Molecular
Cancer
Research
Cell Cycle, Cell Death, and Senescence
miR-15 and miR-16 Are Direct Transcriptional Targets of E2F1
that Limit E2F-Induced Proliferation by Targeting Cyclin E
Matan Ofir, Dalia Hacohen, and Doron Ginsberg
Abstract
microRNAs (miR) are small noncoding RNA molecules that have recently emerged as critical regulators of gene
expression and are often deregulated in cancer. In particular, miRs encoded by the miR-15a, miR-16-1 cluster
seem to act as tumor suppressors. Here, we evidence that the miR-15a, miR-16-1 cluster and related miR-15b,
miR-16-2 cluster comprise miRs regulated by E2F1, a pivotal transcription factor that can induce both
proliferation and cell death. E2F1 is a critical downstream target of the tumor suppressor retinoblastoma
(RB). The RB pathway is often inactivated in human tumors resulting in deregulated E2F activity. We show that
expression levels of the 4 mature miRs, miR-15a, miR-16-1 and miR-15b, miR-16-2, as well as their precursor primiRNAs, are elevated upon activation of ectopic E2F1. Moreover, activation of endogenous E2Fs upregulates
expression of these miRs and endogenous E2F1 binds their respective promoters. Importantly, we corroborate that
miR-15a/b inhibits expression of cyclin E, the latter a key direct transcriptional target of E2F pivotal for the G1/S
transition, raising the possibility that E2F1, miR-15, and cyclin E constitute a feed-forward loop that modulates
E2F activity and cell-cycle progression. In support of this, ectopic expression of miR-15 inhibits the G1/S
transition, and, conversely, inhibition of miR-15 expression enhances E2F1-induced upregulation of cyclin E1
levels. Furthermore, inhibition of both miR-15 and miR-16 enhances E2F1-induced G1/S transition. In
summary, our data identify the miR-15 and miR-16 families as novel transcriptional targets of E2F, which,
in turn, modulates E2F activity. Mol Cancer Res; 9(4); 440–7. 2011 AACR.
Introduction
E2Fs are transcription factors best known for their
involvement in the timely regulation of gene expression
required for cell-cycle progression (1). The product of the
retinoblastoma (RB) tumor suppressor gene, pRB, exerts
growth suppression mainly via inhibitory interactions with
E2Fs (2). Sequential phosphorylations of RB by the CDK
(cyclin-dependent kinase) complexes cyclin D–CDK4/6
and cyclin E–CDK2 lead to release of E2F from the
inhibitory grip of RB and activation of E2F-responsive
genes that promote cell-cycle progression; one of the
pivotal E2F targets being cyclin E itself (3, 4). The critical
role of the RB/E2F pathway in normal cellular proliferation is highlighted by the common incidence in human
Authors' Affiliation: The Mina and Everard Goodman Faculty of Life
Science, Bar Ilan University, Ramat Gan, Israel
Note: Supplementary data for this article are available at Molecular Cancer
Research Online (http://mcr.aacrjournals.org/).
Corresponding Author: Doron Ginsberg, The Mina and Everard Goodman Faculty of Life Science, Bar Ilan University, Ramat Gan 52900, Israel.
Phone: 972-3-5318804; Fax: 972-3-7384058. E-mail:
[email protected]
doi: 10.1158/1541-7786.MCR-10-0344
2011 American Association for Cancer Research.
440
tumors of pathway mutations that result in deregulated
E2F activity (5).
In addition to being fundamental regulators of proliferation, E2Fs modulate diverse cellular functions such as
DNA repair, differentiation, and development (6). At least
1 member of the E2F family, namely, E2F1, can also
mediate apoptosis (1) and autophagy (7–9). Although the
effect of E2F1 on transcriptional regulation of proteinencoding genes has been studied extensively, the role of
E2F1 as a modulator of noncoding RNA expression, in
general, and microRNAs (miRNA), in particular, is less
well studied.
The human genome contains several hundred miRNAs.
These are noncoding RNAs, typically 20 to 24 nucleotides
in length, that are believed to regulate the expression of
about 30% of human genes by either inhibiting mRNA
translation or inducing its degradation (10, 11). miRNAs
are created from primary transcripts, termed pri-miRNAs,
via endonuclease cleavage processing. The synthesis of primiRNAs closely resembles that of mRNAs, with many miRencoding regions embedded in regular protein-coding
genes. Some miRNAs are clustered and transcribed as
polycistrons that contain several mature miRNAs (10).
miRNAs influence a variety of key biological processes,
including development, differentiation, apoptosis, survival,
senescence, metabolism, and signal transduction (12–15).
Furthermore, aberrant expression of distinct miRNAs is
Mol Cancer Res; 9(4) April 2011
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.
E2F1 Regulates Expression of miR-15 and miR-16
often detected in human malignancies and many recent
studies indicate that miRNAs can function as tumor suppressors or oncogenes (16). For example, the miRNAs
encoded by the miR-15a, miR-16-1 cluster seem to act
as tumor suppressors, as deletion or downregulation of these
miRNAs is associated with chronic lymphocytic lymphoma
(CLL), pituitary adenomas, and prostate carcinoma (17).
Recently, a number of E2F-regulated miRNAs have been
identified, including the miR-17-92, miR-106a-363, and
miR-106b-25 clusters as well as miR-449a and miR-449b
(18–24). In line with the complex nature of the RB/E2F
pathway, some of these E2F-regulated miRNAs regulate
E2Fs and/or other pathway components, thereby inhibiting
E2F activity (18–20, 22). Thus, E2F-regulated miRNAs
participate in feedback loops that modulate and restrict E2F
activity.
Here, we evidence that expression of miR-15a, miR-16-1
and miR-15b, miR-16-2 clusters is regulated by E2F. We
show that expression levels of all 4 mature miRNAs, miR15a, miR-16-1, miR-15b, and miR-16-2, as well as their
precursor pri-miRNAs, are elevated upon activation of
ectopic E2F1. Moreover, activation of endogenous E2Fs
upregulates expression of these miRNAs and endogenous
E2F1 binds their promoters. Importantly, we corroborate
that miR-15a/b inhibits expression of cyclin E, a bona fide
target of E2F, raising the possibility that E2F1, miR-15, and
cyclin E constitute a feed-forward loop (FFL) that modulates E2F activity and cell-cycle progression. Indeed, we
show that ectopic expression of miR-15 inhibits G1/S
transition, and, conversely, inhibition of miR-15 expression
enhances E2F1-induced upregulation of cyclin E1 levels.
Furthermore, inhibition of both miR-15 and miR-16
enhances E2F1-induced G1/S transition. In summary,
our data identify the cancer-related miR-15 and miR-16
families as novel transcriptional targets of E2F and present
evidence indicating that they inhibit E2F activity.
Materials and Methods
Cell culture
U2OS osteosarcoma cells were grown in Dulbecco's
modified Eagle's medium supplemented with 5% fetal calf
serum. H1299 lung adenocarcinoma cells were cultured in
RPMI 1640 supplemented with 5% fetal calf serum. Early
passage WI38 human embryonic lung fibroblasts were
grown in minimal essential medium supplemented with
15% fetal calf serum, 2 mmol/L L-glutamine, 1 mmol/L
sodium pyruvate, and nonessential amino acids. Cells were
maintained at 37 C in a humidified atmosphere containing
8% CO2. To induce activation of ER-E2F1, cells were
treated with 300 nmol/L 4-hydroxytamoxifen (OHT) for
the times indicated.
Quantitative PCR
Total RNA was extracted from the cells by the Tri
Reagent method. Real-time quantitative PCR (qPCR)
was done with Absolute Blue SYBER Green Rox Mix
(Thermo) and the following primer pairs:
www.aacrjournals.org
HPRT: 50 -TGACACTGGCAAAACAATGCA and 50 GGTCCTTTTCACCAGCAACGT Cyclin E: 50 -CAGATTGCAGAGCTGTTGGA and 50 -TCAAGGCAGTCAACATCCAG DLEU2: 50 -TGCCAACTGCTTGAAGAATC and 50 -AGAATCATTCGTGCTAAGTGGA SMC4: 50 -TGCAGAGGAATCCTTACCAG and
50 -TGTTCAGCAATGTGACCATC Cdc25A: 50 GAGATCGCCTGGGTAATGAA- 50 and 50 TGCGGAACTTCTTCAGGTCT
For miRNA quantification, TaqMan miRNA assays
(Applied Biosystems) were used according to the manufacturer's protocol. Levels were normalized to the U6
control gene. All real-time reverse transcriptase PCR
(RT-PCR) reactions were performed using the Applied
Biosystems StepOnePlus Real-Time PCR Systems
Machine. Results are presented as mean and SD for duplicate runs.
Western blotting
Cells were lyzed in lysis buffer (50 mmol/L Tris, pH 7.5,
150 mmol/L NaCl, 1 mmol/L EDTA, 1% NP40) in the
presence of protease inhibitor and phosphatase inhibitor
cocktails I and II (Sigma). Equal amounts of protein, as
determined by the Bradford assay, were resolved by electrophoresis in an SDS 12.5% polyacrylamide gel and then
transferred onto an Immobilon-P (Millipore) polyvinylidene difluoride membrane. The membrane was incubated
overnight with 1 of the following primary antibodies: anticyclin E (sc-247; Santa Cruz Biotechnology), anti-Bcl-2 (sc7382; Santa Cruz Biotechnology), anti-p53 (sc-126; Santa
Cruz Biotechnology), and anti-actin (sc-1616r; Santa Cruz
Biotechnology). Binding of the primary antibody was
detected using an enhanced chemilluminescence kit
(ECL Amersham).
Plasmids
The plasmids pBabe-neo-HA-ER-E2F1, pBABE-puro16E7, pBABE-puro-E7-dl21-35, and pRETROSUPERshp53 have been described previously (25).
Transfection/infection procedures
To generate retroviruses, cells (2 106) of the packaging cell line 293T were cotransfected with ecotropic
packaging plasmid pSV-EMLV (10 mg), which provides
packaging helper function, and the relevant cDNA or short
hairpin RNA (shRNA) expression plasmid (10 mg) by using
the calcium phosphate method in the presence of chloroquin
(Sigma). After 8 hours, the transfection medium was
replaced with fresh Dulbecco's modified Eagle's medium
supplemented with 5% fetal calf serum. Subsequently, cell
supernatants containing retroviruses were collected.
When performing infection, cells were incubated for 5
hours at 37 C in 4.5 mL of retroviral supernatant supplemented with polybrene (8 mg/mL; Sigma H9268). Then,
5.5 mL of medium was added, and after a further 24 hours,
the medium was replaced with fresh medium containing
puromycin (2 mg/mL; Sigma P7130).
Mol Cancer Res; 9(4) April 2011
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.
441
Ofir et al.
miRIDIAN miRNA mimics and hairpin antagomiRs
were obtained from Dharmacon. For their transfection,
Dharmafect transfection reagent (Dharmacon) was
employed according to the manufacturer's instructions.
Experiments were carried out 48 hours after transfection
with miRNA mimic or hairpin antagomiRs.
Fluorescence-activated cell-sorting analysis
Cells were trypsinized and then fixed by incubating in
70% ethanol at 4 C overnight. After fixation, cells were
centrifuged for 4 minutes at 1,500 rpm before being
incubated for 30 minutes at 4 C in 1 mL of PBS. Then,
the cells were centrifuged again and resuspended in PBS
containing 5 mg/mL propidium iodide (PI) and 50 mg/mL
RNase A. After incubation for 20 minutes at room
temperature, fluorescence intensity was analyzed by a Becton Dickinson flow cytometer.
is located in the Dleu2 locus and considered to be a tumor
suppressor (29) as its downregulation is associated with a
number of human tumors, including CLL, pituitary adenomas, and prostate carcinoma (17).
Given the high-throughput data concerning E2F regulation of SMC4 and the tumor suppressor activity attributed
to the Dleu2-encoded miRs, we focused our attention on
the miR-15 and miR-16 families. We took advantage of
a conditionally active E2F1 (ER-E2F1), which is activated
by the addition of OHT (30), to validate that SMC4
expression is E2F-regulated and to examine whether
Dleu2 expression is influenced similarly by E2F. Indeed,
activation of this conditional E2F1 in both U2OS human
osteosarcoma cells and H1299 human lung carcinoma
cells was associated with significantly increased SMC4
and Dleu2 RNA levels (Fig. 1A and B). Next, we examined
directly whether E2F1 activation affects expression levels of
Chromatin immunoprecipitation
DNA–protein complexes were immunoprecipitated from
U2OS cells by using the ChIP (chromatin immunoprecipitation) assay kit (Upstate Biotechnology) according to the
manufacturer's protocol with the following polyclonal antibodies: anti-E2F1 (sc-193; Santa Cruz), anti-E2F4 (sc-866),
and anti-HA (sc-805; Santa Cruz); the latter served as a
control for nonspecific DNA binding. The precipitated
DNA was subjected to PCR analysis by using specific primers
corresponding to the Dleu2 promoter, the SMC4 (structural
maintenance of chromosomes 4) promoter, and primers that
served as a negative control for E2F1 binding (b-tubulin):
DLEU2:
50 GGTTATCCTGTCTCTCCCGCTAGATTGA and
50 CATGCGTAAAAATGTCG GGAA SMC4: 50 GCAGGAGCGACAATAAGATGG and 50 CGCTCCTACCGGTGTTTCGb- Tubulin: 50 GGAGCTGATGGAGTCAGTGATG and 50 CAGCTCTCAGCCTCCTTTCTG
Results
To identify miRNAs regulated by E2F, we took advantage of the fact that many miRNAs are located within genes,
and, in such cases, expression of the resident miRNA(s) and
host gene is often coregulated. With this in mind, we
screened the miRbase database for miRNAs located within
E2F-regulated genes. This screen picked up 2 miRNA
clusters, namely, the miR-106b-25 cluster, which resides
in intron 13 of the minichromosome maintenance complex
component 7 gene (Mcm7), already reported to be E2F
regulated (20), and the miR-15b, miR-16-2 cluster, which
resides in intron 5 of the SMC4 gene. The latter encodes for
a protein that functions mainly in M phase and is essential
for mitosis-specific chromatin condensation (26) and has
been suggested to be an E2F-regulated gene, as its mRNA
levels are elevated in RB-deficient cells (27) and its promoter
binds E2F1 and E2F4 (28). Of note, the miR-15b, miR-162 cluster is homologous to the miR-15a, 16-1 cluster, which
442
Mol Cancer Res; 9(4) April 2011
Figure 1. Activation of ectopic E2F1 upregulates expression of the miR15a, miR-16-1 and miR-15b, miR-16-2 clusters. H1299 cells (A) and U2OS
cells (B) expressing ER-E2F1 were incubated with OHT (300 nmol/L) for 18
hours (þ) or left untreated (). Then, RNA was extracted, and Dleu2 and
SMC4 RNA levels were determined by real-time RT-PCR and normalized
to actin or HPRT levels. C, H1299 cells expressing ER-E2F1 were
incubated with OHT (300 nmol/L) for 18 hours (þ) or left untreated ().
Then, RNA was extracted and mature miR-15a, miR-15b and miR-16
expression levels determined by real-time RT-PCR and normalized to
RNU6B levels.
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.
E2F1 Regulates Expression of miR-15 and miR-16
mature miRs-15 and miRs-16. As predicted from their
location, the expression levels of mature miR-15a, miR15b and miR-16 were induced significantly upon activation
of conditional E2F1 in H1299 cells (Fig. 1C).
It has been reported that miR-15 and miR-16 are
regulated by p53 (21, 31, 32). Since E2F1 activates p53
via numerous pathways (33), it is possible that E2F1
regulation of miR-15 and miR-16 expression is mediated
by p53. However, since H1299 cells are p53 deficient (34),
induction of miR-15 and miR-16 levels upon E2F1 activation in this cell line is p53 independent. In line with this, we
found that activation of conditional E2F1 induced miR-15
expression levels in the p53-proficient U2OS cell line even
in the presence of shRNA directed against p53 (Supplementary Fig. S1). Therefore, at least in some settings, E2F1
upregulates expression of miR-15 and miR-16 in a p53independent manner.
Having established that activation of ectopic E2F1
induces expression of miRs-15 and miR-16, we checked
whether endogenous E2Fs are capable of influencing their
expression. To this end, we took advantage of the human
papilloma virus oncoprotein E7, which disrupts RB/E2F
complexes resulting in the activation of endogenous E2Fs.
In line with our ectopic E2F data, expression of E7 in WI38
human fibroblasts elevated the levels of mature miR-15a,
miR-15b and miR-16 whereas expression of a mutant E7,
which does not disrupt RB/E2F complexes, had no effect
(Fig. 2A). To discover whether endogenous E2Fs directly
regulate miRs-15 and miRs-16, we investigated whether
E2Fs bind the human promoters of the Dleu2 pri-miR and
the SMC4 gene that contain miR-15a, miR-16-1 and miR-
15b, miR-16-2, respectively. In silico analysis revealed that
the human Dleu2 promoter contains an evolutionary conserved E2F binding site at position 4 to þ4 and the
human SMC4 promoter contains 2 evolutionary conserved
E2F binding site at positions 1 to þ7 and 41 to 33
(Fig. 2B). Importantly, ChIP using chromatin from proliferating U2OS cells and antibodies directed against E2F1
and E2F4 showed that endogenous E2F1 is associated
detectably with both promoters in vivo (Fig. 2C). In
addition, binding of endogenous E2F4 to the SMC4 promoter was also detected (Fig. 2C; refs. 28, 35). Taken
together, these data support that expression of the miR-15
and miR-16 families is regulated by endogenous E2F. To
test whether the expression of miRs-15 and miRs-16 is cellcycle regulated, we examined their RNA levels in WI38 cells
that were growth arrested at G1 by serum starvation and
induced to reenter the cell cycle by addition of 15% FBS.
Under these conditions, there were no significant changes in
the levels of miR-15 and miR-16 whereas levels of another
E2F-responsive gene, cdc25A, were increased (Supplementary Fig. S2). Thus, our data suggest that endogenous
deregulated E2F elevates miR-15 and miR-16 expression,
yet these miRs are not regulated by E2F during normal cellcycle progression. A similar pattern of expression was
reported for other E2F-regulated genes such as ARF.
Expression of miR-15 and miR-16 has been reported to
inhibit cell proliferation and induce apoptosis (36, 37). This
ability to inhibit proliferation is attributed to their targeting
multiple cell-cycle genes, including cyclin D1, cyclin D3,
cyclin E1, and Cdk6 (37–41), while the effect on apoptosis is
through targeting antiapoptotic genes such as Bcl-2 and
Figure 2. Expression of miR-15 and
miR-16 is regulated by endogenous
E2F. A, WI38 cells were infected with
a retrovirus expressing either wildtype E7 (E7) or an RB-binding–
deficient mutant of E7 (E7mut). Total
RNA was extracted from the cells,
and expression levels of the mature
miR-15a, miR-15b and miR-16 were
determined by RT-PCR and
normalized to RNU6B levels. B,
sequences of SMC4 and Dleu2
promoter regions surrounding their
putative E2F binding sites, which are
shown in bold and underlined. The
sequences of SMC4 and Dleu2
promoter region of human, rhesus,
mouse, and dog were obtained
using UCSC genome browser and
analyzed for the presence of E2F
binding sites using TRANSFAC
matrices. C, ChIP analysis was
performed using U2OS cells. Crosslinked chromatin was precipitated
using antibodies specific to E2F1,
E2F4, and HA. Levels of SMC4 and
Dleu2 promoter fragments were
determined using PCR. Input DNA
represents 0.5% of total chromatin.
www.aacrjournals.org
Mol Cancer Res; 9(4) April 2011
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.
443
Ofir et al.
Mcl-1 (36, 42). Since the subset of genes targeted by a given
miR can differ between tissues and cell lines, we investigated
the consequences of miR-15 expression in U2OS human
osteosarcoma cells. miR-15 was transfected into U2OS cells
and Western blot analysis was done to determine protein
levels of cyclin E and Bcl-2. In agreement with the presence
of 2 evolutionary conserved binding sites for miR-15/16 in
the 30 UTR (untranslated region) of cyclin E (40), ectopic
miR-15 expression resulted in markedly reduced cyclin E
protein levels (Fig. 3A). Levels of Bcl-2 protein were mildly
reduced. Notably, this miR-15–dependent decrease in
cyclin E levels was associated with a reduction in the
percentage of S-phase cells and a concomitant increase in
the percentage of G1 cells (Fig. 3B), indicating that miR-15
inhibits the G1/S transition. In line with the mild effects of
miR-15 expression on Bcl-2 levels, no significant change in
apoptosis levels was detected (data not shown).
Cyclin E1 is transcriptionally regulated by E2F (3) and,
as shown by us here and previously by others, posttranscriptionally regulated by the miR-15 and miR-16 families
(37, 39–41). In addition, as shown here, E2Fs transcrip-
Figure 3. miR-15a induces downregulation of cyclin E and cell-cycle
arrest. A, U2OS cells were transfected with miR-15a mimic (100 nmol/L) or
nonspecific miR mimic (control). Forty-eight hours posttransfection
proteins were extracted from the cells, and Western blot analysis was
performed using antibodies directed against cyclin E, Bcl2, and actin. B,
cells described in (A) were analyzed by FACS (fluorescence-activated cell
sorting); PI). Percentages of cells in G1, S, and G2/M cell-cycle phases are
depicted in the bar graph. The average of 3 independent experiments is
presented.
444
Mol Cancer Res; 9(4) April 2011
tionally regulate the miR-15 and miR-16 families. We
noted that this network of regulation constitutes an
incoherent type 1 FFL, whereby a transcription activator
activates a gene directly and also activates a repressor of the
gene (Fig. 4D; ref. 43). To test whether such an FFL is
operating, we examined the effect of reducing miR-15a
and miR-15b levels on E2F1-induced cyclin E expression.
To this end, miR-15a and miR-15b expression was
inhibited in U2OS cells expressing conditionally active
E2F1 by introducing antagomiRs directed against either
miR-15a or miR-15b. As expected, introduction of a
nonspecific antagomiR did not affect either the basal level
of miR-15a and miR-15b or their induction by E2F1. In
contrast, introducing an antagomiR directed against miR15a or miR-15b resulted in reduced basal levels of these
miRs and inhibited their upregulation by E2F1 (Fig. 4A).
We observed that the antagomiR directed against miR-15a
also significantly inhibited miR-15b expression and an
antagomiR directed against miR-15b also reduced to some
extent the expression of miR-15a, most probably due to
the high sequence similarity between these 2 related miRs.
Having established the activity of the antagomiRs, we
examined their effects on E2F regulation of cyclin E1
expression. As previously reported, activation of E2F1
resulted in an increase in cyclin E1 mRNA and protein
levels (Fig. 4B and C). Importantly, antagomiR-mediated
inhibition of miR-15a and miR-15b expression resulted in
significantly enhanced E2F1-induced upregulation of
cyclin E1 levels, reflected at both the RNA and protein
levels (Fig. 4B and C). Thus, these data support the
existence of an incoherent FFL comprising E2F1, miR15, and cyclin E1.
E2F1 regulates cell-cycle progression by controlling
expression of cell-cycle–related genes including cyclin E that
plays a critical role in G1/S transition. To test whether miRs15 and miRs-16 affect E2F1-induced G1/S transition, we
examined the effect of reducing miRs-15 and miRs-16 levels
on E2F1-induced G1 exit of serum-starved cells. To this
end, antagomiRs directed against miR-15a and miR-16
were introduced into U2OS cells expressing conditionally
active E2F1. Next, cells were serum starved to enrich for
cells in G1 and then E2F1 was activated to induce S-phase
entry. As previously reported, activation of ectopic E2F1
resulted in G1 exit. Importantly, inhibition of miRs-15 and
miRs-16 expression (Fig. 5B) resulted in significantly
enhanced E2F1-induced G1 exit (Fig. 5A). These data
indicate that miRs-15 and miRs-16 may attenuate E2F1mediated cell–cycle progression.
In summary, our data identify the miR-15 and miR-16
families as novel E2F transcriptional targets that modulate E2F-dependent cyclin E expression and cell-cycle
progression.
Discussion
We establish here that expression of miR-15 and miR16 is regulated by E2F1. Specifically, we show that
activation of ectopic E2F1 results in elevated levels of
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.
E2F1 Regulates Expression of miR-15 and miR-16
Figure 4. Inhibition of miR-15a and miR-15b expression results in enhanced E2F1-induced cyclin E expression. U2OS cells expressing ER-E2F1 were
transfected with anti-miRNA oligonucleotides complementary to miR-15a, miR-15b or a nonspecific miR (n.s.). Twenty-four hours posttransfection cells were
treated without or with OHT (300 nmol/L) for 24 hours before harvesting. A, RNA levels of mature miR-15a, miR-15b and miR-16 were determined by real-time
RT-PCR and normalized to RNU6B. B, mRNA levels of cyclin E were determined by real-time RT-PCR and normalized to HPRT. C, extracted proteins were
subjected to Western blot analysis by using antibodies against cyclin E and actin. D, schematic representation of the incoherent FFL comprising E2F1,
miR-15, and cyclin E. E2F1 regulates the expression of both cyclin E and miR-15, and the latter represses cyclin E expression.
miR-15a, miR-16-1 and miR-15b, miR-16-2 and of their
respective precursors SMC4 and Dleu2. Moreover, we
show that expression of these miRs is induced by E7, a
viral protein that activates endogenous E2Fs, and ChIP
analyses evidence that E2F1 is bound to the promoters
regulating the expression of these miRNAs. In addition,
having established E2F regulation of miRs-15 and miRs16, we evidence the participation of this relationship in a
larger regulatory loop, for these miRs target cyclin E, a
pivotal E2F target gene. Accordingly, we show that
inhibition of miR-15 expression enhances E2F1-induced
upregulation of cyclin E1 mRNA and protein levels, and,
conversely, ectopic expression of miR-15 reduces cyclin E
protein levels and inhibits the G1/S transition, the latter a
well-documented biological outcome of E2F activity.
Furthermore, inhibition of both miR-15 and miR-16
expression augments E2F1-mediated G1/S transition.
Summarily, our data reveal that miR-15 and miR-16
represent novel E2F1 targets that restrict E2F activity.
This is not the first example of E2F-dependent restriction of E2F activity. It was shown previously that E2F1
activates AKT via transcriptional regulation of the adaptor
Gab2 and that this E2F1-dependent AKT activation
serves to inhibit E2F1-mediated apoptosis (44). In addition, a recent study showed that in murine fibroblasts,
E2F1 and E2F3 transcriptionally upregulate the expression of a number of miRNAs, which can, in turn, inhibit
cell proliferation (45).
www.aacrjournals.org
More specifically, our data support the existence of a
regulatory loop known as an incoherent FFL type I (43)
because E2F1 transcriptionally regulates the expression of
cyclin E, miRs-15, and miRs-16, and these miRs, in turn,
repress cyclin E expression. In other words, E2F1 activates
both cyclin E and a repressor of cyclin E. A regulatory loop
similar to the one described here that comprises E2F1, miR449, Cdk6, and Cdc25A was shown previously, whereby
E2F1 regulates the levels of miR-499a/b, which, in turn,
restrict E2F activity (22).
Regarding miR-16, we have not shown formally, as for
miR-15, that ectopic expression downregulates cyclin E
levels and reduced expression enhances E2F1-dependent
cyclin E upregulation. Nevertheless, given that the seeds of
miR-15 and miR-16 are highly similar and miR-16 was
shown by others to negatively regulate cyclin E (40), we
consider it reasonable to extrapolate that E2F1 upregulates
the expression of 4 distinct miRs, namely, miR-15a, miR16-1 and miR-15b, miR-16-2, all of which target cyclin E.
Given this scenario, E2F1-regulated miRs likely exert a
significant effect on cyclin E expression. Notably, data
from other studies suggest that miR-15 and miR-16
downregulate not only cyclin E but also a number of
other pivotal regulators of cell-cycle progression, such as
cyclin D1, cyclin D3, and CDK6 (37–41). Thus, these 4
miRs can collaborate to restrict E2F-induced cell-cycle
progression by targeting multiple proliferation-related
genes. A defect in the RB/E2F pathway that results in
Mol Cancer Res; 9(4) April 2011
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.
445
Ofir et al.
cooperate during tumor development to sustain enhanced
proliferation of transformed cells.
In some settings, miR-15 and miR-16 can induce
apoptosis by targeting the antiapoptotic genes Bcl-2 and
Mcl-1 (36, 42). We did not find that elevated miR-15 and
miR-16 expression was associated with increased apoptosis
in the U2OS osteosarcoma cell line. This, notwithstanding, in other contexts, miR-15 and miR-16 may contribute to E2F1-induced apoptosis. A corollary of this
premise is that the frequent deletion of the miR-15a,
miR-16-1 locus in some human tumors could serve to
limit E2F1-induced apoptosis, the latter a result of the
deregulated E2F associated with common RB/E2F pathway mutations. Thus, these 2 molecular alterations bear
the potential to cooperate during tumor development not
only to sustain proliferation but also to suppress apoptosis
of transformed cells.
Summarily, we show here that the cancer-related miR-15
and miR-16 families are transcriptionally regulated by E2F1
and can restrain E2F1 activity. We propose that these miRs
serve to fine-tune E2F1 activity and thereby prevent excessive E2F1 activity that could harm normal cells.
Figure 5. Inhibition of miR-15a and miR-16 expression enhances
E2F1-induced G 1 exit. U2OS cells expressing ER-E2F1 were
transfected with anti-miRNA oligonucleotides complementary to
miR-15a and miR-16, or a nonspecific miR (n.s.). Twelve hours
posttransfection cells were serum starved (48 hours, 0.1% serum) and
then treated with OHT (300 nmol/L) or left untreated for 24 hours
before harvesting. A, cells were analyzed by FACS (fluorescenceactivated cell sorting; PI). Percentages of cells exiting G1 after
activation of E2F1 are depicted in the bar graph. The results show data
from 3 independent experiments expressed as the mean SD.
Statistical differences were calculated using unpaired 2-tailed
Student's t test. *, statistical significance P < 0.05. B, RNA levels of
mature miR-15a, miR-15b and miR-16 were determined by real-time
RT-PCR and normalized to RNU6B.
deregulated and hyperactive E2F is a common event in
many human tumors (5) and deletion of miR-15a and
miR-16-1 is often detected in some human tumors (17).
Our data suggest that these 2 molecular alterations may
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Acknowledgments
We thank Dr. Eran Horstein of the Weizmann Institute of Science for helpful
discussions and Dr. Mark Katzenellenbogen from the Bar Ilan University for
Bioinformatic Analysis.
Grant Support
This work was supported by a grant from the Israel Science foundation (D.
Ginsberg).
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received July 29, 2010; revised February 6, 2011; accepted February 21, 2011;
published OnlineFirst March 31, 2011.
References
1.
2.
3.
4.
5.
6.
446
Polager S, Ginsberg D. E2F—at the crossroads of life and death.
Trends Cell Biol 2008;18:528–35.
DeGregori J, Johnson DG. Distinct and overlapping roles for E2F
family members in transcription, proliferation and apoptosis. Curr Mol
Med 2006;6:739–48.
Ohtani K, DeGregori J, Nevins JR. Regulation of the cyclin E gene by
transcription factor E2F1. Proc Natl Acad Sci U S A 1995;92:12146–
50.
Ohtsubo M, Theodoras AM, Schumacher J, Roberts JM, Pagano M.
Human cyclin E, a nuclear protein essential for the G1-to-S phase
transition. Mol Cell Biol 1995;15:2612–24.
Sherr CJ, McCormick F. The RB and p53 pathways in cancer. Cancer
Cell 2002;2:103–12.
Dimova DK, Dyson NJ. The E2F transcriptional network: old acquaintances with new faces. Oncogene 2005;24:2810–26.
Mol Cancer Res; 9(4) April 2011
7.
Tracy K, Dibling BC, Spike BT, Knabb JR, Schumacker P, Macleod
KF. BNIP3 is an RB/E2F target gene required for hypoxia-induced
autophagy. Mol Cell Biol 2007;27:6229–42.
8. Polager S, Ofir M, Ginsberg D. E2F1 regulates autophagy and the
transcription of autophagy genes. Oncogene 2008;27:4860–4.
9. Kusama Y, Sato K, Kimura N, Mitamura J, Ohdaira H, Yoshida K.
Comprehensive analysis of expression pattern and promoter regulation of human autophagy-related genes. Apoptosis 2009;14:1165–75.
10. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281–97.
11. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked
by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005;120:15–20.
12. He L, Hannon GJ. MicroRNAs: small RNAs with a big role in gene
regulation. Nat Rev Genet 2004;5:522–31.
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.
E2F1 Regulates Expression of miR-15 and miR-16
13. Ambros V. The functions of animal microRNAs. Nature 2004;431:350–
5.
14. Chivukula RR, Mendell JT. Circular reasoning: microRNAs and cellcycle control. Trends Biochem Sci 2008;33:474–81.
15. Inui M, Martello G, Piccolo S. MicroRNA control of signal transduction.
Nat Rev Mol Cell Biol 2010;11:252–63.
16. Ventura A, Jacks T. MicroRNAs and cancer: short RNAs go a long
way. Cell 2009;136:586–91.
17. Aqeilan RI, Calin GA, Croce CM. miR-15a and miR-16-1 in cancer:
discovery, function and future perspectives. Cell Death Differ
2010;17:215–20.
18. Sylvestre Y, De Guire V, Querido E, Mukhopadhyay UK, Bourdeau V,
Major F, et al. An E2F/miR-20a autoregulatory feedback loop. J Biol
Chem 2007;282:2135–43.
19. Woods K, Thomson JM, Hammond SM. Direct regulation of an
oncogenic micro-RNA cluster by E2F transcription factors. J Biol
Chem 2007;282:2130–4.
20. Petrocca F, Visone R, Onelli MR, Shah MH, Nicoloso MS, de Martino I,
et al. E2F1-regulated microRNAs impair TGFbeta-dependent cellcycle arrest and apoptosis in gastric cancer. Cancer Cell
2008;13:272–86.
21. Brosh R, Shalgi R, Liran A, Landan G, Korotayev K, Nguyen GH, et al.
p53-repressed miRNAs are involved with E2F in a feed-forward loop
promoting proliferation. Mol Syst Biol 2008;4:229.
22. Yang X, Feng M, Jiang X, Wu Z, Li Z, Aau M, et al. miR-449a and miR449b are direct transcriptional targets of E2F1 and negatively regulate
pRb-E2F1 activity through a feedback loop by targeting CDK6 and
CDC25A. Genes Dev 2009;23:2388–93.
23. Lize M, Pilarski S, Dobbelstein M. E2F1-inducible microRNA 449a/b
suppresses cell proliferation and promotes apoptosis. Cell Death
Differ 2009;17:452–8.
24. Emmrich S, Putzer BM. Checks and balances: E2F-microRNA crosstalk in cancer control. Cell Cycle 2010;9:2553–65.
25. Berkovich E, Ginsberg D. ATM is a target for positive regulation by
E2F-1. Oncogene 2003;22:161–7.
26. Strunnikov AV, Jessberger R. Structural maintenance of chromosomes (SMC) proteins: conserved molecular properties for multiple
biological functions. Eur J Biochem 1999;263:6–13.
27. Markey MP, Bergseid J, Bosco EE, Stengel K, Xu H, Mayhew CN, et al.
Loss of the retinoblastoma tumor suppressor: differential action on
transcriptional programs related to cell cycle control and immune
function. Oncogene 2007;26:6307–18.
28. Ren B, Cam H, Takahashi Y, Volkert T, Terragni J, Young RA, et al. E2F
integrates cell cycle progression with DNA repair, replication, and
G(2)/M checkpoints. Genes Dev 2002;16:245–56.
29. Bullrich F, Fujii H, Calin G, Mabuchi H, Negrini M, Pekarsky Y, et al.
Characterization of the 13q14 tumor suppressor locus in CLL: identification of ALT1, an alternative splice variant of the LEU2 gene. Cancer
Res 2001;61:6640–8.
30. Vigo E, Muller H, Prosperini E, Hateboer G, Cartwright P, Moroni
MC, et al. CDC25A phosphatase is a target of E2F and is required
www.aacrjournals.org
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
for efficient E2F-induced S phase. Mol Cell Biol 1999;19:6379–
95.
Suzuki HI, Yamagata K, Sugimoto K, Iwamoto T, Kato S, Miyazono K.
Modulation of microRNA processing by p53. Nature 2009;460:529–
33.
Boominathan L. The tumor suppressors p53, p63, and p73 are
regulators of microRNA processing complex. PLoS One 2010;5:
e10615.
Polager S, Ginsberg D. p53 and E2f: partners in life and death. Nat Rev
Cancer 2009;9:738–48.
Mitsudomi T, Steinberg SM, Nau MM, Carbone D, D’Amico D, Bodner
S, et al. p53 gene mutations in non-small-cell lung cancer cell lines
and their correlation with the presence of ras mutations and clinical
features. Oncogene 1992;7:171–80.
Pavlova SV, Elisafenko EA, Zakian SM. The Structure and evolution of
the MaSMC4 gene of common vole Microtus arvalis (Arvicolidae,
Rodentia). Russian J Genet 2007;43:159–69.
Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, et al.
miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl
Acad Sci U S A 2005;102:13944–9.
Liu Q, Fu H, Sun F, Zhang H, Tie Y, Zhu J, et al. miR-16 family induces
cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids
Res 2008;36:5391–404.
Bonci D, Coppola V, Musumeci M, Addario A, Giuffrida R, Memeo
L, et al. The miR-15a-miR-16-1 cluster controls prostate cancer
by targeting multiple oncogenic activities. Nat Med 2008;14:
1271–7.
Bandi N, Zbinden S, Gugger M, Arnold M, Kocher V, Hasan L,
et al. miR-15a and miR-16 are implicated in cell cycle regulation in
a Rb-dependent manner and are frequently deleted or downregulated in non-small cell lung cancer. Cancer Res 2009;
69:5553–9.
Wang F, Fu XD, Zhou Y, Zhang Y. Down-regulation of the cyclin E1
oncogene expression by microRNA-16-1 induces cell cycle arrest in
human cancer cells. BMB Rep 2009;l42:725–30.
Lerner M, Harada M, Loven J, Castro J, Davis Z, Oscier D, et al.
DLEU2, frequently deleted in malignancy, functions as a critical host
gene of the cell cycle inhibitory microRNAs miR-15a and miR-16-1.
Exp Cell Res 2009;315:2941–52.
Calin GA, Cimmino A, Fabbri M, Ferracin M, Wojcik SE, Shimizu M,
et al. MiR-15a and miR-16-1 cluster functions in human leukemia.
Proc Natl Acad Sci U S A 2008;105:5166–71.
Milo R, Shen-Orr S, Itzkovitz S, Kashtan N, Chklovskii D, Alon U.
Network motifs: simple building blocks of complex networks. Science
2002;298:824–7.
Chaussepied M, Ginsberg D. Transcriptional Regulation of AKT Activation by E2F. Mol Cell 2004;16:831–7.
Bueno MJ, Gomez de Cedron M, Laresgoiti U, Fernandez-Piqueras J,
Zubiaga AM, Malumbres M. Multiple E2F-induced microRNAs prevent
replicative stress in response to mitogenic signaling. Mol Cell Biol
2010;30:2983–95.
Mol Cancer Res; 9(4) April 2011
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.
447
miR-15 and miR-16 Are Direct Transcriptional Targets of
E2F1 that Limit E2F-Induced Proliferation by Targeting Cyclin
E
Matan Ofir, Dalia Hacohen and Doron Ginsberg
Mol Cancer Res 2011;9:440-447.
Updated version
Supplementary
Material
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://mcr.aacrjournals.org/content/9/4/440
Access the most recent supplemental material at:
http://mcr.aacrjournals.org/content/suppl/2011/04/15/1541-7786.MCR-10-0344.DC1
This article cites 45 articles, 16 of which you can access for free at:
http://mcr.aacrjournals.org/content/9/4/440.full.html#ref-list-1
This article has been cited by 13 HighWire-hosted articles. Access the articles at:
/content/9/4/440.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2011 American Association for Cancer Research.