Protein Kinase A–Dependent Biophysical Phenotype for
V227F-KCNJ2 Mutation in Catecholaminergic Polymorphic
Ventricular Tachycardia
Amanda L. Vega, PhD; David J. Tester, BS;
Michael J. Ackerman, MD, PhD; Jonathan C. Makielski, MD
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
Background—KCNJ2 encodes Kir2.1, a pore-forming subunit of the cardiac inward rectifier current, IK1. KCNJ2
mutations are associated with Andersen-Tawil syndrome and catecholaminergic polymorphic ventricular tachycardia.
The aim of this study was to characterize the biophysical and cellular phenotype of a KCNJ2 missense mutation, V227F,
found in a patient with catecholaminergic polymorphic ventricular tachycardia.
Methods and Results—Kir2.1-wild-type (WT) and V227F channels were expressed individually and together in Cos-1
cells to measure IK1 by voltage clamp. Unlike typical Andersen-Tawil syndrome–associated KCNJ2 mutations, which
show dominant negative loss of function, Kir2.1WT⫹V227F coexpression yielded IK1 indistinguishable from
Kir2.1-WT under basal conditions. To simulate catecholamine activity, a protein kinase A (PKA)-stimulating cocktail
composed of forskolin and 3-isobutyl-1-methylxanthine was used to increase PKA activity. This PKA-simulated
catecholaminergic stimulation caused marked reduction of outward IK1 compared with Kir2.1-WT. PKA-induced
reduction in IK1 was eliminated by mutating the phosphorylation site at serine 425 (S425N).
Conclusions—Heteromeric Kir2.1-V227F and WT channels showed an unusual latent loss of function biophysical
phenotype that depended on PKA-dependent Kir2.1 phosphorylation. This biophysical phenotype, distinct from typical
Andersen-Tawil syndrome mutations, suggests a specific mechanism for PKA-dependent IK1 dysfunction for this
KCNJ2 mutation, which correlates with adrenergic conditions underlying the clinical arrhythmia. (Circ Arrhythmia
Electrophysiol. 2009;2:540-547.)
Key Words: K-channel 䡲 arrhythmia (mechanisms) 䡲 long QT syndrome 䡲 Andersen-Tawil syndrome
䡲 catecholaminergic polymorphic ventricular tachycardia
T
he gene KCNJ2 gene encodes the pore-forming subunit
of the human inwardly rectifying potassium channel
Kir2.1, which underlies the inward rectifier potassium current, IK1.1 Autosomal dominant loss-of-function mutations in
KCNJ2 represent the solely identified cause thus far for the
heritable arrhythmia syndrome called Andersen-Tawil syndrome (ATS),2 whereas gain-of-function mutations in KCNJ2
have been implicated in the pathogenesis of short-QT
syndrome (SQT3)3 and familial atrial fibrillation.4 Classically, ATS presents with a triad of cardiac arrhythmia and
prolonged QU intervals, dysmorphic features, and periodic
paralysis. Phenotype severity among ATS patients varies,5
however, with some patients presenting with only 1
symptom and other genotype-positive individuals completely nonpenetrant.
Clinical Perspective on p 547
Catecholaminergic polymorphic ventricular tachycardia
(CPVT) is an inherited arrhythmia syndrome characterized by
adrenergically mediated bidirectional or polymorphic ventricular tachycardia that causes syncope and sudden cardiac
arrest in the absence of structural heart defects among the
young.6 Approximately 50% to 60% of CPVT patients harbor
mutations in 1 of 2 critical calcium handling genes: the
cardiac ryanodine receptor (RYR2)7 or calsequestrin-2
(CASQ2),8,9 whereas the remaining 40% have no known
genetic cause.10 Ventricular arrhythmias in ATS have demonstrated an uncanny similarity to the ventricular arrhythmias
observed in CPVT such as bidirectional tachycardia and
exercise-induced arrhythmia.5 This can be a source of diagnostic confusion with CPVT. Previously, we identified mu-
Received April 10, 2009; accepted July 30, 2009.
From the Departments of Medicine (Cardiovascular Medicine) and Physiology (J.C.M.), University of Wisconsin (A.L.V.), Madison, Wis; the
Departments of Medicine, Pediatrics, and Molecular Pharmacology and Experimental Therapeutics/Divisions of Cardiovascular Diseases and Pediatric
Cardiology (D.J.T., M.J.A.), Mayo Clinic, Rochester, Minn; and the Department of Physiology and Biophysics (A.L.V.), University of Washington,
Seattle, Wash. Current address for Dr Vega is the Department of Physiology and Biophysics, University of Washington, Seattle, Wash.
Guest Editor for this article was Douglas P. Zipes, MD.
Correspondence to Jonathan C. Makielski, MD, University of Wisconsin Hospital and Clinics, Division of Cardiovascular Medicine, H6/362 MC 3248,
600 Highland Ave, Madison, WI 53792. E-mail [email protected]
© 2009 American Heart Association, Inc.
Circ Arrhythmia Electrophysiol is available at http://circep.ahajournals.org
540
DOI: 10.1161/CIRCEP.109.872309
Vega et al
V227F-KCNJ2 Mutation and CPVT
541
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
tations in KCNJ2 among 3 of 11 unrelated patients that were
clinically diagnosed with CPVT11 and suggested phenotypic
mimicry. Two patients had R82W, a mutation previously
found in a long-QT syndrome cohort and showing a
dominant-negative loss of function typical of ATS.12 The
other was a previously uncharacterized, missense mutation in
KCNJ2 causing the valine at position 227 to be substituted by
phenylalanine in Kir2.1 (Kir2.1-V227F).
Here, we characterize the biophysical and cellular phenotypes of Kir2.1-V227F and show that when coexpressed with
wild-type channels (Kir2.1-WT), the mutation caused no
abnormal phenotype under control conditions. However,
protein kinase A (PKA) activation, a cellular consequence of
adrenergic stimulation, caused a latent loss of function
biophysical phenotype that was abrogated by a mutation that
eliminated phosphorylation at S425 on Kir2.1. This phenotype, distinct from typical ATS mutations,12 provides a new
specific mechanism for PKA dependence of IK1 dysfunction
for this KCNJ2 mutation in a CPVT patient.
Methods
Mutagenesis
The Kir2.1-V227F, Kir2.1-S425N, and Kir2.1-AAA (AAA for pore
GYG) mutations were introduced into the human Kir2.1 using a
Quik Change Site-Directed Mutagenesis kit (Stratagene). The following primer pairs were used to mutate the targeted sites in
the cDNA:
●
●
●
●
●
●
V227F-F, TTGGTGGAAGCTCATTTTCGAGCACAGCTCCTC;
V227F-R, CAGGAGCTGTGTGCTCGAAAATGAGCTTCCACCAA;
S425N-F, CGGCGAGAACGAGATATGAAAGGGC;
S425N-R, GCCCTTTCATATCTCGTTCTCTGCCCG;
AAA-F, CAGACAACCATAGCCGCTGCCTTCAGATGTGTC;
and
AAA-R, GACACATCTGAAGGCAGCGGCTATGGTTATGGTTGTCTG.
The S425N mutation was also introduced into the cDNA of both
Kir2.1 WT and Kir2.1-V227F. Mutants were generated using the
protocol outlined by the manufacturer (Stratagene). DNA integrity
was verified by sequencing.
Figure 1. Twelve-lead ECGs (A) and selected tracings from a
treadmill stress test (B) for the CPVT patient with V227F-KCNJ2
mutation.
superfused with PKA cocktail bath solution for 5 minutes. IK1 was
recorded again in the presence of the PKA cocktail and after the PKA
cocktail was washed out over a 10-minute period. All currents
returned to basal levels after complete washout of PKA cocktail. In
a set of parallel experiments, the cells were perfused for 2 hours with
the PKA cocktail and compared with cells in control media.
Statistical Analysis
The key biological questions asked is whether current density at ⫺40
mV and ⫺60 mV (the physiological range of importance) were
affected by the mutation or by exposure to PKA. Data are expressed
as mean⫾SEM and analyzed using an unpaired Student t test. Where
indicated, a 1-way ANOVA was used to compare 3 means among
different channel types. Values of Pⱕ0.05 were considered
significant.
Results
Cos-1 Transfection and Culture
Cos-1 cells were transfected (Superfect Transfection Kit, Qiagen)
with Kir2.1 cDNA and cultured in modified Dulbecco modified
Eagle’s medium, as previously described.12
Electrophysiology
IK1 was recorded from Cos-1 cells using an Axopatch 200B amplifier
(Axon Instruments) as previously described.12 The protocol for
recording IK1 from Cos-1 cells was to hold the cell at a potential of
⫺70 mV and run a step protocol from ⫺140 mV to ⫹40 mV in 20
mV increments for 100 ms. The extracellular solution contained (in
mM) 140 NaCl, 5.4 KCl, 1.8 CaCl2, 0.5 MgCl2, 5 HEPES, 0.33
NaH2PO4, 5.5 glucose, and the pH adjusted to 7.4. The microelectrodes were created from borosilicate glass capillaries that after fire
polishing had a resistance of 1.0 to 2.1 M⍀ when filled with internal
solution. The internal solution contained (in mM) 30 KCl, 85
K-aspartate, 5 MgCl2, 10 KH2PO4, 2 K2EGTA, 2 K2ATP, 5 HEPES,
and the pH adjusted to 7.2. All recordings were performed at
room temperature.
A PKA cocktail (100 ␮mol/L forskolin ⫹ 10 ␮mol/L 3-isobutyl1-methylxanthine; Sigma-Aldrich) was prepared in DMSO and
diluted in bath solution. After successful whole-cell access IK1was
recorded in control bath solution and the bath was immediately
A CPVT Patient With Kir2.1-V227F
Previously, we identified the mutation Kir2.1-V227F in a
female patient referred for CPVT genetic testing.11 The
32-year-old white female was genotype-negative for mutations in the 2 CPVT-susceptibility genes (RYR2 and CASQ2)
and also negative for the principal long-QT syndrome susceptibility genes (LQT1-6). The patient was heterozygous for
a missense mutation in the ATS-susceptibility gene KCNJ2
annotated as Kir2.1-V227F. The proband had no evidence of
periodic paralysis or dysmorphism to suggest ATS. Instead,
the proband had a history of exertion/emotion-triggered
syncope and presyncope that had been documented since the
age of 2 years. The subject also had palpitations, ventricular
tachycardia, and mild mitral and tricuspid insufficiency. Her
resting 12-lead ECG had U waves in lead II (Figure 1A), and
exercise stress testing revealed frequent ventricular ectopy,
ventricular bigeminy, ventricular couplets, 3-beat runs of
polymorphic ventricular tachycardia suggestive of bidirectional ventricular tachycardia, and nonsustained ventricular
542
Circ Arrhythmia Electrophysiol
October 2009
Figure 2. Kir2.1-V227F has distinct
molecular phenotype for IK1. A, Representative IK1 traces for the Kir2.1-WT, Kir2.1V227F and coexpressed Kir2.1WT⫹Kir2.1-V227F. B, Current-voltage (IV)
plots for Kir2.1-WT (closed squares;
n⫽14), Kir2.1-V227F (closed circles;
n⫽16), and coexpressed Kir2.1WT⫹V227F (closed triangles; n⫽18)
expressed in Cos-1 cells. Inset shows
detail of outward currents. V227F significantly reduces current amplitudes of
homomeric channels but heteromeric
channels are the same as WT. *P⬍0.05
by ANOVA for V227F versus both WT and
WT⫹V227F.
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
tachycardia (Figure 1B). The proband had a defibrillator
implanted and at last follow-up was taking oral bisoprolol (5
mg) to treat cardiac symptoms. The maternal family history
and progeny is unremarkable, but they have not been genotyped. Paternal history is unavailable.
Kir2.1-WT or Kir2.1-V227F both caused a strong dominantnegative reduction of IK1. These results support the idea that
Kir2.1-V227F interacted with Kir2.1-WT to form a multimeric pore.
Abnormal Phenotype Depends on PKA Activation
Kir2.1-V227F Mutation Has a Distinct Molecular
Phenotype for IK1
Expression of Kir2.1-V227F in Cos-1 cells formed functional
pores in contrast to the majority of ATS-associated Kir2.1
mutant channels that show negligible current.12 Inward IK1
for Kir2.1-V227F was significantly reduced by ⬇40% in
comparison to Kir2.1-WT, as shown by the current traces
(Figure 2A) and summary peak current-voltage plots (Figure
2B). Over the physiological range of terminal repolarization
(⫺40mV to ⫺60mV), outward IK1 was decreased 85% to
99% in comparison to Kir2.1-WT (Figure 2B inset).
The normal IK1 phenotype of Kir2.1-WT⫹Kir2.1-V227F
under basal conditions did not leave a plausible explanation
for the arrhythmia phenotype observed in the patient. The
possibility of V227F being a rare variant was considered, but
the mutant was absent from more than 800 reference alleles.10
Kir2.1-V227F and Kir2.1-WT Interact to Form
Multimeric Pore
Inward rectifier potassium channels are formed by the assembly of 4 subunits allowing for heteromeric pores containing
both WT and mutant subunits. The patient was heterozygous
with both a mutant V227F allele and a WT allele, so we
examined heteromeric channels by coexpression studies. In
contrast to most ATS-associated Kir2.1 mutations that show
a dominant negative decrease in IK1,5,12 IK1 from heteromeric
channels produced by coexpression of Kir2.1-V227F with
Kir2.1-WT was statistically indistinguishable from
Kir2.1-WT (Figure 2). To exclude the possibility that this
normal-appearing IK1 was caused by the failure of Kir2.1V227F to interact with Kir2.1-WT, we used a dominantnegative approach as previously described.13 We introduced
the dominant-negative mutation, AAA, to remove the potassium selectivity filter (GYG) in both WT and mutant cDNA.
Expression of Kir2.1-AAA alone yielded no potassium currents (Figure 3), as expected. Expression of Kir2.1-AAA with
Figure 3. IK1 measured from Cos-1 cells transfected with the
dominant negative mutation Kir2.1-AAA. A, Representative
traces from Kir2.1-AAA, coexpressed Kir2.1-WT, and Kir2.1-AAA
and coexpressed Kir2.1-V227F and Kir2.1-AAA. B, Peak current
relationships for Kir2.1-AAA (open circles), coexpressed
Kir2.1-WT and Kir2.1-AAA (open squares) coexpressed Kir2.1V227F (open triangles). For comparison, the relationships for
Kir2.1WT (closed squares) and Kir2.1V227F⫹Kir2.1WT (closed
triangles) are shown. These results show that Kir2.1-AAA shows
dominant negative suppression of Kir2.1-V227F, suggesting that
the V227F mutant channel coassembles with other Kir2.1
subunits.
Vega et al
V227F-KCNJ2 Mutation and CPVT
543
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
Figure 4. PKA activation reduced outward IK1 for heteromeric Kir2.1 WT⫹V227F channels. From each cell, a complete IV plot was
obtained before (closed symbols) and after (open symbols) 5 minutes of PKA activation. A, Representative current after (bottom row) 5
minutes of PKA activation. Peak IV plots for Kir2.1-WT (squares, n⫽6) (B), Kir2.1-V227F (circles, n⫽9) (C), and coexpressed Kir2.1WT⫹V227F (triangles, n⫽7) (D). PKA activity significantly decreased inward IK1 for all groups. PKA tended (not significant) to increase
outward IK1 for WT (B, inset) and did not affect outward IK1 for V227F but significantly decreased outward IK1 for Kir2.1-WT⫹V227F (D,
inset). *P⬍0.05.
Also, the homomeric V227F currents were reduced (Figure
2), supporting the possibility of a latent pathological defect.
For CPVT, increased catecholamine activity is a characteristic clinical feature for arrhythmia. Therefore, we used a
PKA-activating cocktail (100 ␮mol/L forskolin ⫹ 10 ␮mol/L
3-isobutyl-1-methylxanthine) in the Cos-1 cells to mimic
adrenergic stimulation. IK1 was measured before and after 5
minutes of exposure to PKA activation. PKA activation
caused a significant reduction (Pⱕ0.05) of inward IK1 for
Kir2.1-WT (35%), Kir2.1-V227F (35%), and Kir2.1WT⫹Kir2.1-V227F (56%) in comparison to basal conditions
(Figure 4). Outward IK1 in the physiological range is of
particular interest. In WT channels, PKA caused an increase
in outward IK1 (Figure 4B inset), whereas in the heteromeric
channels outward IK1 was decreased by 73% and 68% (at
⫺60mV and ⫺40 mV respectively; Figure 4D inset). The
vehicle control solution (DMSO 1%) and timed control
experiments (where no solution was added) showed no
significant effects on IK1 (data not shown). The effects on IK1
were reversible after a 10-minute washout (data not shown).
After longer exposure to PKA stimulation (2 hours) the
outward IK1 of Kir2.1-WT channels was not affected, but
heteromeric channels showed (Figure 5) a significant decrease in agreement with experiments after 5 minutes of
exposure.
Mutation of Serine 425 on Kir2.1 Abrogates
PKA Effect
We hypothesized that the PKA-induced effects on IK1 density
were mediated by a direct phosphorylation of the channel.
The single known PKA consensus motif, S425 on Kir2.1, has
been shown to regulate PKA effects on IK1.14 We mutated
S425 to an asparagine (S425N) in both Kir2.1-WT and
Kir2.1-V227F to prevent phosphorylation. The introduced
mutation had no impact on Kir2.1-WT function in the
absence of PKA (data not shown) and prevented PKAmediated effects on homomeric Kir2.1-WT channels (Figure
6A and 6B) in agreement with previously published results.14
The S425N mutation abrogated the PKA-mediated inhibition
of IK1 for heteromeric WT and V227F channels when it was
544
Circ Arrhythmia Electrophysiol
October 2009
Environmental and regulatory factors have been previously
reported to trigger or exacerbate inherited arrhythmia. For
example, increased temperature exacerbated an already abnormal biophysical phenotype in Brugada syndrome16,17 and
in LQT2.18 More germane to our case, PKA stimulation has
been reported to worsen the phenotype for mutant CPVT
RYR2 channels.19 It is unusual, however, for a channel with
an arrhythmia causing mutation to exhibit a completely WT
phenotype. Such a latent pathogenic biophysical phenotype
has a precedent in the cardiac sodium channel, where low pH
was required to elicit an abnormal late current in sudden
infant death syndrome.20,21 Kir2.1-V227F provides an unusual example of a mutation that depends on PKA-dependent
phosphorylation to manifest a latent and potentially pathogenic phenotype.
␤-Adrenergic Modulation of IK1 in Heart
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
Figure 5. PKA activation reduced outward IK1 for heteromeric
Kir2.1 WT⫹V227F channels after 2 hours of PKA activation.
Cells were incubated in control solutions or PKA activations
solutions for 2 hours, then patch-clamped to measure IK1 density. Sample sizes are shown in parentheses. *P⬍0.05 PKA versus non-PKA.
present on all subunits (Figure 6C). The PKA-mediated
reduction of heteromeric channel current densities was restored if a serine at position 425 was available if it was on the
WT subunit (Figure 6D) or the mutant subunit (data not
shown). This would suggest only 1 subunit, whether WT or
V227F, needs to be phosphorylated for the PKA effect.
These results support the idea that the pathogenic molecular phenotype depends on PKA-mediated phosphorylation
at residue S425.
Discussion
A “Latent” PKA-Dependent Dysfunctional
Biophysical Phenotype for Kir2.1-V227F
The predominant molecular phenotype for KCNJ2 mutations
associated with ATS is a dominant-negative decrease in IK1
when expressed with WT subunits (see References 5 and 12
for reviews).5,12 Kir2.1-V227F showed no effect on IK1 when
coexpressed with WT (Figure 2) and joins only R67Q12 and
P351S15 as examples of KCNJ2 mutations identified from
cardiac arrhythmia patients that have a “WT-like phenotype”
when expressed in heterologous systems (Figure 2). Mindful
of the clinical CPVT presentation, we tested the hypothesis
that a ␤-adrenergic input as mimicked by PKA stimulation
would induce channel dysfunction of heteromeric Kir2.1-WT
and V227F channels. We found a latent PKA-dependent
pathological phenotype in which a profound loss of outward
IK1 depended on PKA activation (Figure 4).
Heteromeric Kir2.1-WT⫹Kir2.1-V227F channels expressed
in Cos-1 had significantly reduced function in the presence of
PKA (Figure 4) that depended on phosphorylation at S425
(Figure 6). The few reports available for PKA effects on
Kir2.1-WT channels have contradictory results including
activation after application of PKA in Xenopus oocytes22 and
CHO cells,23 no effect in studies of bovine pulmonary artery
endothelial cells,24 and inhibition in Cos-7 cells.14 Our results
support observations made by Wischmeyer et al,14 possibly
because the cell model and experimental approach were
similar. Of the 4 members of the Kir2.x family, 3 (Kir2.1,
Kir2.2, Kir2.3) are known to be expressed in the human
heart1,25 and underlie cardiac IK1.26 They are likely to form
heteromers that affect function, including response to phosphorylation, so that our results using only Kir2.1 in heterologous systems may not fully recapitulate the effects in native
tissue. In native tissue, isoproterenol or PKA has been
reported to decrease IK1 in canine Purkinje fibers27 and guinea
pig28 and human29 ventricular myocytes and to have no effect
on rat30 and bull-frog atrial cells.31
IK1 Adrenergic/Ca2ⴙ-Mediated Arrhythmia
and CPVT
Decreased IK1 is postulated to play a role in Ca2⫹-dependent
and triggered arrhythmia, based on studies in a rabbit model
of heart failure.32 Loss of IK1 results in membrane “destabilization” caused by a reduction in outward current opposing
pathogenic transient inward currents. A computer simulation
of decreased IK1 showed prolonged action potentials, depolarized resting membrane potential, and early afterdepolarizations, with delayed afterdepolarizations emerging after simulated ␤-adrenergic activity.33 A computer simulation study
of the ATS mutation D71V in KCNJ2 showed prolonged QT
interval34 but no transmural dispersion of repolarization. In
addition, the canine arterial wedge preparation model using
barium to block IK1 failed to generate early afterdepolarizations, dispersion of repolarization, or sustained arrhythmia
despite provocation with isoproterenol and low K⫹,35 but, in
a similar model, IK1 block by Cs⫹ caused delayed afterdepolarizations and ventricular tachycardia was eliminated by
verapamil.36 Together these results support a role generally
for IK1 in adrenergically mediated Ca2⫹-dependent arrhyth-
Vega et al
V227F-KCNJ2 Mutation and CPVT
545
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
Figure 6. PKA consensus site S425 required for PKA-mediated effects on Kir2.1 channels. A, Representative IK1 traces of Kir2.1S425N, Kir2.1-S425N⫹Kir2.1-V227F/S425N, and Kir2.1-WT⫹Kir2.1-V227F/S425N in the presence or absence of the PKA activation. B,
IV plot for Kir2.1-S425N with PKA activation (open squares; n⫽5) or without PKA activation (closed squares; n⫽8) shows nearly complete abrogation of inhibition seen in WT (Figure 4B). C, IV plot for Kir2.1-S425N⫹Kir2.1-V227F/S4245N with PKA activation (open triangle; n⫽5), and without PKA activation (closed triangle; n⫽11) shows abrogation of the inhibitory effect seen in heteromeric channels
(Figure 4C). D, IV plot for Kir2.1-WT⫹Kir2.1-V227F/S425N with PKA activation (open diamond; n⫽8) and without PKA activation (closed
diamond; n⫽11) shows that the inhibitory effect remains with a WT subunit that can be phosphorylated. *P⬍0.05.
mia. Our results with V227F suggest a special direct role of
adrenergic stimulation for this mutation. We cannot, however, on the basis of this single patient, say how this novel
biophysical phenotype affects the clinical phenotype. For
example, other mutations that show a dominant negative
pattern such as R82W also are adrenergic dependent.11
Adrenergic effects outside of the channel (eg, on calcium
handling) may in combination with a fixed Kir2.1 deficit
make the arrhythmia adrenergic dependent. The adrenergic
dependence of the clinical phenotype of Kir2.1 mutations is
likely to represent a spectrum.
Kir-V227F: ATS1 or CPVT3?
The patient presented with a diagnosis of CPVT and had
clinical features of CPVT and none for ATS aside from
arrhythmia. Approximately 50% to 60% of CPVT cases are
caused by mutations in either RYR27 or CASQ2,8,9 whereas
the remaining 40% have are genotype negative.10 Genetic
screening of patients diagnosed with CPVT and genotype
negative for RYR2 or CASQ2 have identified mutations in
KCNJ2,11,37,38 a gene that has been previously well established as a cause of the pleiotropic ATS.5 The discovery of
KCNJ2 mutations in CPVT patients has been described as
phenotypic mimicry11 and considered within the variable
presentation of ATS.5 The latent biophysical phenotype of
Kir2.1-V227F, however, poses a possibly distinct mechanistic classification. Unlike other ATS mutations in which the
defect is always present, the abnormal phenotype would be
predicted to be present only transiently under conditions of
adrenergic stress. It can be speculated that a transient defect
might preclude development of dysmorphic features characteristic of ATS that presumably requires a fixed loss of
function during development. Moreover, a permanent defect
might be more likely to promote compensatory mechanisms
that would ameliorate the defect. Resolving these questions of
mechanism and classification will require additional clinical
546
Circ Arrhythmia Electrophysiol
October 2009
and basic information on additional mutations showing this
mechanism.
Caveats and Summary
The Kir2.1-V227F mutation found in a patient with CPVT
shows an unusual latent biophysical phenotype where loss of
function occurred only with PKA stimulation, suggesting a
direct link with the adrenergic dependence of the clinical
phenotype. We showed that phosphorylation on S425 of 1
subunit of Kir2.1 was both necessary and sufficient for the
effect. Although this new biophysical phenotype is of interest, the effects of this mutation on action potential and
arrhythmogenesis in myocardial cells and transgenic animals
will be required to further confirm and elucidate the mechanism. Also, this is a single case, and the importance and
implications for the classification of KCNJ2 mutations in
CPVT are not clear.
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
Acknowledgments
We thank Drs Lee Eckhardt and Carmen Valdivia for valuable
discussion and technical assistance.
Sources of Funding
Support was provided by the University of Wisconsin Cellular and
Molecular Arrhythmia Research Program and the Mayo Clinic
Windland Smith Rice Comprehensive Sudden Cardiac Death Research program. Dr Vega received support from National Heart,
Lung, and Blood Institute grant T32 HL07936 (principal investigator, J.C.M.) and the Graduate School of the University of Wisconsin.
Disclosures
Dr Ackerman is a consultant to PGx Health.
References
1. Wible BA, De Biasi M, Majumder K, Taglialatela M, Brown AM.
Cloning and functional expression of an inwardly rectifying K⫹ channel
from human atrium. Circ Res. 1995;76:343–350.
2. Plaster NM, Tawil R, Tristani-Firouzi M, Canun S, Bendahhou S,
Tsunoda A, Donaldson MR, Iannaccone ST, Brunt E, Barohn R, Clark
J, Deymeer F, George AL, Fish FA, Hahn A, Nitu A, Ozdemir C,
Serdaroglu P, Subramony SH, Wolfe G, Fu YH, Ptacek LJ. Mutations in
Kir2.1 cause the developmental and episodic electrical phenotypes of
Andersen’s syndrome. Cell. 2001;105:511–519.
3. Priori SG, Pandit SV, Rivolta I, Berenfeld O, Ronchetti E, Dhamoon A,
Napolitano C, Anumonwo J, di Barletta MR, Gudapakkam S, Bosi G,
Stramba-Badiale M, Jalife J. A novel form of short QT syndrome (SQT3)
is caused by a mutation in the KCNJ2 gene. Circ Res. 2005;96:800 – 807.
4. Xia M, Jin Q, Bendahhou S, He Y, Larroque MM, Chen Y, Zhou Q, Yang
Y, Liu Y, Liu B, Zhu Q, Zhou Y, Lin J, Liang B, Li L, Dong X, Pan Z,
Wang R, Wan H, Qiu W, Xu W, Eurlings P, Barhanin J, Chen Y. A
Kir2.1 gain-of-function mutation underlies familial atrial fibrillation.
Biochem Biophys Res Commun. 2005;332:1012–1019.
5. Donaldson MR, Yoon G, Fu YH, Ptacek LJ. Andersen-Tawil. syndrome:
a model of clinical variability, pleiotropy, and genetic heterogeneity. Ann
Med. 2004;36(Suppl 1):92–97.
6. Leenhardt A, Lucet V, Denjoy I, Grau F, Ngoc DD, Coumel P. Catecholaminergic polymorphic ventricular tachycardia in children: a 7-year
follow-up of 21 patients. Circulation. 1995;91:1512–1519.
7. Priori SG, Napolitano C, Memmi M, Colombi B, Drago F, Gasparini M,
DeSimone L, Coltorti F, Bloise R, Keegan R, Cruz Filho FE, Vignati G,
Benatar A, DeLogu A. Clinical and molecular characterization of patients
with catecholaminergic polymorphic ventricular tachycardia. Circulation.
2002;106:69 –74.
8. Lahat H, Eldar M, Levy-Nissenbaum E, Bahan T, Friedman E, Khoury A,
Lorber A, Kastner DL, Goldman B, Pras E. Autosomal recessive catecholamine- or exercise-induced polymorphic ventricular tachycardia:
clinical features and assignment of the disease gene to chromosome
1p13-21. Circulation. 2001;103:2822–2827.
9. Postma AV, Denjoy I, Hoorntje TM, Lupoglazoff JM, Da Costa A,
Sebillon P, Mannens MM, Wilde AA, Guicheney P. Absence of calsequestrin 2 causes severe forms of catecholaminergic polymorphic ventricular tachycardia. Circ Res. 2002;91:e21– e26.
10. Lehnart SE, Ackerman MJ, Benson DW Jr, Brugada R, Clancy CE,
Donahue JK, George AL Jr, Grant AO, Groft SC, January CT, Lathrop
DA, Lederer WJ, Makielski JC, Mohler PJ, Moss A, Nerbonne JM, Olson
TM, Przywara DA, Towbin JA, Wang LH, Marks AR. Inherited arrhythmias: a National Heart, Lung, and Blood Institute and Office of Rare
Diseases workshop consensus report about the diagnosis, phenotyping,
molecular mechanisms, and therapeutic approaches for primary cardiomyopathies of gene mutations affecting ion channel function. Circulation.
2007;116:2325–2345.
11. Tester DJ, Arya P, Will M, Haglund CM, Farley AL, Makielski JC,
Ackerman MJ. Genotypic heterogeneity and phenotypic mimicry among
unrelated patients referred for catecholaminergic polymorphic ventricular
tachycardia genetic testing. Heart Rhythm. 2006;3:800 – 805.
12. Eckhardt LL, Farley AL, Rodriguez E, Ruwaldt K, Hammill D, Tester DJ,
Ackerman MJ, Makielski JC. KCNJ2 mutations in arrhythmia patients
referred for LQT testing: a mutation T305A with novel effect on rectification properties. Heart Rhythm. 2007;4:323–329.
13. Herskowitz I. Functional inactivation of genes by dominant negative
mutations. Nature. 1987;329:219 –222.
14. Wischmeyer E, Karschin A. Receptor stimulation causes slow inhibition
of IRK1 inwardly rectifying K⫹ channels by direct protein kinase
A-mediated phosphorylation. Proc Natl Acad Sci U S A. 1996;93:
5819 –5823.
15. Haruna Y, Kobori A, Makiyama T, Yoshida H, Akao M, Doi T, Tsuji K,
Ono S, Nishio Y, Shimizu W, Inoue T, Murakami T, Tsuboi N,
Yamanouchi H, Ushinohama H, Nakamura Y, Yoshinaga M, Horigome
H, Aizawa Y, Kita T, Horie M. Genotype-phenotype correlations of
KCNJ2 mutations in Japanese patients with Andersen-Tawil syndrome.
Hum Mutat. 2007;28:208 –216.
16. Dumaine R, Towbin JA, Brugada P, Vatta M, Nesterenko DV, Nesterenko VV, Brugada J, Brugada R, Antzelevitch C. Ionic mechanisms
responsible for the electrocardiographic phenotype of the Brugada
syndrome are temperature dependent. Circ Res. 1999;85:803– 809.
17. Mok NS, Priori SG, Napolitano C, Chan NY, Chahine M, Baroudi G. A
newly characterized SCN5A mutation underlying Brugada syndrome
unmasked by hyperthermia. J Cardiovasc Electrophysiol. 2003;14:
407– 411.
18. Amin AS, Herfst LJ, Delisle BP, Klemens CA, Rook MB, Bezzina CR,
Underkofler HA, Holzem KM, Ruijter JM, Tan HL, January CT, Wilde
AA. Fever-induced QTc prolongation and ventricular arrhythmias in
individuals with type 2 congenital long QT syndrome. J Clin Invest.
2008;118:2552–2561.
19. Lehnart SE, Wehrens XH, Laitinen PJ, Reiken SR, Deng SX, Cheng Z,
Landry DW, Kontula K, Swan H, Marks AR. Sudden death in familial
polymorphic ventricular tachycardia associated with calcium release
channel (ryanodine receptor) leak. Circulation. 2004;109:3208 –3214.
20. Plant LD, Bowers PN, Liu Q, Morgan T, Zhang T, State MW, Chen W,
Kittles RA, Goldstein SA. A common cardiac sodium channel variant
associated with sudden infant death in African Americans, SCN5A
S1103Y. J Clin Invest. 2006;116:430 – 435.
21. Wang DW, Desai RR, Crotti L, Arnestad M, Insolia R, Pedrazzini M,
Ferrandi C, Vege A, Rognum T, Schwartz PJ, George AL Jr. Cardiac sodium
channel dysfunction in sudden infant death syndrome. Circulation. 2007;115:
368–376.
22. Fakler B, Brandle U, Glowatzki E, Zenner HP, Ruppersberg JP. Kir2.1
inward rectifier K⫹ channels are regulated independently by protein
kinases and ATP hydrolysis. Neuron. 1994;13:1413–1420.
23. Malinowska DH, Sherry AM, Tewari KP, Cuppoletti J. Gastric parietal
cell secretory membrane contains PKA- and acid-activated Kir2.1 K⫹
channels. Am J Physiol Cell Physiol. 2004;286:C495–C506.
24. Kamouchi M, Van Den BK, Eggermont J, Droogmans G, Nilius B.
Modulation of inwardly rectifying potassium channels in cultured bovine
pulmonary artery endothelial cells. J Physiol. 1997;504:545–556.
25. Ashen MD, O’Rourke B, Kluge KA, Johns DC, Tomaselli GF. Inward
rectifier K⫹ channel from human heart and brain: cloning and stable
expression in a human cell line. Am J Physiol. 1995;268:H506 –H511.
26. Zaritsky JJ, Redell JB, Tempel BL, Schwarz TL. The consequences of
disrupting cardiac inwardly rectifying K(⫹) current (I(K1)) as revealed
by the targeted deletion of the murine Kir2.1 and Kir2.2 genes. J Physiol.
2001;533:697–710.
Vega et al
27. Tromba C, Cohen IS. A novel action of isoproterenol to inactivate a
cardiac K⫹ current is not blocked by beta and alpha adrenergic blockers.
Biophys J. 1990;58:791–795.
28. Koumi S, Wasserstrom JA, Ten Eick RE. Beta-adrenergic and cholinergic
modulation of inward rectifier K⫹ channel function and phosphorylation
in guinea-pig ventricle. J Physiol. 1995;486:661– 678.
29. Koumi S, Backer CL, Arentzen CE, Sato R. Beta-adrenergic modulation
of the inwardly rectifying potassium channel in isolated human ventricular myocytes: alteration in channel response to beta-adrenergic stimulation in failing human hearts. J Clin Invest. 1995;96:2870 –2881.
30. Sonoyama K, Ninomiya H, Igawa O, Kaetsu Y, Furuse Y, Hamada T,
Miake J, Li P, Yamamoto Y, Ogino K, Yoshida A, Taniguchi S, Kurata
Y, Matsuoka S, Narahashi T, Shiota G, Nozawa Y, Matsubara H,
Horiuchi M, Shirayoshi Y, Hisatome I. Inhibition of inward rectifier K⫹
currents by angiotensin II in rat atrial myocytes: lack of effects in cells
from spontaneously hypertensive rats. Hypertens Res. 2006;29:923–934.
31. Giles W, Nakajima T, Ono K, Shibata EF. Modulation of the delayed
rectifier K⫹ current by isoprenaline in bull-frog atrial myocytes.
J Physiol. 1989;415:233–249.
32. Pogwizd SM, Schlotthauer K, Li L, Yuan W, Bers DM. Arrhythmogenesis and contractile dysfunction in heart failure: roles of sodiumcalcium exchange, inward rectifier potassium current, and residual betaadrenergic responsiveness. Circ Res. 2001;88:1159 –1167.
V227F-KCNJ2 Mutation and CPVT
547
33. Sung RJ, Wu SN, Wu JS, Chang HD, Luo CH. Electrophysiological
mechanisms of ventricular arrhythmias in relation to Andersen-Tawil
syndrome under conditions of reduced IK1: a simulation study. Am J
Physiol Heart Circ Physiol. 2006;291:H2597–H2605.
34. Seemann G, Sachse FB, Weiss DL, Ptacek LJ, Tristani-Firouzi M.
Modeling of IK1 mutations in human left ventricular myocytes and tissue.
Am J Physiol Heart Circ Physiol. 2007;292:H549 –H559.
35. Tsuboi M, Antzelevitch C. Cellular basis for electrocardiographic and
arrhythmic manifestations of Andersen-Tawil syndrome (LQT7). Heart
Rhythm. 2006;3:328 –335.
36. Morita H, Zipes DP, Morita ST, Wu J. Mechanism of U wave and
polymorphic ventricular tachycardia in a canine tissue model of
Andersen-Tawil syndrome. Cardiovasc Res. 2007;75:510 –518.
37. Postma AV, Bhuiyan ZA, Shkolnikova M, Denjoy I, Mannens MM,
Wilde AAM, Guicheney R, Bezzina CR. Involvement of the Kir2 gene
family in catecholaminergic polymorphic ventricular tachycardia: analysis for mutations and identification of numerous pseudogenes. Eur
Heart J. 2004;25:66 – 66. Abstract.
38. Ruan Y, Theilade J, Memmi M, Giuli LD, Rizzi N, Cruz FE, Napolitano
C, Priori SG. KCNJ2 mutations in patients referred for catecholaminergic
polymorphic ventricular tachycardia gene screening. Circulation.
2007;116:492– 492.
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
CLINICAL PERSPECTIVE
KCNJ2 encodes Kir2.1, a pore-forming subunit of the cardiac inward rectifier current IK1 that contributes to maintenance
of the resting potential and to termination of the action potential. KCNJ2 mutations are associated with Andersen-Tawil
syndrome and catecholaminergic polymorphic ventricular tachycardia. This study characterized the IK1 currents of a
particular novel KCNJ2 missense mutation found in a patient with catecholaminergic polymorphic ventricular tachycardia
and showed that unlike previously characterized KCNJ2 arrhythmia mutations, this mutation required protein kinase A
stimulation (a downstream effect of adrenergic stimulation) to show the biophysical phenotype of IK1 abnormality usually
associated with arrhythmia. This protein kinase A dependence of the biophysical phenotype directly correlates with the
adrenergic dependence of the catecholaminergic polymorphic ventricular tachycardia clinical phenotype and has
implications for the classification and pathophysiology of these inherited arrhythmias.
Protein Kinase A-Dependent Biophysical Phenotype for V227F-KCNJ2 Mutation in
Catecholaminergic Polymorphic Ventricular Tachycardia
Amanda L. Vega, David J. Tester, Michael J. Ackerman and Jonathan C. Makielski
Downloaded from http://circep.ahajournals.org/ by guest on June 17, 2017
Circ Arrhythm Electrophysiol. 2009;2:540-547; originally published online August 25, 2009;
doi: 10.1161/CIRCEP.109.872309
Circulation: Arrhythmia and Electrophysiology is published by the American Heart Association, 7272 Greenville
Avenue, Dallas, TX 75231
Copyright © 2009 American Heart Association, Inc. All rights reserved.
Print ISSN: 1941-3149. Online ISSN: 1941-3084
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circep.ahajournals.org/content/2/5/540
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation: Arrhythmia and Electrophysiology can be obtained via RightsLink, a service of the Copyright
Clearance Center, not the Editorial Office. Once the online version of the published article for which
permission is being requested is located, click Request Permissions in the middle column of the Web page
under Services. Further information about this process is available in the Permissions and Rights Question and
Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation: Arrhythmia and Electrophysiology is online at:
http://circep.ahajournals.org//subscriptions/