Molecular Cell 23, 801–808, September 15, 2006 ª2006 Elsevier Inc.
DOI 10.1016/j.molcel.2006.07.019
The DNA Repair Helicases XPD and FancJ
Have Essential Iron-Sulfur Domains
Jana Rudolf,1 Vasso Makrantoni,2 W. John Ingledew,1
Michael J.R. Stark,2 and Malcolm F. White1,*
1
Centre for Biomolecular Sciences
University of St Andrews
North Haugh, St Andrews, Fife KY16 9ST
2
Division of Gene Regulation and Expression
School of Life Sciences
MSI/WTB Complex
University of Dundee
Dundee DD1 5EH
United Kingdom
Summary
DNA helicases are essential components of the cellular machinery for DNA replication, recombination, repair, and transcription. The XPD and FancJ proteins
are related helicases involved in the nucleotide excision repair (NER) and Fanconi anemia repair pathways, respectively. We demonstrate that both proteins
have a conserved domain near the N terminus that includes an iron-sulfur (Fe-S) cluster. Three absolutely
conserved cysteine residues provide ligands for the
Fe-S cluster, which is essential for the helicase activity
of XPD. Yeast strains harboring mutations in the Fe-S
domain of Rad3 (yeast XPD) are defective in excision
repair of UV photoproducts. Clinically relevant mutations in patients with trichothiodystrophy (TTD) and
Fanconi anemia disrupt the Fe-S clusters of XPD and
FancJ and thereby abolish helicase activity.
Introduction
XPD (Rad3 in Saccharomyces cerevisiae) is a superfamily
2 (SF2) helicase with a 50 –30 polarity. In all eukaryotes
studied, XPD is a component of the ten-subunit complex
TFIIH, which plays a role in both transcription initiation
from RNA polymerase II promoters and in the NER pathway. XPD is the dominant helicase activity within TFIIH
(Tirode et al., 1999) and is essential for the structure
and function of the complex. Point mutations that knock
out the ATPase or helicase activities of XPD have a limited effect on transcription initiation by TFIIH but abolish
NER, pointing to a primary role for the XPD helicase in
DNA repair (Winkler et al., 2000). Inherited mutations in
XPD are found in patients with three related conditions:
xeroderma pigmentosum (XP), Cockayne syndrome
(CS) and TTD (reviewed in Lehmann [2001]).
As a universal eukaryal protein, XPD appears to be the
founding member of a family of related SF2 helicases
that includes FancJ (also known as BACH1 and BRIP1),
Chl1, and RTel1 (Figure 1B, and Figure S1 in the Supplemental Data available with this article online). The FancJ
helicase interacts with the BRCT motifs of BRCA1 (Cantor et al., 2001), and germline mutations that abolish the
helicase activity were shown to result in early onset
breast cancer (Cantor et al., 2004). Recently, FancJ has
*Correspondence: [email protected]
been implicated in crosslink repair in the pathway
mutated in Fanconi anemia patients (Levitus et al.,
2005; Litman et al., 2005). The Chl1 helicase is required
for sister-chromatid cohesion in budding yeast (Skibbens, 2004) and is conserved in fungi, plants, and metazoa, including humans (Hirota and Lahti, 2000). The
fourth member of this family, RTel1, is distributed in
plants and metazoa. An RTel1 knockout results in embryonic lethality in mice, and RTel12/2 cells showed elevated levels of telomere loss, chromosome breaks, and
fusions, suggesting putative roles in the maintenance
of telomere length and genome stability (Ding et al.,
2004). Many archaeal species also encode a homolog
of the XPD family helicase, and sequence analysis shows
that the archaeal and eukaryal XPD sequences are more
related to one another than to the other eukaryal family
members (Figure S1). The archaeal XPD protein has not
been characterized genetically or biochemically and its
function is unknown.
Sequence analysis of the eukaryal and archaeal helicase family members revealed the existence of a conserved domain positioned near the N terminus, between
the Walker A and B boxes (Figure 1A). The key characteristic of this domain was the conservation of four cysteine residues, suggestive of a metal ion binding motif
(Figure 1B). This motif is present at an equivalent position to the b hairpin domain of the bacterial NER helicase
UvrB, which serves to physically separate DNA strands
(Figure 1C). Here, we report that the conserved region
forms an Fe-S cluster binding domain. Fe-S clusters
are rare in nuclear proteins and have not previously
been identified in helicases. We show that the Fe-S cluster can be abolished in XPD by mutation of the conserved cysteine ligands, resulting in the generation of
mutant proteins that retain their overall fold and stability,
and can hydrolyze ATP in an ssDNA-dependent manner.
However, mutants lacking the cluster can no longer
function as DNA helicases, implicating the Fe-S cluster
in the mechanism of DNA strand displacement. Clinically relevant mutations of XPD and FancJ that cause
TTD and Fanconi anemia in affected patients cause
the destabilization of the Fe-S cluster in archaeal XPD,
suggesting a molecular mechanism for the phenotypes
observed.
Results and Discussion
XPD Is an Fe-S Protein
The XPD gene from the crenarchaeote Sulfolobus acidocaldarius (sacxpd) was cloned and expressed in E. coli.
The protein purified as a monomer by gel filtration. The
pure protein had a yellow-green color with a broad
shoulder of absorbance between 360 and 550 nm
(Figure 2A). These observations suggested the presence
of an Fe-S cluster in XPD. Iron was quantified at 3.3
moles iron per mole protein by using an iron chelation
assay and confirmed by elemental analysis using inductively coupled plasma optical emission spectroscopy
(ICP-OES), which yielded an iron to sulfur ratio of
0.133, consistent with the value of 0.136 expected for
Molecular Cell
802
Figure 1. A Conserved Metal Binding Domain in the XPD Protein Family
(A) Schematic of the human XPD protein, with the canonical helicase motifs indicated by black boxes and the position of the Fe-S domain shown
in green.
(B) Sequence alignment of the region between the Walker A and B boxes (helicase motifs I and II), including the Fe-S domain, for a variety of
human and archaeal helicases. Sac, Sulfolobus acidocaldarius XPD; Pfu, Pyrococcus furiosus XPD; Rad3, Saccharomyces cerevisiae Rad3;
XPD, human XPD; RTel1, human RTel1; FancJ, human FancJ/BACH1; and Chl1, human Chl1. The four conserved cysteine residues are
highlighted in yellow. The positions of the clinically relevant XPD mutation R112H and the FancJ mutation A349P are highlighted in blue.
(C) Structure of the UvrB helicase, showing the b hairpin domain in blue interacting with a bound DNA species in red (Truglio et al., 2006).
a [3Fe-4S] cluster (allowing for the 18 sulfurs in methionine and cysteine residues in XPD, thus 3 Fe and 22 S
atoms in total, a ratio of 0.136). The presence of a
[3Fe-4S] cluster was also detected by EPR after oxidation by ferricyanide (Figure 2B), suggesting the cluster
is in a reduced (S = 2) state after purification. In vivo, it
Essential Fe-S Domain in XPD and FancJ Helicases
803
Figure 2. Archaeal XPD Contains an Fe-S Cluster
(A) Visible absorbance spectrum of pure S. acidocaldarius XPD
showing the shoulder of absorbance at 400 nm for the wild-type
(WT) protein that is absent in the K84H, F136P, and C137S mutants.
The inset shows the color of a 150 mM solution of WT XPD protein.
(B) Electron paramagnetic resonance (EPR) spectrum of oxidanttreated XPD. X band EPR spectrum of the oxidized (ferricyanidetreated) enzyme. The spectrum is characteristic of an oxidized
[3Fe-4S] Fe-S cluster. EPR conditions: temperature, 30 K; modulation frequency, 100 KHz; modulation amplitude, 0.32 mT; microwave
frequency, 9.49 GHz; and microwave power, 0.2 mW.
is possible that the cluster may exist in the [4Fe-4S]
form, which degrades to give a [3Fe-4S] cluster.
Given the strong conservation of the four cysteine
ligands, it thus appears there are four related human
DNA helicases with an Fe-S cluster domain positioned
between their Walker A and B boxes—the first helicases
to be identified with Fe-S domains. Fe-S clusters are
rare in nuclear enzymes but are present in DNA glycosylases of the EndoIII/MutY family (Kuo et al., 1992) and in
the family 4 uracil DNA glycosylases (Hinks et al., 2002).
In MutY, the Fe-S cluster does not contribute significantly to the folding and stability of the protein but
does help position a loop that is important for DNA binding, and there is evidence that the cluster becomes redox-active on binding to DNA (reviewed in Lukianova
and David [2005]). Beyond the presence of four cysteine
ligands, the Fe-S domains in these different protein
families show no sequence similarity and are thus difficult to detect with bioinformatics. In XPD, there is considerable variation in the spacing between cysteines 2
and 3, and 3 and 4, for example. There are rather few
conserved residues with the exception of the cysteines,
and it is thus not obviously the case that the Fe-S domain serves to orientate a functionally important residue
as is seen for MutY (Thayer et al., 1995).
To examine the role of the Fe-S domain in XPD, we
constructed and purified a range of site-directed mutant
forms of the protein (Figure S2). Each cysteine was individually changed to a serine, generating mutants C88S,
C102S, C105S, and C137S. Two clinically relevant mutants, K84H and F136P, were constructed and are
described in more detail later. Two highly conserved
aromatic residues in the domain were also mutated,
generating the double mutant Y139A/Y140A and two
single mutants, Y139F and Y140F. As a control, we mutated the Walker A box lysine to an alanine (K35A) to
abolish the ATPase and helicase activities of the enzyme. All the mutant proteins were expressed and purified from E. coli (Figure S2). The C88S, C105S, and
C137S mutants were colorless on purification, consistent with absence of the Fe-S cluster (Figure 2A and
Figure S3). The cluster was destabilized in the Y139A/
Y140A mutant, which lost its color during purification,
but individual mutation of these residues to phenylalanine did not disrupt the cluster. The K35A mutant had
a stable Fe-S cluster, as expected, as did the C102S mutant, suggesting that serine can substitute for cysteine
at this position in the cluster, consistent with other
Fe-S proteins (Kowal et al., 1995) and the observation
that the Thermoplasma volcanium XPD sequence has
a serine at this position. Using a phenanthroline iron
chelation assay, we quantified the iron content of the
C102S and C105S mutants as 2.9 and 0 moles iron per
mole of protein, respectively.
The Fe-S Cluster Is Essential for the Helicase Activity
of XPD
XPD displays an ATPase activity that is stimulated
strongly by single-, but not double-, stranded DNA (Figure 3A), suggesting the enzyme tracks along a single
DNA strand. This property is shared in common with
other monomeric SF2 DNA helicases (Soultanas et al.,
2000). This activity increases with increasing temperature, consistent with a thermostable enzyme (Figure 3B).
All of the mutant forms of XPD produced in this study
were active ssDNA-dependent ATPases, with the exception of the Walker A-box K35A mutant (data not
shown). Data for the C88S and K84H mutants were
representative (Figure 3A). The XPD mutants lacking
the Fe-S cluster tended to have a slightly higher maximal
ssDNA-stimulated ATPase activity than the wild-type
(WT) protein but similar Km values for ATP (Figure S4).
These observations show that the Fe-S cluster is not
necessary for ssDNA-stimulated ATP hydrolysis by
XPD and that the mutations did not result in a gross disruption of the enzyme structure, a conclusion supported
by circular-dichroism spectroscopy (Figure S5).
XPD can also function as an ATP-dependent 50 –30
DNA helicase, displacing a DNA strand from a partially
duplex DNA species (Figure 4). We observed a strong
correlation between the stability of the Fe-S cluster
and the helicase activity of the XPD mutants
(Figure 4C). Mutants without the cluster, such as C88S
and C105S, showed virtually complete loss of helicase
activity, whereas mutants such as C102S with an intact
Molecular Cell
804
strands as the protein translocates along DNA. Additionally, it is possible that the Fe-S cluster in the XPD family
helicases provides a mechanism for the coupling of ATP
hydrolysis with conformational changes necessary for
strand displacement. For example, as ATP is bound,
hydrolyzed, and ADP released, cyclical changes in the
oxidation state of the cluster could generate local
changes in protein conformation. Mechanistic details
for the coupling of ATP hydrolysis to strand displacement are not well understood for helicases generally.
Figure 3. ssDNA-Dependent ATPase Activity of XPD
(A) Rate of ATP hydrolysis by WT and two mutant forms of XPD in the
presence of double- and single-stranded phiX174 DNA. WT (black
circles), C88S (red triangles), and K84H (blue squares) XPD proteins
were assayed in the presence of ssDNA (filled symbols) and dsDNA
(open symbols). Data points are the means of triplicate measurements, with standard errors of the mean (SEM) indicated.
(B) Temperature dependence of the ssDNA-dependent ATPase
activity of WT XPD. Reactions contained 50 nM XPD and 5 nM of
a 70 nt oligonucleotide. SEM obtained from triplicate data points
are indicated.
cluster had WT activity. ATP hydrolysis is therefore uncoupled from strand displacement in mutants lacking
an Fe-S cluster. The Fe-S cluster of XPD (and by extension FancJ and the other helicases in this family) is thus
essential for DNA strand displacement by the enzyme.
Monomeric helicases are thought to catalyze strand
displacement by an ‘‘inchworm’’ mechanism that requires separate domains for ATP-dependent tracking
along ssDNA and for destabilization of duplex DNA
(Soultanas et al., 2000). SF2 helicases consist of two
conserved RecA-like motor domains that couple ATP
hydrolysis to DNA translocation (Singleton and Wigley,
2002). Additional unique domains confer substrate
specificity or mediate interactions with other proteins.
In XPD, the domain containing the Fe-S cluster is located
at a position equivalent to the b hairpin domain of the
bacterial NER helicase UvrB (Skorvaga et al., 2002),
which functions as a wedge, opening up the DNA double
helix (Figure 1C). Equivalent structures with similar predicted roles have been observed in the PcrA and T7
RNA polymerase, and the concept of a ‘‘molecular
ploughshare’’ for all DNA helicases has been proposed
(Takahashi et al., 2005). The Fe-S cluster in XPD therefore defines a domain that serves to separate DNA
Comparisons with Bacterial Helicases
The XPD and the UvrB helicases perform similar functions in NER in eukarya and bacteria, respectively.
They are both SF2 helicases, and the structure of UvrB
has been used to model the XPD structure (Bienstock
et al., 2003). In the modeled XPD structure, the area
equivalent to the b hairpin domain, which we now
know is responsible for Fe-S cluster binding, was difficult to build with confidence due to the weak sequence
similarity between the two enzymes in this region (Bienstock et al., 2003), and the four cysteines are not positioned appropriately for Fe-S cluster binding. The closest bacterial homolog of XPD is in fact the helicase
DinG, which shares the 50 –30 polarity of XPD and has
a role in DNA repair that is currently not clear (Voloshin
et al., 2003). Sequence analysis of a subset of DinG proteins from diverse bacterial species reveals the presence of four conserved cysteine residues between the
Walker A and B boxes (Figure S6), raising the possibility
that DinG, too, is an Fe-S protein, though this has yet
to be demonstrated experimentally.
Clinically Relevant Mutations of XPD and FancJ
Disrupt the Fe-S Cluster
The observation of an essential Fe-S cluster in the XPD
and FancJ helicases explains the phenotypes of several
clinically relevant mutations of these proteins. The
R112H variant of XPD, which is a common mutation in
TTD patients, has been shown to result in a loss of
XPD helicase activity and a concomitant defect in NER
(Dubaele et al., 2003), despite the fact that the mutation
lies outside the known helicase motifs and protein interaction domains of XPD and most human mutations of
XPD occur at the C terminus of the protein (Lehmann,
2001). Cells harboring the R112H XPD variant also
have reduced levels of TFIIH (Botta et al., 2002) and subtle changes in transcription that are thought to be responsible for the unusual differences in XP and TTD
pathology (Lehmann, 2001). In the archaeal XPD sequences, this residue is conserved as an arginine or
lysine residue positioned close to the first cysteine residue of the Fe-S cluster (Figure 1B). The equivalent mutation in SacXPD, K84H, abolishes the Fe-S cluster and
helicase activity of the protein (Figures 2A and 4). Our
data thus show that this residue is an important structural component of the Fe-S domain of XPD, providing
a molecular explanation for the loss of helicase activity
and the phenotype of the human mutation. The mutation
A349P in FancJ has been described in a patient with severe clinical symptoms of Fanconi anemia (Levran et al.,
2005). Although not a conserved residue, Ala-349 is directly adjacent to the last cysteine of the Fe-S cluster
(Figure 1B), and so mutation to a proline is likely to
Essential Fe-S Domain in XPD and FancJ Helicases
805
Figure 4. Helicase Activities of XPD Mutants
(A) Schematic of the helicase assay and substrate design.
(B) WT XPD is an ATP-dependent DNA helicase. The displaced DNA strand accumulates
over time upon incubation at 45 C. There is
no strand displacement in the absence of
ATP or XPD.
(C) Helicase activity of WT and mutant forms
of XPD. The K35A control mutant is inactive
as a helicase but has a stable Fe-S cluster.
For the four cysteine mutants, helicase activity correlates with the presence of a stable
Fe-S domain. Mutagenesis of SacXPD to
mimic the clinically relevant XPD mutation
R112H and FancJ mutation A349P destabilizes the Fe-S cluster and abolishes helicase
activity. The presence or absence of a stable
Fe-S cluster is indicated by a green or gray
circle, respectively.
(D) Quantification of the helicase activity of
WT and mutant XPD enzymes at 45 C. Each
data point represents the mean of triplicate
measurements, with SEM indicated. The
data were fitted with a smooth curve.
lead to a distortion of the local structure. Introduction of
a proline at the equivalent position in SacXPD (F136P)
destabilized the Fe-S cluster (Figure 2A) and abolished
the helicase activity of the enzyme (Figure 4), whereas
ATPase activity was similar to the WT (data not shown).
Thus, we predict that the phenotype of this mutation in
Fanconi anemia is due to destabilization of the Fe-S domain of the FancJ helicase, resulting in the loss of FancJ
helicase activity.
Disruption of the Yeast Rad3 Fe-S Cluster Causes UV
Sensitivity In Vivo
To confirm the importance of the Fe-S cluster in a eukaryal XPD ortholog, we introduced point mutations in
the yeast RAD3 gene. It has been demonstrated previously that point mutations of lysine 48 in the Walker A
box that inactivate the helicase activity of Rad3 are not
lethal in S. cerevisiae but are defective in NER and thus
have a repair deficient phenotype (Feaver et al., 1993).
We introduced three rad3 mutants into a rad3D null
background by plasmid shuffling (Sikorski and Boeke,
1991) and tested their sensitivity to UV light as a means
of monitoring their capacity for NER. As expected,
a mutant strain harboring the K48A substitution in the
Walker A box showed extreme UV sensitivity (Figure 5).
Mutation of the first cysteine residue in the Fe-S cluster
(C115S) resulted in UV sensitivity on par with the K48A
mutant, whereas the R111H mutation equivalent to the
human R112H mutation noted in TTD patients showed
a lesser but still highly significant UV-sensitive phenotype. This intermediate sensitivity reflects the observation that the mutation in the archaeal XPD destabilizes
the Fe-S cluster rather than abolishing binding completely. Similar data were obtained from studies of the
UV sensitivity of the R112H mutation in Schizosaccharomyces pombe Rad15 (the XPD ortholog in this organism)
(Berneburg et al., 2000). Thus, the Fe-S cluster in yeast
Rad3 is clearly important for the function of the protein
in vivo in the NER pathway, consistent with an important
role in DNA-strand displacement by the helicase.
Molecular Cell
806
Figure 5. Mutations of the Yeast Rad3p Fe-S
Domain Confer a UV-Sensitive Phenotype
Equivalent 10-fold serial dilutions of haploid
yeast strains containing the indicated WT or
mutant copies of RAD3 were spotted onto
YPD agar plates, irradiated with the indicated
flux of ultraviolet light, and photographed after 2 days growth at 26 C in the dark. Control,
no irradiation. Equivalent residue numbers in
SacXPD and Rad3 are K35 and K48, K84 and
R111, and C88 and C115, respectively.
Potential Implications for Iron-Storage Diseases
The new link reported here between DNA repair, transcription, and Fe-S proteins opens some intriguing possibilities. Tumor cells have a greater requirement for iron
than nontransformed cells, and iron chelation is an established therapy for the treatment of neoplastic cells (reviewed in Richardson [2005]). It is possible that changes
in the bioavailablity of iron could influence DNA repair
and gene expression through FancJ, RTel1, and XPD.
There may also be implications for our understanding of
inherited diseases that result in defective Fe-S cluster formation, the most common being Friedreich’s ataxia,
caused by triplet expansion in the frataxin gene, leading
to reduced cellular levels of the frataxin protein and consequently a reduction in the activities of Fe-S proteins
(Campuzano et al., 1997). Friedreich’s ataxia patients experience progressive neurodegeneration and a significantly reduced lifespan, with sporadic tumor development (reviewed in Thierbach et al. [2005]). Knockout of
the frataxin gene in murine hepatocytes causes increased
cellular proliferation and multiple hepatic tumors (Thierbach et al., 2005). Thus, although primarily considered
a mitochondrial disease, elements of the pathology of
Friedreich’s ataxia may be related to a reduction in activity of one or more of the four helicases we have identified
with essential Fe-S clusters, resulting in defects in DNA
repair, transcription, telomere maintenance, or other cellular processes. Given the wide variation in phenotypes
known for XPD mutations, defects caused by limiting
the assembly of Fe-S clusters could be quite subtle.
Conclusion
Fe-S clusters have not been identified previously in helicases, but we now have four examples of human helicases where an Fe-S domain appears to play an essential role in DNA strand displacement. We assume that
the cluster serves a structural role, stabilizing a domain
that acts as a molecular ‘‘ploughshare,’’ analogous to
the b hairpin domain in the distantly related bacterial
helicase UvrB. This is an unusual role for an Fe-S cluster,
which is more usually employed in redox-active forms
by enzymes. An alternative possibility is that the cluster
becomes redox active on DNA binding and may play
a role in the detection of DNA damage, as has been suggested for the DNA glycosylases with Fe-S clusters
(Boal et al., 2005). However, the fact that the Fe-S cluster
is present in four different helicases with different functions argues against this possibility, suggesting a more
generic role in the helicase mechanism. The presence
of an essential Fe-S cluster in XPD and FancJ explains
the phenotypes of inherited human mutations that inactivate these proteins in trichothiodystrophy and Fanconi
anemia and also raise the possibility of unexpected links
between DNA repair pathways and iron-storage diseases such as Friedreich’s ataxia. The fact that these
observations arose from the analysis of an archaeal enzyme emphasizes the utility of the archaea as a model
system for the study of conserved eukaryotic proteins.
Experimental Procedures
Cloning and Recombinant Protein Production
The xpd gene was amplified from Sulfolobus acidocaldarius genomic DNA by PCR and cloned into the pET28c vector by using
BamHI/NcoI recognition sites for expression of untagged recombinant protein in E. coli. Protein expression for WT and mutant
SacXPD proteins was carried out in BL21 Rosetta cells and induced
overnight for w14 hr at 28 C by addition of IPTG (0.2 mM). Cells were
lysed by sonication in column buffer (20 mM MES [pH 6.0], 200 mM
NaCl, 1 mM DTT, and 1 mM EDTA) and 1 mM benzamidine. The
lysate was centrifuged (48,000 3 g, 20 min, 4 C), heat treated
(65 C, 20 min), and centrifuged for a further 20 min. The protein
was bound to a heparin column (HiTrap 5 ml Heparin HP, Amersham
Biosciences) and eluted with a linear gradient of sodium chloride
(1 M). Fractions containing the SacXPD protein were identified by
SDS-PAGE, pooled, and purified to homogeneity by using a HiLoad
26/60 Superdex 200 size exclusion column (GE Healthcare) equilibrated with gel filtration buffer (20 mM Tris [pH 7.8], 200 mM NaCl,
1 mM EDTA, and 1 mM DTT). All proteins were analyzed by electrospray mass spectrometry to confirm the expected molecular
masses. The protein sample (20 ml, 5 pM/ml) was desalted on line
through an XTerra MS C8 2.1 3 10 mm column, eluting with an
increasing acetonitrile concentration (2% acetonitrile, 98% aqueous
1% formic acid to 98% acetonitrile 2% aqueous 1% formic acid) and
delivered to an electrospray ionization mass spectrometer (LCT,
Micromass, Manchester, UK), which had previously been calibrated
with myoglobin. An envelope of multiply charged signals was obtained and deconvoluted by using MaxEnt1 software to give the
molecular mass of the protein. sacxpd and yeast rad3 mutants
were generated by using the XL QuikChange Mutagenesis Kit
(Stratagene). Mutations were confirmed by sequencing and mass
spectrometry. Full details of the oligonucleotides used for cloning
and mutagenesis are available from the corresponding author on
request.
EPR
EPR spectra were obtained on a Bruker X-band (cw) EPR spectrometer with spectrometer settings as reported in the figure legends.
Sample temperature was regulated by a liquid helium transfer system. For EPR spectroscopy, SacXPD (95 mM) was treated with either
1 mM potassium ferricyanide (oxidant) or 1 mM dithionite (reductant)
and incubated on ice for 5 min in 3 mm quartz EPR tubes before being quick-frozen and stored under liquid nitrogen until use.
Essential Fe-S Domain in XPD and FancJ Helicases
807
Inductively Coupled Plasma-Optical Emission Spectrometry
The elemental analysis of the Fe-S cluster bound to SacXPD was
carried out on a PerkinElmer Optima 5300 ICP-OES. Protein was
purified as described above except that buffers were free of DTT
and the NaCl concentration of the buffer was lowered to 100 mM
during gel filtration. Standards used for standard curves contained
0.5, 1, 2, 3, 5, and 10 ppm of iron and sulfur. The Fe:S ratio of 10
mM SacXPD in gel filtration buffer was measured by comparing
emission intensities with the standard curves. The blank contained
gel filtration buffer only.
Iron Chelation Assay
Iron bound to SacXPD was quantified by using the bathophenanthroline method. Briefly, 100 ml of 50 mM protein in gel filtration buffer
was mixed with 30 ml concentrated HCl and heated for 15 min at
100 C. The control reaction contained buffer only. After a 2 min centrifugation at 13,000 3 g, 100 ml supernatant was transferred into a 2
ml tube and 1.3 ml 500 mM Tris-HCl (pH 8.5) was added. Freshly
prepared 5% ascorbic acid (100 ml) and 0.1% bathophenanthroline
(400 ml) were then added. Samples were mixed thoroughly after every addition. Reactions were incubated 1 hr at room temperature
and the absorbance measured at 535 nm. To calculate the number
of moles of iron bound to XPD, the molar extinction coefficient for
bathophenanthroline of 22,369 mol21 cm21 was used (Pieroni et al.,
2001).
Helicase Assays
For construction of 50 overhang DNA substrates, a 25 nt long oligonucleotide (B25, sequence 50 - CCTCGAGGGATCCGTCCTAGCAAGC30 ) was 50 -[32P]-end-labeled and annealed to the 30 end of a 50 nt
long oligonucleotide (X50, sequence 50 - GCTCGAGTCTAGACTGCA
GTTGA GAGCTTGCTAGGACGGATCCCTCGAGG-30 ) by slow cooling from 85 C to room temperature and purified by gel electrophoresis as described previously (Roberts et al., 2003). Helicase assays
were carried out at 45 C in 20 mM MES (pH 6.5), 1 mM DTT,
0.1 mg/ml BSA, 10 nM 32P-labeled DNA substrate, and 200 nM protein, and reactions started by addition of a MgCl2/ATP (1 mM final
concentration). At specific time points, 10 ml samples were taken
and immediately added to 20 ml of chilled stop solution (10 mM
Tris-HCl [pH 8], 5 mM EDTA, 5 mM competitor DNA [B25 oligo],
0.5% SDS, and 1 mg/ml proteinase K) and incubated for 15 min at
room temperature to allow proteinase K digestion. Samples were
separated on a native 12% acrylamide:TBE gel for 2 hr at 130 V
and quantified by phosphorimaging.
ATPase Assays
Reactions for ATPase assays contained 20 mM MES (pH 6.5), 1 mM
DTT, 0.1 mg/mL BSA, 50 nM protein, and 0.5 nM DNA in 300 ml total
volume. PhiX174 virion DNA (NEB) and PhiX174 RFII DNA were used
as ssDNA and dsDNA substrates, respectively. Reactions were incubated at 45 C for 1 min and started by adding ATP/MgCl2 to a final
concentration of 1 mM. At specific time points, 40 ml samples were
taken and immediately added to 40 ml 0.3 M chilled perchloric acid
on a 96-well plate. After equilibration to room temperature, malachite green was added (20 mL) and the absorbance at 650 nm was
measured on a SpectraMAX 250 Microplate Reader (Molecular Devices) after 12 min incubation at room temperature. For each reaction a blank without XPD was quantified and subtracted as background from the sample reactions. All experiments were carried
out in triplicate. Temperature-dependence assays (Figure 3B) were
carried out with WT protein and the set up described above. A
70-mer oligonucleotide (5 nM oligonucleotide concentration) was
used for ssDNA stimulation and only one time point taken after
2 min incubation.
Yeast Rad3
A PCR fragment containing Saccharomyces cerevisiae RAD3 (including 492 bp upstream and 20 bp downstream of the ORF) was
cloned into vector TOPO 2.1 by using the TOPO TA Cloning System
(Invitrogen). The gene was excised from the TOPO vector by using
SphI and XhoI (which cleaved flanking sites that had been incorporated with the PCR primers); the RAD3 fragment was gel purified and
then subcloned into the SphI/SalI cloning sites of the yeast shuttle
vectors YCplac33 and YCplac111 (Gietz and Sugino, 1988). All con-
structs were sequenced fully. One copy of RAD3 in the Saccharomyces cerevisiae WT W303 diploid strain AYS927 (MATa/MATa ade2-1/
ade2-1 his3-11, 15/his3-11, 15 leu2-3, 112/leu2-3, 112 trp1-1/trp1-1
ura3-1/ura3-1 can1-100/can1-100 ssd1-d2/ssd1-d2 Gal+) (Black
et al., 1995) was deleted by using a PCR fragment generated with
pFA6a-His3MX6 as template and primers designed from the RAD3
flanking sequences to direct precise replacement of the RAD3
ORF with the HIS3MX marker (Longtine et al., 1998), generating
strain VMYD100. After verification of the rad3D::HIS3MX6/RAD3 status of VMYD100 by PCR, the strain was transformed with the URA3marked plasmid YCplac33 (Gietz and Sugino, 1988) containing the
RAD3 gene (YCplac33-RAD3). Haploid rad3::HIS3MX disruptants
containing YCplac33-RAD3 were then obtained by sporulation and
tetrad dissection, and one such segregant was transformed with derivatives of the LEU2-marker plasmid YCplac111 (Gietz and Sugino,
1988) carrying either WT RAD3 or mutant derivatives (R111H, K48A,
and C115S). After two rounds of YCplac33-RAD3 counterselection
using 5-fluoroorotic acid (Sikorski and Boeke, 1991), six independently derived isolates dependent solely on the YCplac111-RAD3
plasmids for RAD3 function were identified. UV sensitivity was
tested by plating 5 ml spots of equivalent, 10-fold serial dilutions of
yeast cultures (starting OD600 of 0.5) onto YPD agar plates, followed
by irradiation using an XL-1000 UV crosslinker (Spectronics Corporation) at UV (l = 254 nm) at doses of 0–60 J/m2. Plates were photographed after 2 days incubation in the dark at 26 C.
Supplemental Data
Supplemental Data include Supplemental Experimental Procedures,
Supplemental References, three figures, and one table and can be
found with this article online at http://www.molecule.org/cgi/
content/full/23/6/801/DC1/.
Acknowledgments
Thanks to Prof. Steve Chapman for help with the ICP-OES, Dr David
Keeble for access to the EPR spectrometer, Dr Sharon Kelly for CD
spectroscopy, and Dr Catherine Botting for mass spectrometry
services. Thanks to Mark Dillingham for pointing out the similarity
between XPD and DinG. This work was funded by the Association
for International Cancer Research and the Biotechnology and
Biological Sciences Research Council. Mass spectrometry at St
Andrews is funded by the Wellcome Trust.
Received: March 10, 2006
Revised: May 26, 2006
Accepted: July 13, 2006
Published: September 14, 2006
References
Berneburg, M., Clingen, P.H., Harcourt, S.A., Lowe, J.E., Taylor,
E.M., Green, M.H., Krutmann, J., Arlett, C.F., and Lehmann, A.R.
(2000). The cancer-free phenotype in trichothiodystrophy is unrelated to its repair defect. Cancer Res. 60, 431–438.
Bienstock, R.J., Skorvaga, M., Mandavilli, B.S., and Van Houten, B.
(2003). Structural and functional characterization of the human DNA
repair helicase XPD by comparative molecular modeling and sitedirected mutagenesis of the bacterial repair protein UvrB. J. Biol.
Chem. 278, 5309–5316.
Black, S., Andrews, P.D., Sneddon, A.A., and Stark, M.J. (1995). A
regulated MET3-GLC7 gene fusion provides evidence of a mitotic
role for Saccharomyces cerevisiae protein phosphatase 1. Yeast
11, 747–759.
Boal, A.K., Yavin, E., Lukianova, O.A., O’Shea, V.L., David, S.S., and
Barton, J.K. (2005). DNA-bound redox activity of DNA repair glycosylases containing [4Fe-4S] clusters. Biochemistry 44, 8397–8407.
Botta, E., Nardo, T., Lehmann, A.R., Egly, J.M., Pedrini, A.M., and
Stefanini, M. (2002). Reduced level of the repair/transcription factor
TFIIH in trichothiodystrophy. Hum. Mol. Genet. 11, 2919–2928.
Campuzano, V., Montermini, L., Lutz, Y., Cova, L., Hindelang, C., Jiralerspong, S., Trottier, Y., Kish, S.J., Faucheux, B., Trouillas, P., et al.
(1997). Frataxin is reduced in Friedreich ataxia patients and is
Molecular Cell
808
associated with mitochondrial membranes. Hum. Mol. Genet. 6,
1771–1780.
Cantor, S., Drapkin, R., Zhang, F., Lin, Y., Han, J., Pamidi, S., and Livingston, D.M. (2004). The BRCA1-associated protein BACH1 is
a DNA helicase targeted by clinically relevant inactivating mutations.
Proc. Natl. Acad. Sci. USA 101, 2357–2362.
Sikorski, R.S., and Boeke, J.D. (1991). In vitro mutagenesis and plasmid shuffling: from cloned gene to mutant yeast. Methods Enzymol.
194, 302–318.
Singleton, M.R., and Wigley, D.B. (2002). Modularity and specialization in superfamily 1 and 2 helicases. J. Bacteriol. 184, 1819–1826.
Skibbens, R.V. (2004). Chl1p, a DNA helicase-like protein in budding
yeast, functions in sister-chromatid cohesion. Genetics 166, 33–42.
Cantor, S.B., Bell, D.W., Ganesan, S., Kass, E.M., Drapkin, R., Grossman, S., Wahrer, D.C., Sgroi, D.C., Lane, W.S., Haber, D.A., and Livingston, D.M. (2001). BACH1, a novel helicase-like protein, interacts
directly with BRCA1 and contributes to its DNA repair function. Cell
105, 149–160.
Skorvaga, M., Theis, K., Mandavilli, B.S., Kisker, C., and Van Houten,
B. (2002). The beta -hairpin motif of UvrB is essential for DNA binding, damage processing, and UvrC-mediated incisions. J. Biol.
Chem. 277, 1553–1559.
Ding, H., Schertzer, M., Wu, X., Gertsenstein, M., Selig, S., Kammori,
M., Pourvali, R., Poon, S., Vulto, I., Chavez, E., et al. (2004). Regulation of murine telomere length by Rtel: an essential gene encoding
a helicase-like protein. Cell 117, 873–886.
Soultanas, P., Dillingham, M.S., Wiley, P., Webb, M.R., and Wigley,
D.B. (2000). Uncoupling DNA translocation and helicase activity
in PcrA: direct evidence for an active mechanism. EMBO J. 19,
3799–3810.
Dubaele, S., Proietti De Santis, L., Bienstock, R.J., Keriel, A., Stefanini, M., Van Houten, B., and Egly, J.M. (2003). Basal transcription
defect discriminates between xeroderma pigmentosum and trichothiodystrophy in XPD patients. Mol. Cell 11, 1635–1646.
Takahashi, T.S., Wigley, D.B., and Walter, J.C. (2005). Pumps, paradoxes and ploughshares: mechanism of the MCM2-7 DNA helicase.
Trends Biochem. Sci. 30, 437–444.
Feaver, W.J., Svejstrup, J.Q., Bardwell, L., Bardwell, A.J., Buratowski, S., Gulyas, K.D., Donahue, T.F., Friedberg, E.C., and Kornberg,
R.D. (1993). Dual roles of a multiprotein complex from S. cerevisiae
in transcription and DNA repair. Cell 75, 1379–1387.
Thayer, M.M., Ahern, H., Xing, D., Cunningham, R.P., and Tainer, J.A.
(1995). Novel DNA binding motifs in the DNA repair enzyme endonuclease III crystal structure. EMBO J. 14, 4108–4120.
Gietz, R.D., and Sugino, A. (1988). New yeast-Escherichia coli shuttle
vectors constructed with in vitro mutagenized yeast genes lacking
six-base pair restriction sites. Gene 74, 527–534.
Thierbach, R., Schulz, T.J., Isken, F., Voigt, A., Mietzner, B., Drewes,
G., von Kleist-Retzow, J.C., Wiesner, R.J., Magnuson, M.A., Puccio,
H., et al. (2005). Targeted disruption of hepatic frataxin expression
causes impaired mitochondrial function, decreased life span, and
tumor growth in mice. Hum. Mol. Genet. 14, 3857–3864.
Hinks, J.A., Evans, M.C., De Miguel, Y., Sartori, A.A., Jiricny, J., and
Pearl, L.H. (2002). An iron-sulfur cluster in the family 4 uracil-DNA
glycosylases. J. Biol. Chem. 277, 16936–16940.
Tirode, F., Busso, D., Coin, F., and Egly, J.M. (1999). Reconstitution
of the transcription factor TFIIH: assignment of functions for the
three enzymatic subunits, XPB, XPD, and cdk7. Mol. Cell 3, 87–95.
Hirota, Y., and Lahti, J.M. (2000). Characterization of the enzymatic
activity of hChlR1, a novel human DNA helicase. Nucleic Acids
Res. 28, 917–924.
Truglio, J.J., Karakas, E., Rhau, B., Wang, H., DellaVecchia, M.J.,
Van Houten, B., and Kisker, C. (2006). Structural basis for DNA recognition and processing by UvrB. Nat. Struct. Mol. Biol. 13, 360–364.
Kowal, A.T., Werth, M.T., Manodori, A., Cecchini, G., Schroder, I.,
Gunsalus, R.P., and Johnson, M.K. (1995). Effect of cysteine to serine mutations on the properties of the [4Fe-4S] center in Escherichia
coli fumarate reductase. Biochemistry 34, 12284–12293.
Voloshin, O.N., Vanevski, F., Khil, P.P., and Camerini-Otero, R.D.
(2003). Characterization of the DNA damage-inducible helicase
DinG from Escherichia coli. J. Biol. Chem. 278, 28284–28293.
Kuo, C.F., McRee, D.E., Fisher, C.L., O’Handley, S.F., Cunningham,
R.P., and Tainer, J.A. (1992). Atomic structure of the DNA repair
[4Fe-4S] enzyme endonuclease III. Science 258, 434–440.
Lehmann, A.R. (2001). The xeroderma pigmentosum group D (XPD)
gene: one gene, two functions, three diseases. Genes Dev. 15, 15–23.
Levitus, M., Waisfisz, Q., Godthelp, B.C., de Vries, Y., Hussain, S.,
Wiegant, W.W., Elghalbzouri-Maghrani, E., Steltenpool, J., Rooimans, M.A., Pals, G., et al. (2005). The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. Nat. Genet. 37,
934–935.
Levran, O., Attwooll, C., Henry, R.T., Milton, K.L., Neveling, K., Rio,
P., Batish, S.D., Kalb, R., Velleuer, E., Barral, S., et al. (2005). The
BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia.
Nat. Genet. 37, 931–933.
Litman, R., Peng, M., Jin, Z., Zhang, F., Zhang, J., Powell, S., Andreassen, P.R., and Cantor, S.B. (2005). BACH1 is critical for homologous recombination and appears to be the Fanconi anemia gene
product FANCJ. Cancer Cell 8, 255–265.
Longtine, M.S., McKenzie, A., III, Demarini, D.J., Shah, N.G., Wach,
A., Brachat, A., Philippsen, P., and Pringle, J.R. (1998). Additional
modules for versatile and economical PCR-based gene deletion
and modification in Saccharomyces cerevisiae. Yeast 14, 953–961.
Lukianova, O.A., and David, S.S. (2005). A role for iron-sulfur clusters
in DNA repair. Curr. Opin. Chem. Biol. 9, 145–151.
Pieroni, L., Khalil, L., Charlotte, F., Poynard, T., Piton, A., Hainque,
B., and Imbert-Bismut, F. (2001). Comparison of bathophenanthroline sulfonate and ferene as chromogens in colorimetric measurement of low hepatic iron concentration. Clin. Chem. 47, 2059–2061.
Richardson, D.R. (2005). Molecular mechanisms of iron uptake by
cells and the use of iron chelators for the treatment of cancer.
Curr. Med. Chem. 12, 2711–2729.
Roberts, J.A., Bell, S.D., and White, M.F. (2003). An archaeal XPF
repair endonuclease dependent on a heterotrimeric PCNA. Mol.
Microbiol. 48, 361–371.
Winkler, G.S., Araujo, S.J., Fiedler, U., Vermeulen, W., Coin, F., Egly,
J.M., Hoeijmakers, J.H., Wood, R.D., Timmers, H.T., and Weeda, G.
(2000). TFIIH with inactive XPD helicase functions in transcription initiation but is defective in DNA repair. J. Biol. Chem. 275, 4258–4266.