Carcinogenesis vol.26 no.4 pp.779--784, 2005
doi:10.1093/carcin/bgi019
Decreased n-6/n-3 fatty acid ratio reduces the invasive potential of human lung
cancer cells by downregulation of cell adhesion/invasion-related genes
Shu-Hua Xia, Jingdong Wang and Jing X.Kang*
Departments of Medicine, Massachusetts General Hospital and
Harvard Medical School, Boston, MA 02114, USA
To whom correspondence should be addressed. Tel: þ1 617 726 8509;
Fax: þ1 617 726 6144;
Email: [email protected]
Recent studies have shown opposing effects of n-6 and n-3
fatty acids on the development of cancer and suggest a role
for the ratio of n-6 to n-3 fatty acids in the control of
cancer. However, whether an alteration in the n-6/n-3
fatty acid ratio of cancer cells affects their invasive potential has not been well investigated. We recently developed a
genetic approach to modify the n-6/n-3 ratio by expression
of the Caenorhabditis elegans fat-1 gene encoding an n-3
desaturase that converts n-6 to n-3 fatty acids in mammalian cells. The objective of this study was to examine the
effect of alteration in the n-6/n-3 fatty acid ratio on the
invasive potential of human lung cancer A549 cells.
Adenovirus-mediated gene transfer of the n-3 desaturase
resulted in a marked reduction of the n-6/n-3 fatty acid
ratio, particularly the ratio of arachidonic acid to eicosapentaenic acid. Cell adhesion assay showed that the cells
expressing fat-1 gene had a delayed adhesion and retarded
colonization. Matrigel assay for invasion potential indicated a 2-fold reduction of cell migration in the fat-1 transgenic cells when compared with the control cells. An
increased apoptosis was also observed in the fat-1 transgenic cells. Microarray and quantitative polymerase chain
reaction revealed a downregulation of several adhesion/
invasion-related genes (MMP-1, integrin-a2 and nm23-H4)
in the fat-1 transgenic cells. These results demonstrate that
a decreased n-6/n-3 fatty acid ratio reduces the invasion
potential of human lung cancer cells by probably downregulating the cell adhesion/invasion-related molecules,
suggesting a role for the ratio of n-6 to n-3 fatty acids in
the prevention and treatment of cancer.
Introduction
The ability of malignant tumors to metastasize is largely
responsible for their lethality. Patients with metastatic disease
from a solid tumor are almost invariably incurable. Thus,
metastasis is a principal factor that affects the survival time
and prognosis of patients with cancer, and the control of
metastasis remains to be a major clinical challenge for the
Abbreviations: AA, arachidonic acid; Ad, adenovirus; Ad.GFP, Ad carrying
GFP gene; Ad.GFP-fat-1, Ad carrying fat-1 and GFP genes; DHA,
docosahexaenoic acid; EPA, eicosapentaenic acid; GFP, green fluorescent
protein; PUFAs, polyunsaturated fatty acids; TUNEL, terminal
deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick endlabeling.
Carcinogenesis vol.26 no.4 # Oxford University Press 2005; all rights reserved.
treatment of cancer. Development of safe and effective
means to prevent or limit tumor metastasis is urgently needed.
Emerging evidence from epidemiological and experimental
studies suggests a relationship between dietary fat and the risk
of cancer (1--8). Specifically, it has been shown that a high
dietary intake of omega-6 (n-6) polyunsaturated fatty acids
(PUFAs), such as linoleic acid (18:2n-6), is associated with a
high risk for cancer, whereas high intake of omega-3 (n-3)
PUFAs from fish oils, such as eicosapentaenic acid (EPA)
(20:5n-3) and docosahexaenoic acid (DHA) (22:6n-3),
decreases the risk for cancers of breast, colon and possibly
prostate (3--8). Experimental data show that the n-6 fatty acids
stimulate carcinogenesis, tumor growth and metastasis,
whereas the n-3 fatty acids exert suppressive effects (3--13).
These findings suggest that the ratio of n-6 to n-3 fatty acids
may be an important factor in controlling the development of
tumors. Although previous studies have examined the effect of
supplementation with n-3 fatty acids on tumor formation, cell
proliferation and apoptosis, less information is available on the
effect of these fatty acids on the tumor invasive potential and
metastasis. A role for the n-6/n-3 fatty acid ratio in tumor
invasion and metastasis has not been evaluated in wellqualified experimental models.
We recently developed a genetic approach to modify the
n-6/n-3 ratio by expression of the Caenorhabditis elegans
fat-1 gene encoding an n-3 desaturase that converts n-6 to
n-3 fatty acids in mammalian cells (14). Human cells normally
cannot produce n-3 from n-6 fatty acids due to a lack of the
fat-1 gene, and must rely on exogenous supply. Our previous
studies have shown that the adenovirus-mediated gene transfer
of the C.elegans n-3 desaturase can quickly and dramatically
modify the fatty acid composition (n-6/n-3), without the need
for supplementation with exogenous fatty acids (14). In comparison with supplementation, this genetic approach is more
effective in balancing the n-6/n-3 fatty acid ratio because it not
only elevates the cellular concentrations of n-3 fatty acids, but
also reduces the levels of endogenous n-6 fatty acids (as a
result of the direct conversion of n-6 to n-3 fatty acids).
Therefore, this can serve as a new model for the elucidation
of the biological effects of n-3 as well as the n-6/n-3 fatty acid
ratio. The objective of this study was to examine the effect of
decreased/balanced n-6/n-3 fatty acid ratio on the invasive
potential of human lung cancer A549 cells.
Materials and methods
Cell culture and adenovirus-mediated gene transfer
Human lung cancer cell line A549 was grown in Dulbecco’s modified
medium/F-12 supplemented with 5% fetal bovine serum (FBS) and penicillin/
streptomycin. The recombinant adenovirus (Ad) carrying the fat-1 cDNA was
constructed as described previously (14). Cells were infected with Ad for
experiments when they were grown to ~70% confluence by adding virus
particles to the culture medium (3--5 108 particles/ml) (in the presence of
5% FBS). Initially, optimal viral concentration was determined by using
Ad.GFP (control vector) to achieve an optimal balance of high gene expression
779
S.-H.Xia, J.Wang and J.X.Kang
and low viral titer to minimize cytotoxicity. Infection efficiency was determined by cell counting using a microscope under both white light and fluorescent
light [Infection efficiency ¼ number of green cells (under fluorescence)/cell
number (under white light) 100%]. In this study, only those cells with an
infection efficiency of 490% were used for the further analysis.
Detection of fat-1 expression by immunofluorescence staining
Three days after infection, the expression of fat-1 gene in A549 cells was
detected by a standard protocol of immunofluorescence. Briefly, the cells were
cultured on sterilized glass coverslips to ~75% confluence, fixed by immersion
in phosphate-buffered saline (PBS) containing 3% formaldehyde for 15 min
(room temperature) followed by permeabilization in PBS containing 0.1%
Triton X-100. Anti-fat-1 serum from rabbits (against a synthetic peptide) was
used as the primary antibody (dilution, 1:300), Alex Fluor goat-anti-rabbit IgG
(HþL) (dilution, 1:800) was used as the secondary antibody (Molecuar Probe,
Eugene, OR). Images were captured with an Olympus fluorescence microscope equipped with a SPOT CCD camera.
Analysis of fatty acid composition
The fatty acid composition of total tissue lipids was analyzed as described
previously (15). Lipid was extracted with chloroform/methanol (2:1, v/v)
containing 0.005% butylated hydroxytoluene (as antioxidant). Fatty acid
methyl esters were prepared using a 14% BF3/methanol reagent. Fatty acid
methyl esters were analyzed by gas chromatography using a fully automated
HP5890 system equipped with a flame-ionization detector. The chromatography utilized an Omegawax 250 capillary column (30 m 0.25 mm ID).
Peaks were identified by a comparison with fatty acid standards (Nu-chekPrep, Elysian, MN), and the area percentage for all resolved peaks was
analyzed using a Perkin-Elmer M1 integrator.
Cell proliferation assay
Cell proliferation was assessed using an MTT assay (Roche, Mannheim,
Germany). At a series of time points after infection, the number of viable
cells grown on a 96-well microtiter plate was estimated by adding 10 ml of
MTT solution (5 mg/ml in PBS). After 4 h of incubation at 37 C, the stain was
diluted with 100 ml of dimethyl sulfoxide. The optical densities were quantified at a test wavelength of 550 nm and a reference wavelength of 630 nm on a
multiwell spectrophotometer.
Cells apoptosis assay
Terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate
nick end-labeling (TUNEL) assay was used for apoptosis detection. After 72 h
of infection with Ad.GFP or Ad.GFP-fat-1, the cells were fixed with 4%
paraformaldehyde in PBS overnight at 4 C. The samples were washed three
times in PBS and permeabilized by 0.2% Triton X-100 in PBS for 15 min on
ice. After rinsing twice with PBS, the samples were incubated with the TUNEL
reagent (Roche) at 37 C in the dark, according to the manufacturer’s instructions. Apoptotic cells were identified by microscopy.
Microarray assay
Total RNA was extracted from the cells after 48 h infection with Ad.GFP or
Ad.GFP-fat-1 (infection efficiency was 490%), using an RNeasy Mini kit
(QIAGEN, Valencia, CA) according to the manufacturer’s suggested protocol.
Concentration and purity of extracted RNA were determined using a
SHIMADZU UV1600 spectrophotometer (Shimadzu, Kyoto, Japan). The
quality of RNA was checked by the 1% agarose gel electrophoresis. Total
RNA (5 mg) was used for the synthesis of cDNA probe according to the
manufacturer’s protocol. Microarray assay was carried out by using the
Human Cancer Pathway Finder Gene Array that contains 96 cancer-related
genes (SupperArray Biosci. Corp., Frederick, MD). Hybridized arrays were
scanned with HP ScannJet 5550. The images were quantified using the
imaging software GeArray Analyzer from SuperArray Inc., and a smoothed
T-value cutoff of 2.0 was used.
Real-time quantitative RT--PCR
Oligonucleotide primers were designed using the Primer Express software
(Applied Biosystems) and synthesized by Sigma. Forward primers (50 -30 )
were: AAGCGGAGAAATAGTGGCCC, CCATGATTGGACACACCGACTC, GCGATGTAGG CTACCCTGCTTT and TCCTGCACCA CCAACTGCTTAG for matrix metalloproteinase-1 (MMP-1), NM23-H4, ITG-a2 and
GAPDH, respectively. Reverse primers (50 -30 ) were: TCCCAGTCACTTTCAGCCCA, CTGCTG ATGTGGACGGCGAAGT, GAGAGACGCCTGATTCTGAAGG and GGCATGGACTGTGG TCATGAGT for MMP-1,
NM23-H4, ITG-a2 and GAPDH, respectively. The fluorescent dye SYBR
green was ordered from Stratagene (La Jolla, CA). GAPDH gene was used as
an endogenous control to normalize the expression of these genes. Quantitative
real-time RT--PCR was performed in triplicate using a 96-well optic tray on
an ABI Prism 7000 sequence detection system (Applied Biosystems).
780
The negative controls lacking template RNA were included in each experiment. PCR products were then run on a 1% agarose gel in order to confirm the
presence of a single band with the expected size. Data collection and analysis
were performed with the SDS version 1.7 software (Applied Biosystems). Data
were then exported and further analyzed in Excel. Results, expressed as N-fold
differences in the target gene expression relative to the control gene, termed
‘N’, were determined by the formula: N ¼ 2DCtsample, where DCt value of the
sample was determined by subtracting the average Ct value of the target gene
from the average Ct value of the control gene. All Ct values of the samples
were normalized by human GAPGH.
Cell attachment assay
After 48 h, the A549 cells infected with Ad.GFP or Ad.GFP-fat-1, were
detached from the culture plates with 0.5% trypsin--EDTA and plated back
on a new culture plate. After a period of 6 and 24 h, the cell attachment status
and morphology were examined and the images of the cells were captured by
using a fluorescence microscope.
Chemoinvasion assay
Chemoinvasion was determined using the 6-well BioCoat Matrigel invasion
chambers (Becton Dickinson Labware, Bedford, MA) with an 8 mm pore
polycarbonate filter coated with matrigel. The lower compartment contained
0.6 ml of DMEM/F12 medium with 5% FBS as chemoattractants or serum-free
DMEM/F12 medium as a control. In the upper compartment, 5 104 cells/
well were placed in triplicate and incubated for 24 h at 37 C in a humidified
incubator with 5% CO2. After incubation, the cells that had passed through the
filter into the lower wells were stained with crystal purple (Fisher Scientific,
Orangeburg, NY) and counted under a microscope in five predetermined
fields. All the assays were repeated at least three times. The differences in
the invasion rates between the control Ad.GFP cells and the Ad.GFP-fat-1 cells
were analyzed using a two-tailed Student’s t-test.
Statistical analysis
Results are mean SD. Statistical analysis was performed using Student’s
t-test, and P-values 5 0.05 were considered significant.
Results
Expression of fat-1 gene in A549 cells
After 72 h of viral infection, ~90% of the cells were infected
based on the expression of GFP (as shown by green fluorescence, data not shown). To verify the existence of fat-1 product in the cells infected with Ad.GFP-fat-1, we performed an
immunofluorescence staining. As shown in Figure 1, a strong
stain was observed in the cells infected with Ad.GFP-fat-1, but
not in the control cells treated with Ad.GFP. These results
indicate a high infection efficiency of the viral vectors and a
high expression rate of the transgene (fat-1) in A549 cells.
Expression of fat-1 gene alters n-6/n-3 fatty acid ratio
After 48 h of infection, the total long chain unsaturated fatty
acids were analyzed by gas chromatography. No difference
in lipid profile was found between uninfected cells and
Fig. 1. Detection of fat-1 gene expression in A549 cells by
immunofluorescent assay. After 60 h of the adenoviral gene transfer, the cells
were fixed, permeabilized and stained with anti-fat-1 serum. (A) Control
cells infected with Ad.GFP; (B) transgenic cells infected with Ad.GFP-fat-1.
(Magnification, 400). See online supplementary material for a color
version of this figure.
n-6/n-3 fatty acid ratio and cancer invasion
Fig. 2. Partial gas chromatograph traces showing the change in cellular n-6/n-3 ratio as a result of the expression of fat-1 in the A549 cells. Left: cells
infected with Ad.GFP; right: cells infected with Ad.GFP-fat-1.
GFP-virus infected cells (data not shown). As shown in
Figure 2, eight PUFAs (4 n-6 and 4 n-3) were detected in the
Ad.GFP cells and Ad.GFP-fat-1 cells. The expression of fat-1
cDNA in A549 cells resulted in the conversions of n-6 fatty
acids to n-3 fatty acids, leading to a significant change in the
ratio of n-6/n-3 fatty acids. In the fat-1 transgenic cells, the n-3
fatty acids ALA, EPA and DHA increased from 0.3, 0.4 and
3.1% to 0.6, 7.6 and 4.5%, respectively. Accordingly, the n-6
fatty acids LA, arachidonic acid (AA) reduce from 3.5 and
15.1% to 1.4 and 3.5%, respectively (Table I). Consequently,
the ratio of n-6 to n-3 fatty acids dropped from 4.5 in the
control cells to 0.4 in the fat-1 transgenic cells (AA/EPA þ
DHA decreased by 10-fold).
Fat-1 expression inhibits the adhesion of A549 cells
To examine the effect on cell adhesion, we detached the cells
from culture plates with 0.5% trypsin--EDTA and plated them
back on a new culture plate. The same number of viable
infected (green) cells in each group (Ad.GFP or Ad.GFP-fat-1)
were plated. The rounded cells were the unattached cells. They
all eventually attached and developed projections. At a given
time point within 24 h, the higher percentage of round cells
indicates the more unattached cells (a defect or delay in cell
attachment). Figure 3 shows the difference in cell attachment
between the control cells and fat-1 transgenic cells. Within 6 h,
a majority of the control cells (infected with Ad.GFP) adhered
firmly to the plate and developed projections (Figure 3B).
Twenty-four hours later, these cells began to grow and form
colonies (Figure 3D). In contrast, the cells infected with
Ad.GFP-fat-1 still remained suspended after 6 h (Figure 3A)
or only slightly attached to the plate 24 h after plating
(Figure 3C). The fat-1 cells exhibited a round shape with no
attachment projections (Figure 3A and C). Colonization of the
fat-1 cells was retarded. These results indicate that the fat-1
transgenic cells have a lower adhesive capability than the
control cells.
Expression of fat-1 gene reduces invasive potential of A549
cells
A matrigel assay was performed to examine the invasive
potential of the lung cancer cells after fat-1 gene transfer
Table I. PUFA composition of total cellular lipids from cells infected
with Ad-GFP and cells infected with Ad-GFP-fat-1
Mol % of total fatty acids
n-6 PUFA
18:2n-6
20:4n-6
22:4n-6
22:5n-6
n-3 PUFA
18:3n-3
20:5n-3
22:5n-3
22:6n-3
n-6/n-3 ratio
Ad-GFP
Ad-GFP-fat-1
3.5a
15.1a
2.1a
1.6a
1.4b
3.5b
0.6b
0.4b
0.3b
0.4b
1.2b
3.1b
4.5a
0.6a
7.6a
3.3a
4.5a
0.4b
Values are means of three measurements. Values for each fatty acid with
the same letter do not differ significantly (P5 0.01) between Ad-GFP and
Ad-GFP-fat-1.
Fig. 3. Micrographs showing the effect of fat-1 gene transfer on the cell
attachment of A549 cells. Following infection with Ad.GFP or Ad.GFP-fat-1
for 48 h, the cells were trypsinized and plated on a new culture dish.
After a period of 6 and 24 h, the images were captured with a fluorescence
microscope. (A and B) 6 h; (C and D) 24 h. (A and C) Cells infected
with Ad.GFP-fat-1; (B and D) cells infected with Ad.GFP. (Magnification,
100). See online supplementary material for a color version of this figure.
781
S.-H.Xia, J.Wang and J.X.Kang
Fig. 5. The growth rate of A549 cells infected with Ad.GFP or Ad.GFP-fat-1.
Equal number of cells was incubated in DMEM/F12 þ5% FBS for different
time periods, and cell numbers were quantified by the MTT assay.
cells.) The difference in cell apoptosis observed at 72 h reflects
the effect of fat-1 expression.
Fig. 4. Fat-1 expression decreased the invasive potential of A549 cells.
The cells that invaded through the matrigel-coated trans-well inserts toward
chemoattractant were stained with 1% crystal purple as described in
Materials and methods. Photographs were taken at a magnification of 100.
(A) Control cells infected with Ad.GFP; (B) transgenic cells infected with
Ad.GFP-fat-1; and (C) the cells invading through the matrigel were counted
under microscope in five predetermined fields at 100. Each sample was
assayed in triplicate. See online supplementary material for a color version
of this figure.
(the cells infected with Ad.GFP were used as control). The
BioCoat Matrigel invasion kit has an 8 mm pore polycarbonate
filter coated with matrigel located between two (upper and
lower) chambers. The matrigel matrix served as a reconstituted
basement membrane, the layer occluding the pores of the membrane, blocking non-invasive cells from migrating through the
membrane. In contrast, the invasive cells were able to detach
themselves and invaded through the matrigel matarix and the
8 mm pores. The number of cells that pass through the filter
into the lower well reflects their invasive potential. As shown
in Figure 4, the number of cells that migrated through the filter
into the lower chamber was significantly lower in the fat-1
cells than in the control cells (P 5 0.001), suggesting a
reduced invasive potential in the fat-1 transgenic cells.
Fat-1 expression increases apoptosis of A549 cells
We used the MTT reagent to detect the cell proliferation and
found that during the first 4 days, the cell growth rate was not
different between Ad.GFP and Ad.GFP-fat-1 cells. But after
96 h, the growth rate of the fat-1 transgenic cells was lower
than that of the control cells (Figure 5). In addition, apoptosis
assay (TUNEL) showed that the percentage of apoptotic cells
in the fat-1 transgenic cells was higher than that in the control
cells (P 5 0.05) (Figure 6). Although some experiment-toexperiment variability might occur, the high expression and
functional activity of fat-1 gene in the fat-1 transgenic cells
but the zero background of the gene in the control cells made
it not difficult to see the effect, if any, of the fat-1 expression.
Indeed, the adenoviral infection and GFP expression somehow
affected the cell survival after the 4-day infection. (This nonspecific effect is similar between Ad.GFP and Ad.GFP-fat-1
782
Expression of fat-1 gene downregulates adhesion/invasionrelated genes in A549 cells
To examine if the fat-1-induced change in n-6/n-3 ratio has an
effect on the expression of cancer-related genes in A549 cells,
we characterized the gene-expression profiles of the transgenic
and control cells using a low-density microarray (SuperArray)
as the preliminary screening, which contains 96 cancer-related
genes. The images were quantified using the imaging software
GeArray Analyzer from SuperArray, Inc. (Figure 7). Eight
genes were found to be downregulated in the fat-1 transgenic
cells. Among them, the three genes, MMP-1 (the intensity of
signal of the gene on the array decreased from 27435 to 2988
counts), ITG-a2 (the intensity decreased from 56821 to 20654)
and NM23-H4 (the intensity decreased from 60429 to 49218),
which are involved in the adhesion or metastasis of cancer
cells, showed the significant change. This downregulation was
verified by a quantitative real-time RT--PCR. The results are
shown in Table II.
Discussion
The present study demonstrates that the gene transfer of the
n-3 fatty acid desaturase into human lung cancer A549 cells
decreases the ratio of n-6 to n-3 fatty acids in these cells,
inhibits their adhesion, migration and proliferation, and downregulates the expression of MMP-1, ITG-a2 and NM23-H4.
These results suggest that the decreased n-6/n-3 fatty acid ratio
reduces the invasive potential of A549 cells through downregulation of the adhesion/invasion-related genes.
In this study, we used a genetic approach to modify the
cellular n-6/n-3 fatty acid ratio by converting the endogenous
n-6 to n-3 fatty acids, without the need for supplementation
with exogenous fatty acids. Thus, this technique could eliminate the potential confounding factor of supplementation (which
can cause cellular fatty acid volumes to be unequal between
control and experimental cells—an increase in total lipid mass
in the supplemented cells), and therefore may be able to provide more reliable results on the effect of change in the n-6/n-3
ratio. Our observation that the change of the cellular n-6/n-3
ratio from a relatively high to a low/balanced one exhibits
n-6/n-3 fatty acid ratio and cancer invasion
Fig. 6. Fat-1 expression induced apoptosis of A549 cells. After 72 h of infection with Ad.GFP or Ad.GFP-fat-1, apoptotic cells were detected by using TUNEL
assay. Cells with yellow or red color are apoptotic cells. (Magnification, 200).
Fig. 7. Microarray images showing the expression profiles of 96
cancer-related genes in A549 cells infected with Ad.GFP (A) or Ad.GFP-fat-1
(B). The arrows indicate the genes (1, ITG-a2; 2, MMP-1; 3, NM23-H4)
that are downregulated in Ad.GFP-fat-1-treated cells.
Table II. Real-time RT--PCR showing fold change of target gene
expression in A549 cells
Genes
Ad.GFP-fat-1
GAPDH
NM23-H4
MMP-1
Integrin-a2
DCt
Ct values
15.96
22.76
22.59
23.66
0.079
0.161
0.098
0.036
Fold
changed
Ad.GFP
15.14
20.68
20.81
20.73
0.015
0.306
0.188
0.015
0.82
2.08
1.77
2.93
0.094
0.195
0.286
0.051
—
2.40 0.231
1.93 0.453
4.32 0.132
an inhibitory effect on the invasive potential of A549 cells,
implies differential/opposing effects of n-6 and n-3 fatty acids
on cancer metastasis and points to the importance of n-6/n-3
fatty acid ratio in the control of cancer.
It is not yet clear how the decreased n-6/n-3 fatty acid ratio
causes inhibitory effects on the invasion of cancer cells. The
mechanisms may be complex and probably involve multiple
pathways. It is possible that the effects are mediated by the
decreased production of n-6-derived eicosanoids and/or the
increased generation of n-3 fatty acid metabolites. Regardless
of peripheral mediators, the behavior of a cell is ultimately
dictated by its genetic profile. Importantly, the results of the
present study demonstrate for the first time that the decreased
n-6/n-3 fatty acid ratio downregulates the expression of
MMP-1, ITG-a2 and NM23-H4 in A549 cells. MMP-1 is a
member of matrix metalloproteinases that collectively degrade
most of the components of the extracellular matrix. It has been
classically thought to contribute to the tissue destruction
required for the cells to invade, intravasate, extravasate and
migrate (16). More recent evidence suggests that MMP-1 also
plays a role in the growth of benign and malignant tumors (17),
angiogenesis (18) and the sustained growth of metastatic
lesions (19). NM23-H4 belongs to human NM23/nucleoside
diphosphate kinase gene family. NM23-H family genes
(H1, H2, H3 and H4) play different roles in various types of
carcinomas. Huang et al. found that NM23-H4 expressed in
diffuse astrocytomas, but not in non-tumorous brain tissue (20).
Hayer et al. reported a strong overexpression of NM23-H4 in
most colorectal carcinomas (21). NM23-H4 was also found
to overexpress in the large cell anaplastic lymphoma (22) and
renal tumors (21). ITG-a2, one of the first integrins to be
identified and characterized, is a collagen receptor, although
it can function as a dual collagen/laminin receptor on some cell
types. Numerous studies have implicated this integrin in a
wide range of biological and pathological functions. Current
studies have revealed that ITG-a2 plays a key role in tumor
cell-induced platelet aggregation (23) and in adhesive interactions necessary for tumoral invasion and metastasis in breast
carcinoma (24). The downregulation of these three genes may
be the molecular basis for the inhibitory effects on cell adhesion, invasion (migration) and growth.
Lung cancer is one of the most common cancers and has the
highest death rate, owing to its invasion and metastasis.
Although currently available drug therapies may temporarily
slow tumor growth, they lose their effectiveness and the genetic versatility of the cells allows them to become resistant.
Some therapies may not be suitable for long-term use due to
severe side-effects. Thus, it is important to develop additional
effective and safe approaches for the treatment of cancer,
which can be applied separately or in conjunction with current
modalities. The results of the present study suggest a role for
the n-6/n-3 fatty acid ratio in the control of cancer and provide
insights into the development of a new therapeutic strategy
by modulating the tissue n-6/n-3 fatty acid ratio for patients
with lung cancer. Hardman et al. recently reported that the
increased consumption of n-3 fatty acids from fish oil sensitized the A549 lung xenografts in mice to doxorubin chemotherapy (25). In fact, recent studies have shown that the ratio of
783
S.-H.Xia, J.Wang and J.X.Kang
n-6 to n-3 fatty acids in today’s diet is ~10--30:1, indicating
that Western diets are deficient in n-3 fatty acids as compared
with the diet on which humans evolved and their genetic
patterns were established (n-6/n-3 ¼ 1:1) (26). The excess
n-6 fatty acids and the very high n-6/n-3 ratios may contribute
to the increased incidence of modern diseases, including
cancer (27). Thus, manipulating (balancing) the n-6/n-3 ratio
of tissue lipids appears to be a feasible approach to the control
of cancer.
In addition, the results of the present study showing the
effectiveness of adenoviral gene transfer of n-3 fatty acid
desaturase in the modification of fatty acid composition indicate a novel and effective approach to the balance of n-6/n-3
fatty acid ratio in human cancer cells, and provide a basis for
potential applications of this gene transfer as a gene therapy for
patients with cancer.
Supplementary material
Supplementary material can be found at: http://www.carcin.
oupjournals.org
Acknowledgements
We thank Dr John Browse for generously providing the C.elegans fat-1 cDNA.
This work was financially supported by grants from the American Institute
for Cancer Research (02A017-REV) and the American Cancer Society
(RSG-03-140-01-CNE).
References
1. Lipworth,L. (1995) Epidemiology of breast cancer. Eur. J. Cancer Prev.,
4, 7--30.
2. Potter,J.D. (1995) Risk factors for colon neoplasia: epidemiology and
biology. Eur. J. Cancer, 31, 1033--1038.
3. Key,T. (1995) Risk factors for prostate cancer. Cancer Surv., 23, 63--77.
4. Bougnoux,P. (1999) n-3 polyunsaturated fatty acids and cancer. Curr.
Opin. Clin. Nutr. Metab. Care, 2, 121--126.
5. Cave,W.T.,Jr (1997) Omega-3 polyunsaturated fatty acids in rodent
models of breast cancer. Breast Cancer Res. Treat., 46, 239--246.
6. Rose,D.P. and Connolly,J.M. (1999) Omega-3 fatty acids as cancer
chemopreventive agents. Pharmacol. Ther., 83, 217--244.
7. Bartsch,H., Nair,J. and Owen,R.W. (1999) Dietary polyunsaturated fatty
acids and cancers of the breast and colorectum: emerging evidence for
their role as risk modifiers. Carcinogenesis, 20, 2209--2218.
8. Larsson,S.C., Kumlin,M., Ingelman-Sundberg,M. and Wolk,A. (2004)
Dietary long-chain n-3 fatty acids for the prevention of cancer: a review of
potential mechanisms. Am. J. Clin. Nutr., 79, 935--945.
9. Collett,E.D., Davidson,L.A., Fan,Y.Y., Lupton,J.R. and Chapkin,R.S.
(2001) n-6 and n-3 polyunsaturated fatty acids differentially modulate
oncogenic Ras activation in colonocytes. Am. J. Physiol. Cell Physiol.,
280, C1066--C1075.
10. Hubbard,N.E., Lim,D. and Erickson,K.L. (1998) Alteration of murine
mammary tumorigenesis by dietary enrichment with n-3 fatty acids in fish
oil. Cancer Lett., 124, 1--7.
784
11. Singh,J., Hamid,R. and Reddy,B.S. (1997) Dietary fat and colon cancer:
modulation of cyclooxygenase-2 by types and amount of dietary fat during
the postinitiation stage of colon carcinogenesis. Cancer Res., 57,
3465--3470.
12. Rose,D.P., Connolly,J.M. and Coleman,M. (1996) Effect of omega-3 fatty
acids on the progression of metastases after the surgical excision of human
breast cancer cell solid tumors growing in nude mice. Clin. Cancer Res.,
2, 1751--1756.
13. Ge,Y., Chen,Z., Kang,Z.B., Cluette-Brown,J., Laposata,M. and Kang,J.X.
(2002) Effects of adenoviral gene transfer of C.elegans n-3 fatty acid
desaturase on the lipid profile and growth of human breast cancer cells.
Anticancer Res., 22, 537--543.
14. Kang,Z.B., Ge,Y., Chen,Z., Cluette-Brown,J., Laposata,M., Leaf,A. and
Kang,J.X. (2001) Adenoviral gene transfer of Caenorhabditis elegans n-3
fatty acid desaturase optimizes fatty acid composition in mammalian cells.
Proc. Natl Acad. Sci. USA, 98, 4050--4054.
15. Kang,J.X., Man,S.F., Brown,N.E., Labrecque,P.A. and Clandinin,M.T.
(1992) Essential fatty acid metabolism in cultured human airway epithelial
cells. Biochim. Biophys. Acta, 1128, 267--274.
16. Nelson,A.R., Fingleton,B., Rothenberg,M.L. and Matrisian,L.M. (2000)
Matrix metalloproteinases: biologic activity and clinical implications.
J. Clin. Oncol., 18, 1135--1149.
17. Korem,S., Resnick,M.B. and Kraiem,Z. (1999) Similar and divergent
patterns in the regulation of matrix metalloproteinase-1 (MMP-1) and
tissue inhibitor of MMP-1 gene expression in benign and malignant human
thyroid cells. J. Clin. Endocrinol. Metab., 84, 3322--3327.
18. Jeong,J.W., Cha,H.J., Yu,D.Y., Seiki,M. and Kim,K.W. (1999)
Induction of membrane-type matrix metalloproteinase-1 stimulates
angiogenic activities of bovine aortic endothelial cells. Angiogenesis, 3,
167--174.
19. Pilcher,B.K., Sudbeck,B.D., Dumin,J.A., Welgus,H.G. and Parks,W.C.
(1998) Collagenase-1 and collagen in epidermal repair. Arch Dermatol.
Res., 290(Suppl.), S37--S46.
20. Huang,H., Colella,S., Kurrer,M., Yonekawa,Y., Kleihues,P. and Ohgaki,H.
(2000) Gene expression profiling of low-grade diffuse astrocytomas by
cDNA arrays. Cancer Res., 60, 6868--6874.
21. Hayer,J., Engel,M., Seifert,M., Seitz,G. and Welter,C. (2001)
Overexpression of NM23-H4 RNA in colorectal and renal tumours.
Anticancer Res., 21, 2821--2825.
22. Gaiser,T., Thorns,C., Merz,H., Noack,F., Feller,A.C. and Lange,K. (2002)
Gene profiling in anaplastic large-cell lymphoma-derived cell lines with
cDNA expression arrays. J. Hematother. Stem Cell Res., 11,
423--428.
23. Keely,P.J. and Parise,L.V. (1996) The alpha2beta1 integrin is a necessary
co-receptor for collagen-induced activation of Syk and the subsequent
phosphorylation of phospholipase Cgamma2 in platelets. J. Biol. Chem.,
271, 26668--26676.
24. Lochter,A., Navre,M., Werb,Z. and Bissell,M.J. (1999) Alpha1 and alpha2
integrins mediate invasive activity of mouse mammary carcinoma cells
through regulation of stromelysin-1 expression. Mol. Biol. Cell, 10,
271--282.
25. Hardman,W.E., Moyer,M.P. and Cameron,I.L. (2000) Dietary fish oil
sensitizes A549 lung xenografts to doxorubicin chemotherapy. Cancer
Lett., 151, 145--151.
26. Simopoulos,A.P. (2003) Importance of the ratio of omega-6/omega-3
essential fatty acids: evolutionary aspects. World Rev. Nutr. Diet, 92, 1--22.
27. Chajes,V. and Bougnoux,P. (2003) Omega-6/omega-3 polyunsaturated
fatty acid ratio and cancer. World Rev. Nutr. Diet, 92, 133--151.
Received August 18, 2004; revised January 1, 2005;
accepted January 8, 2005