F. (1989) Biochemistry 28, 5779-5786.
Voigt.J.M., et al. (1989) J. Biol. Chem. 264, 5172-5176.
Maxam.A.M. and Gilbert.W. (1980) Methods Enzymol. 65, 499-560.
Wong.C.W., Tan.N.W. and Li.B.F.L. (1992) J. Mol. Biol. 228, 1137- 1146.
Saenger.W. (1984) Principles of Nucleic Acid Structure. Springer-Verelag.
New York, chapter 6.
10. Lindahl.T., et al. (1988) Annu. Rev. Biochem. 57, 133-157.
11. Liem.L.K., et al. (1993) J. Mol Biol. 231, 950-959.