© 1992 Oxford University Press
Nucleic Acids Research, Vol. 20, No. 18 4741 -4746
Involvement of the size and sequence of the anticodon
loop in tRNA recognition by mammalian and E.coli
methionyl-tRNA synthetases
Thierry Meinnel, Yves Mechulam, Guy Fayatf and Sylvain Blanquet*
Laboratoire de Biochimie, Unite de Recherche Associ6e no 240 du Centre National de la Recherche
Scientifique, Ecole Polytechnique, F-91128 Palaiseau Cedex, France
Received July 7, 1992; Revised and Accepted August 19, 1992
ABSTRACT
INTRODUCTION
The rates of the cross-aminoacylation reactions of
tRNAs1** catalyzed by methionyl-tRNA synthetases
from various organisms suggest the occurrence of two
types of tRNA^/methionyl-tRNA synthetase systems.
In this study, the tRNA determinants recognized by
mammalian or E.coli methionyl-tRNA synthetases,
which are representative members of the two types,
have been examined. Like its prokaryotic counterpart,
the mammalian enzyme utilizes the anticodon of tRNA
as main recognition element. However, the mamalian
cytoplasmic elongator tRNA Met species is not
recognized by the bacterial synthetase, and both the
initiator and elongator E.coli tRNA"61 behave as poor
substrates of the mammalian cytoplasmic synthetase.
Synthetic genes encoding variants of tRNAsMet,
including the elongator one from mammals, were
expressed in E.coli. tRNAs Mst recognized by a
synthetase of a given type can be converted into a
substrate of an enzyme of the other type by introducing
one-base substitutions in the anticodon loop or stem.
In particular, a reduction of the size of the anticodon
loop of cytoplasmic mammalian elongator tRNAMc1
from 9 to 7 bases, through the creation of an additional
Watson-Crick pair at the bottom of the anticodon
stem, makes it a substrate of the prokaryotic enzyme
and decreases its ability to be methionylated by the
mammalian enzyme. Moreover, enlarging the size of the
anticodon loop of E.coli tRNAMetm from 7 to 9 bases,
by disrupting the base pair at the bottom of the
anticodon stem, renders the resulting tRNA a good
substrate of the mammalian enzyme, while strongly
altering its reaction with the prokaryotic synthetase.
Finally, E.coli tRNA1*81! can be rendered a better
substrate of the mammalian enzyme by changing its
U33 into a C. This modification makes the sequence of
the anticodon loop of tRNAMet, identical to that of
cytoplasmic initiator tRNAMe1.
The search for the molecular bases governing the specific
aminoacylation of a tRNA by its corresponding aminoacyl-tRNA
synthetase has made much progress in the past few years
(reviewed in 1). However, up to now, most of the available data
focused on the definition of the rules governing the
aminoacylation of a tRNA by a given aminoacid in E. coli so that
little is known about the conservation of such rules in other
organisms. In other words, have the nucleotides conferring its
identity to a given tRNA acceptor species been conserved
throughout evolution?
A number of experiments indirectly argue in favor of such a
conservation. For instance, a given aminoacyl-tRNA synthetase
was shown to be able to selectively aminoacylate in vitro
heterologous tRNAs of the same aminoacid specificity (2-4).
Moreover, the E. coli tyrosyl-tRNA synthetase can substitute in
vivo for the function of the corresponding yeast mitochondrial
enzyme (5). In addition, several tRNAs from different organisms
and accepting the same aminoacid display the identity nucleotides
defined in the E.coli system. Accordingly, the conserved G3U70
base pair in the acceptor stem of tRNA^ is a major determinant
in Prokaryotes (E.coli, 6) as well as in Eukaryotes (yeast, insect
and mammals; 7,8). Finally, in the phenylalanine system, the
anticodon and base 20 in the variable pocket play an important
role in Prokaryotes (E. coli; 9) as well as in Eukaryotes (yeast,
human; 9-11). In the aspartic system, the 'discriminator' base
G73 is recognized by either yeast and E.coli synthetases (12,13).
Despite the above results, several other experiments moderate
the idea of evolution-conserved mechanisms of tRNA recognition.
For instance, the yeast cytoplasmic tyrosyl-tRNA synthetase could
not aminoacylate in vivo an E.coli tyrosine-accepting amber
tRNATyr(14). In fact, this latter tRNA behaves as a substrate
of leucyl-tRNA synthetase in yeast (15). On the other hand, the
study of the phenylalanine system has emphasized the importance
of organism-specific recognition elements, in addition to common
recognition determinants the anticodon stem participates in
recognition in human cells, while bases 10, 25, 26, 44 and 59
play a role in E.coli (9). Moreover, the base requirement at
* To whom correspondence should be addressed
f
Deceased, October 22, 1990
4742 Nucleic Acids Research, Vol. 20, No. 18
A
3c
5'
n
u
D
G3
S1
A
GT C
Gi*
C •
C»
OC»
C
C
A
C
G
C
G
G
C A C O C
A
A C A G G
C D C G
G O G A G
ctCGl
C5
G A G C
G G
G D„
G C G C
Ot
20
F»
C»
A»
G«
A
*
D
G7
AG
A
G
D
C
T F
G
58
A
A7
c«
C3A
E. coli elongator tRNA
B
inducible
lac promoter
U
Rabbit liver cytoplmsmic elongator tRNA
in constitutive
< lpp promoter
rrnC
terminator M
2
1
3
WTCGCCTCGTTAGCG"CAGTAGGTAGCGCG1 AGjTtTCATA^TtTGAAGGTCGTGAGTTCGm'CCTCACACGGGGCACCACTGCA
GCGGAGCAATCGCGTCATCCATCGCGCAGTckpAGTATTBbACTTCCAGCACTCAAGCTAGGAGTGTGCCCCGTGGTG
Figure 1. Expression of mammalian cytoplasmic elongator tRNA Ma in E.coli. Panel A The secondary structures of elongator t R N A ^ from E.coli (43) and rabbit
liver (35) are shown. Numbering and abbreviations for modified nucleotides are according to Sprinzl et at. (33). Panel B The six overlapping oligonucleotides used
to build the synthetic gene for rabbit liver elongator tRNAMct are defined by vertical arrows and numbered from 1 to 6. Positions 31 and 39, which were varied,
are boxed. The cloning region of the pBSTNAV2 tRNA expression vector is also represented, with the relevant restriction sites. Single restriction sites are bold-faced.
The checkered, black, and grey boxes symbolize the lac promoter, the lpp promoter, and the rmC terminator, respectively.
position 20 of a tRNA differs between the E.coli, yeast or human
phenylalanyl-tRNA synthetases (9-11)
In the methionine system, a number of cross-aminoacylation
experiments have been performed. Firstly, earlier experiments
have shown that E.coli methionyl-tRNA synthetase (MTSEC)
aminoacylated initiator tRNAs (all featuring the CAU anticodon)
isolated from various species (bacteria, yeast, plant, animal) and
from different cellular compartments (mitochondria], cytoplasmic
or chloroplastic) with catalytic efficiencies close to those observed
with the homologous E.coli tRNAMet substrates (16-18). In
contrast, eukaryotic cytoplasmic elongator tRNAMet from
mammalian (19), plant (18) or yeast (16) origins behaved as poor
substrates of MTSEC. In particular, elongator tRNAMet from
rabbit liver has been reported not to bind MTSEC better than
a non-Met tRNA (17). In addition, yeast mitochondrial and wheat
germ chloroplastic MTS aminoacylate as efficiently E.coli
tRNAsMct as their cognate tRNAs (20-22). Finally, eukaryotic
cytoplasmic MTS aminoacylate the mitochondrial, choroplastic
and E.coli tRNAsMct with a low efficiency (20—22) whereas
mammalian cytoplasmic MTS efficiently aminoacylates
cytoplasmic tRNAMct from yeast (23).
This analysis of specificity through heterologous
aminoacylation studies suggests that there exists two types of MTS
the first type would include the synthetases from Prokaryotes and
organelles able to aminoacylate tRNAsMa from prokaryotes and
organites, as well as eukaryotic cytoplasmic initiator tRNA Ma .
The lack of recognition of elongator tRNAsMet of cytoplasmic
origin by a MTS of this first type is rather surprising, since it
is generally believed that the presence of a CAU anticodon
sequence in a tRNA is enough to govern the reaction of
methionylation (see references 24—28). The second type would
be composed of the MTS from the cytoplasm of Eukaryotes, with
a specificity restricted to eukaryotic cytoplasmic tRNAsMet.
In the present paper, we attempted to define the determinants
on tRNA to explain the two types of tRNAMet reactivities. For
that purpose, we have studied the tRNAsMa determinants used
by two species of MTS isolated from Escherichia coli (MTSEC)
and from the cytoplasm of rabbit liver (MTSOC), respectively.
Nucleic Acids Research, Vol. 20, No. 18 4743
MATERIAL AND METHODS
Synthesis of tRNA genes
Oligonucleotides (18 to 31-mers) were synthesized on a
Pharmacia Gene Assembler and purified on a Mono Q column
(Pharmacia). Rabbit liver tRNA genes as well as other tRNA
genes and their derivatives were constructed by assembling six
different overlapping oligonucleotides (Figure 1) as described
(29). tRNA genes were ligated between the EcoRl and Pstl sites
of the pBSTNAV2 expression vector (Figure 1), a derivative of
pBSTNAV (29). Verification ot the tRNA gene sequences was
achieved using single-stranded DNA obtained by using the R-408
helper phage (Stratagene, La Jolla, CA, USA).
tRNA purification
tRNA overproducing cells were grown in a 1 litre of LB medium
containing 50/xg of ampicillin per ml. A crude tRNAMa extract
(190 to 650 pmole tRNAMet/A260 Unit depending on the
tRNAMct species) was prepared and further purified by anion
chromatography (29,30). In the case of the preparation of the
mammalian tRNA species, the elution profile of each column
was checked for tRNAMaf0rtRNAMetm contamination using ^Pkinased oligonucleotides as previously described (17). Purity of
tRNAMet species was 950 to 1350 pmole of radioactive
methionine incorporated per A260 Unit.
Aminoacylation assays
MTSOC activity was part of a pure rabbit aminoacyl-tRNA
synthetase complex devoid of lysyl-tRNA synthetase and assayed
as described (23). MTSEC used in this test was the truncated
monomeric M547 variant (31). Aminoacylation reactions
catalyzed by MTSEC were performed at 25° C in 100 /tl assays
containing 20 mM Tris-HCl (pH=7.6); 7 mM MgCl2; 10 mM
2-mercaptoethanol; 0.1 mM EDTA; 150 mM KC1; 21.5 ^M
[l4C]-Methionine (50.3 Ci/mole; CEA-France); 2 mM ATP and
purified tRNA (0.2 to 40 /iM). In the case of MTSOC, the
concentration of [14C]-Methionine was raised to 43 fiM and that
of ATP to 3 mM. Km and k^ values were derived from iterative
non-linear least squares fits of the Michaelis-Menten equation
to the experimental values.
Spectrophotofluorimetric determination of [tRNA E.coli
MTS] dissociation constants
Intrinsic protein fluorescence of MTSEC was measured at 25 °C
as described (32) in a quartz cell filled with 0.8 ml of a M547
solution (0.8 fiM) in a buffer containing 20 mM Tris-HCl
(pH = 7.6); 0.1 mM EDTA; 10 mM 2-mercaptoethanol; 8 mM
MgCl2. Titration curves were obtained by adding successive 5
fi\ tRNA aliquots of increasing concentrations (10 to 160 fiM).
Associated equilibrium constants were derived from iterative nonlinear least squares fits of the theoretical binding equation to the
experimental values.
RESULTS AND DISCUSSION
a) The anticodon loop of eukaryotic cytoplasmic elongator
tRNAsMet could be abnormally large
To identify the structural features accounting for the lack of
aminoacylation by MTSEC of cytoplasmic elongator tRNAMet
from rabbit liver (17,19), the sequences of the six eukaryotic
cytoplasmic elongator t R N A ^ compiled in reference 33 (wheat
germ, Lupinus luteus, rabbit liver, mouse myeloma and human
HeLa cells) were compared to those of tRNAs able to be
aminoacylated by MTSEC. From this comparison, the occurrence
of pseudo-uridines (F) at positions 31 and 39 in the eukaryotic
cytoplasmic elongator tRNAMet sequences emerged as a constant
feature. These pseudo-uridines at the junction between the
anticodon loop and stem are unlikely to be normally base-paired
in a Watson-Crick helix because of the distance between the
C r positions of the ribose rings (34). The consequence might
be an enlarged anticodon loop composed of 9 rather than 7 bases
possibly accounting for the lack of recognition by MTSEC.
Noticeably, the E.coli tRNA Mcl f derivative having a
supplementary A inserted at position 37, and thus possessing an
abnormally large anticodon loop, has been reported to be 14-fold
less efficiently aminoacylated by MTSEC than the wild-type
substrate (24). The abnormally large anticodon loop of eukaryotic
cytoplasmic elongator tRNAMct is a unique case in the known
tRNA sequences (33). In particular, eukaryotic cytoplasmic
initiator tRNAsMet show the normal 7-base anticodon loop.
b) The creation of a Watson-Crick base pair between
residues 31 and 39 of a mammalian elongator tRNAMet
renders it a substrate of MTSEC
To probe the importance of the size of the anticodon loop in the
aminoacylation by MTSEC, two tRNA genes were constructed
and expressed in E.coli. The DNA sequence of the first gene
(Figure 1) was deduced from that of the elongator tRNAMet
from rabbit liver (35). Noteworthy, this sequence is identical to
those of the elongator tRNAsMet from mouse myeloma or
human HeLa cells (33). This yielded the M.tRNAMa species (M
= mammalian). The sequence of the second tRNA gene was
derived from the above by changing the T31 residue into an A,
thus creating a 7 base anticodon loop (M.tRNAMc*A3|). The U39
residue of M.tRNAMct is likely to be changed into an F under
the action of the modification enzyme produced by the hisT'gene,
similarly to any E. coli tRNA species possessing a U at position
38, 39 or 40 (36). In contrast, the uridine (U) at position 31 should
not be modified in M.tRNAMet when expressed in E.coli,
because a U at position 31 is always intact in E.coli tRNAs
(tRNA0111,, tRNA5",, t R N A ^ and tRNATT, see reference 33).
In fact, whatever the modifications taking place in the E.coli
context, any of the F 3 |-F 39 , U 3 r F 3 9 , F 3 r U 3 9 or U 3 r U 3 9 base
pairs combinations should produce a 9 base anticodon loop (34).
The M.tRNAMa purified from E.coli cells was assayed for
aminoacylation in the presence of rabbit liver MTS (MTSOC).
Km and k^ values only slightly differed from those reported in
the case of the wild-type tRNAMa species extracted from rabbit
liver (23), the aminoacylation efficiencies (kca/Km) being the
same within a factor of 2 (Table 1). This comparison indicates
that the recognition of M.tRNAMet by MTSOC is not dependent
on a post-transcriptional modification specifically occurring in
the mammalian cell context. In particular, a role of the
2'-0-methylation of the C residue of the CAU anticodon (C3)
occurring in all examined eukaryotic elongator tRNAMet species
can be excluded (32,35).
When assayed in the presence of MTSEC, the aminoacylation
of M.tRNAMet occurred with a k^JKn, value 4 orders of
magnitude smaller than that measured with EC.tRNAMa (Table
2). Moreover, M.tRNAMet did not form a stable complex with
MTSEC (Table 2), in agreement with previous studies using
tRNAMet extracted from rabbit liver (17,19).
To probe the importance of the 31—39 base pairing,
M.tRNAMetA3i was then assayed as a substrate of MTSEC.
4744 Nucleic Acids Research, Vol. 20, No. 18
Table 1. Michaelian parameters for the reaction of aminoacylation of tRNAs
catalyzed by MTSOC.
31
39
Elongator tRNA
from rabbit liver
M.tRNA M «
EC.tRNAM«n,
T
T
T
T
A
T
EC.tRNA M c W31
M.tRNA""A3i
M.tRNAMetAgg
EC.tRNAllej
T
T
A
T
T
A
C
G
EC.tRNAn«iC34
C
G
EC.tRNAv»li
C
G
EC.tRNAv«lC34U38
EC.tRNAM«f
EC tRNAMctjCjj
C
G
G
C
3.2±1.0
0.03±0.01
G
C
M.tRNAM<:tG34
T
T
1.6±0.2
n m.
0.10±0.01
njn.
M.tRNAMetU35A36
T
T
run.
njn.
Mct
(UMI
2.3*
(s-i)
l.r
0.9±0.3
0.35±0.03
1.4±0.7 0.015±0.002
0.11±0.07 0.20±0.02
njn.
n.m.
n.m.
run.
n.m.
njn.
0.04±0.01
3.3±1.5
n.m.
njn.
0.8±0.4
0.06±0.01
(lC^s'.M 1 )
07
0.4
0.01
2
0.006
0.007
< 10"5
0.01
< 10-5
0.008
0.01
0.07
< 10-5
< 10-5
For each tRNA species, the nucleotides at positions 31 and 39 in the corresponding
genes are indicated. Mammalian MTS activity was from a pure rabbit aminoacyltRNA synthetase complex devoid of lysyl-tRNA synthetase (23). Km and k^
values, and associated standard errors, were derived from iterative nonlinear
least squares fits of the Michaelis-Menten equation to the experimental values,
n.m.means that the value was not measurable (Km> 12/iM).
(*) data from (23).
Table 2. Michaelian parameters for the reaction of aminoacylation of tRNAs
catalyzed by MTSEC.
31
M.tRNAM«
M.tRNAM«A3i
M tRNA"«A3 9
EC.tRNA««
EC.tRNA«*T 3l
EC.tRNAM«f
EC.tRNA'kCM
EC.tRNAn=C34U38
39
T
T
A
T
Kd
((lM)
n.m.
1510.2
1410.3
1.3 ±0.4
T
A
A
T
T
T
G
C
1.5 ± 0.7
C
G
C
G
1.0 ±0.5
1.6 ±0.3
n.m
Km
(HM)
n.m.
21 ± 8
25 ± 7
0.9 ±0.1
n.m
2.3 ±0.1
1 7 ±0.7
6.8 ± 0 1
fccoi/Km
(s-i)
(lOfls-1 M-l)
n.m.
lxlO"4
1x10-2
0.22 ± 0 03
0.08 ± 0 01
3x10-3
3.3 ±0.1
3.7
n.ra.
lxlO- 3
3.3 ±0.1
1.4
7.6x10-2
0.13 ±0.01
0.82 ± 0.02
12xlO- 2
For each tRNA species, the nucleotides at positions 31 and 39 in the corresponding
genes are indicated. Kd is the dissociation constant of the enzyme:tRNA complex,
as determined by fluorescence spectrophotometry at equilibrium (32).
Homogeneous MTSEC used in these experiments was the truncated monomeric
M547 variant (31).
n.m. not measurable (Km and Kd >2<VM)
This single-base substitution caused a very large improvement
of the M.tRNAM<a aminoacylation efficiency by MTSEC. The
kaJK-m rati° increased by two orders of magnitude, when
compared to that of the non-mutagenized M.tRNAMa (Table 2).
Furthermore, the MTSECM.tRNAMaA3| complex was as stable
as the MTSECEC.tRNAMo complex (Table 2).
To further study the effect of the introduction of an additional
Watson—Crick base pairing at the bottom of the anticodon stem,
the T 39 residue of M.tRNAMet was changed into an A
(M.tRNAMctA39). As shown in Table 2, this change had the
same consequence on MTSEC recognition as the A3, change.
c) Disruption of the Watson—Crick base pair between
residues 31 and 39 of EC.tRNA Met m impairs the
aminoacylation by MTSEC
Since the introduction of a seven base anticodon loop in
M.tRNAMet appeared necessary to render this tRNA as good a
ligand of MTSEC as EC.tRNAMet, we wondered whether the
unpairing of the 31—39 bases in EC.tRNAMa could cause a
reduction of its affinity towards MTSEC. For this purpose, an
EC.tRNAMa gene with a T in place of A3, was constructed. The
aminoacylation efficiency of MTSEC towards the resulting
EC.tRNAMetT3i was decreased by 3 orders of magnitude, as
compared to the normal substrate (Table 2). In parallel, the
dissociation constant of the corresponding MTSECEC.tRNA1^
T 3 | complex increased by one order of magnitude at least (Table
2). We may therefore propose that the binding to MTSEC
requires a 7-base sized anticodon loop. However, in this case,
the nature of the paired bases at the bottom of the anticodon stem
appears not critical, since M.tRNAMe)A3, (A3,T39), M.tRNAMa
A39 (T31A39), EC.tRNAMaf (G3IC39) and either E C t R N A 0 ^
or ECtRNA^-wU-K (C^G^) bind specifically MTSEC (Table
2). Note that the two latter tRNAs were converted into substrates
of MTSEC by changing their non-Met anticodon into a CAU
one (26,27,37).
Two mechanisms may account for the observed reduced
stability of complexes of MTSEC with tRNAs Ma having both
a 9-base anticodon loop and an anticodon stem of reduced length.
Firstly, the conformation of such an unusual stem and loop
structure may change the orientation of the anticodon with respect
to other parts of the tRNA interacting with the enzyme, in
particular to the acceptor arm the critical role of which has been
recently underlined (37,38). A distorted relative positioning
between these tRNA regions is likely to markedly lower the
stability of the enzyme:tRNA complex. In this context, it should
be noted that tRNAs with enlarged anticodon loops can induce
translational frameshifting (39,40). This property has been
proposed to result from an altered three-dimensional folding of
the anticodon loop (40).
Secondly, a larger number of conformational isomers might
correspond to an enlarged loop. This may reduce the value of
the statistical kinetic constant of association to the synthetase by
decreasing the probability of having in solution those tRNA
conformations fitting the MTSEC binding site. Consequently,
the association constant of formation of the enzymetRNA complex
would be lowered.
d) Disruption of the Watson-Crick base pair between
residues 31 and 39 of EC.tRNAMetm is enough to render it
a substrate of MTSOC
EC.tRNAsMet are poor substrates of MTSOC with 40-fold
reduced kcat/Km values as compared to M.tRNAMct (Table 1).
As pointed out above, the eukaryotic elongator tRNAsMct
sequences are featured by the F31 and F 39 bases and the resulting
enlarged anticodon loop. We wondered therefore whether the
creation of a 9 base anticodon loop in the EC.tRNA'*0 structure
could increase the efficiency of its aminoacylation by MTSOC.
The A3, base of EC.tRNAMa was changed into a T. This single
change increased by three orders of magnitude the catalytic
efficiency of MTSOC towards EC.tRNA Mcl , the
EC.tRNAMctT3| species becoming an even better substrate than
the M.tRNAMct species (Table 1).
e) The creation of a Watson-Crick base pair between
residues 31 and 39 of M.tRNAMetm lowers its aminoacylation
efficiency by MTSOC
The aminoacylation of M.tRNAMaA3, and M.tRNAMaA39 by
the eukaryotic synthetase from rabbit liver were measured. Either
substitution, which reduces the 9 nucleotide anticodon loop of
M.tRNAMa to 7 nucleotides, caused a decrease of the catalytic
Nucleic Acids Research, Vol. 20, No. 18 4745
efficiency of MTSOC to values of the order of that measured
using EC.tRNAMa as a substrate, with a concomitant large
increase of the Km value (Table 1).
The latter result was rather unexpected since cytoplasmic rabbit
liver MTS can recognize mammalian initiator tRNAMet species
which is featured by a 7 nucleotide anticodon loop, with a G-C
pair at positions 31—39. In this context, it is noticeable that the
conserved sequence of the anticodon loops of all known
mammalian cytoplasmic initiator tRNAMet species (CCCAUA7A) differs from that of the corresponding elongator species
(FCUC3AUA7AF). This situation differs from that encountered
in E.coli, where the anticodon loop of initiator as well as that
of elongator tRNAMe* have identical sequences. In addition, the
CCCAUA7A sequence is different from that in EC.tRNAMetf.
To examine the importance of a C at position 33 in the 7-base
anticodon loop of mammalian cytoplasmic initiator tRNAMet, we
constructed the genes encoding this tRNAMet species
(M.tRNAMaj) as well as the gene corresponding to the same
tRNA with a U instead of a C at position 33 (M.tRNA Ma U 33 ).
Unfortunately, although the plasmid was stable in E.coli cells,
the production of these two tRNA species in E. coli could not
be achieved as probed by hybridization experiments performed
on a 1M soluble RNA extract using a specific oligonucleotidic
probe. The in vitro production was not attempted because the
transcription of the two genes would begin on an A instead of
the required G. An alternative experiment was therefore carried
out by studying the effect in the aminoacylation by MTSOC of
the change of the U33 position of E.C.tRNAMa into a C. As
shown in table 1, this single change in E.C.tRNAMetfC33 was
sufficient to increase by a factor of 7 the measured kca/Km value
as compared to that with E.C.tRNAMe<f (Table 2).
To explain this phenomenon, in relation with the above
discussion on the role of the conformation of the anticodon loop
in the binding of tRNA to MTSEC, it may be imagined that the
unique anticodon loops of initiator or elongator mammalian
tRNAMet can adopt the same conformation to form a complex
with the synthetase. This hypothesis presupposes that MTSOC
offers a unique binding site to the binding of the two tRNAMc<
species which, in fact, has not yet been demonstrated.
f) As in the case of the E.coli system, the CAU anticodon
sequence is a major identity element for recognition by
MTSOC
As suggested by the poor in vivo aminoacylation of yeast initiator
tRNAMa variants modified in their anticodon sequence by yeast
cytoplasmic MTS (41), the CAU anticodon is likely to play an
important role in the specific aminoacylation of a tRNA by a
eukaryotic methionyl-tRNA synthetase. In this context, it was
interesting to evaluate the contribution of the presence of the CAU
anticodon in the recognition of a tRNA by MTSOC. Firstly, we
constructed two genes encoding two variants of M.tRNAMa,
with substitutions introduced within the anticodon sequence
(M.tRNAMctG34 and M.tRNA^U-tfAje). As shown in Table 1,
these two tRNAs were not substrates of the rabbit liver enzyme,
and their catalytic efficiencies were affected by at least 5 orders
of magnitude.
Secondly, two non-Met EC.tRNA species, ECtRNA"11, and
EC. tRNAVali having a 7-base anticodon loop could be switched
into substrates of MTSOC by changing their non-Met anticodon
into a CAU one (Table 1). The resulting tRNA^iQ^ and
tRNA Val iC 34 U3 6 were aminoacylated by MTSOC with
measurable catalytic efficiencies at least 3 orders of magnitude
larger than those of tRNA"0, and tRNAVaV The catalytic
efficiencies in the presence of tRNADe1C34 and tRNAVal,C34U36
which have a 7-base anticodon loop remained 40-fold smaller
than those measured in the presence of M.tRNA Ma (Table 1).
However, the obtained k^Kn, values were very similar to those
measured in the presence of EC.tRNA Ma , EC.tRNAMaf,
M.tRNAMaA31 or M.tRNAMaA39. Such a lower efficiency is
therefore likely to be accounted for by the lack of an anticodon
loop of a size identical to that of M.tRNAMet.
CONCLUDING REMARKS
Whatever the considered synthetase, MTSEC or MTSOC, a CAU
anticodon appears necessary to govern the aminoacylation of a
tRNA. However, additional features in the tRNA structure play
a cooperative role in the aminoacylation reaction.
Recent results obtained in the E.coli system have shown that
variants of EC.tRNAMam mutated in the anticodon loop at
position 32, 33 and 37 or in the acceptor stem were affected in
their aminoacylation capacities (37). The conclusion was that both
the sequences of the acceptor stem and of the anticodon loop were
critical to adjust the 3'-end of tRNA into the catalytic centre of
the synthetase. Noteworthy, although the anticodon loops of
EC.tRNAMam and EC.tRNAMaf have identical sequences, the
nucleotides composing the two acceptor stems of these tRNAs
are markedly different, while insuring identical high
aminoacylation rates. In reference 37, it was envisaged that, in
spite of such a difference, the two acceptor stems may share
common structural features important for their aminoacylation
by MTSEC.
In the mammalian cytoplasmic system, initiator and elongator
tRNAMet also differ at the level of their acceptor stems. In
addition, they are likely to carry anticodon loops of different sizes,
and, consequently, anticodon stems of different lengths.
Different conformations of the anticodon loops between
M.tRNAMel| and M.tRNAMa are suggested by the observation
that the anticodon loop of M.tRNAMa is much more sensitive
to S, nuclease attack than the 7-base anticodon loop of
M.tRNA Ma or of E.coli tRNAMam (42). Such a difference,
which markedly distinguishes between the two mammalian
tRNAs, is difficult to understand at the level of the mechanism
of tRNA aminoacylation by MTSOC. However, it provides some
molecular basis to explain the lack of recognition by MTSEC
of M.tRNA Ma , as compared to M.tRNAMct,.
Finally, the mitochondrial MTS from yeast has been reported
to aminoacylate both the E.coli initiator and elongator tRNAMct,
as efficiently as the two mitochondria! tRNAs Ma (20,22).
Interestingly, the mitochondrial elongator tRNAs Ma sequenced
up to now display the 7-nucleotide anticodon loop (33).
Therefore, as could be expected, the mitochondrial system
resembles its prokaryotic counterpart.
ACKNOWLEDGEMENTS
The authors wish to thank Dr J.P.Waller for the generous gift
of a sample of pure rabbit liver aminoacyl-tRNA synthetases
complex and for his interest. C.Lazennec is acknowledged for
skilfull technical help. This work was supported by grants from
the Ministere de la Recherche et de l'Enseignement supe'rieur
(87-C0392) and the Fondation pour la Recherche M&licale.
4746 Nucleic Acids Research, Vol. 20, No. 18
REFERENCES
1. Schulman, L.H. (1991) Prog. Nucleic Acid Res., 41, 2 3 - 8 7 .
2. Roe, B., Sirover, M. & Dudock, B. (1973) Biochemistry, 12, 4146-4154.
3. Kumazawa, Y., Yokogawa, T., Hasegawa, E., Miura, K. & Watanabc, K.
(1989) J. Biol. Chem., 264, 13005-13011.
4. Kumazawa, Y., Himeno, H.., Miura, K. & Watanabe, K. (\99l) Biochem.
J., 109, 421-427.
5. Edwards H. & Schimmel, P. (1987) Cell, 51, 643-649.
6. Hou, Y.M. & Schimmel, P. (1988) Nature, 333, 140-144.
7. Hou, Y.M. & Schimmel, P. (1989) Biochemistry, 28, 6800-6804.
8. Trezeguet V., Edwards H. & Schimmel, P. (1991) Mol. Cell. Biol., 11,
2744-2751.
9. Nazarenko, I.A., Peterson, E.T., Zakharova, O.D., Lavrik, O.I. &
Uhlenbeck, O.C. (1992) Nucleic Acids Res., 20, 475-478.
10. Sampson, J.R., DiRenzo, A.B., Behlen, L.S. & Uhlenbeck, O.C. (1989)
Science, 243, 1363-1366.
11. Sampson, J.R., Behlen, L.S., DiRenzo, A.B. & Uhlenbeck, O.C. (1992)
Biochemistry, 31, 4161-4167.
12. Hasegawa, T. Himeno, H., Ishikura, H. & Shimizu, M. (1989) Biochem.
Biophys. Res. Comm., 163, 1534-1538.
13. Putz, J., Puglisi, J.D., Florentz, C. & Giege, R. (1991) Science, 252,
1696-1699.
14. Edwards H. & Schimmel, P. (1990) Mol. Cell. Biol., 10, 1633-1641.
15. Edwards H., Trezeguet V. & Schimmel, P. (1991) Proc.Nall.Acad.Sci.
(USA), 88, 1153-1156.
16. RajBhandary, U.L. & Ghosh, H.P. (1969) / Biol. Chem., 244, 1104-1113.
17. Blanquet, S., Petrissant, G. & Waller, J.P. (1973) Eur.J. Biochem., 36,
227-233.
18. Guillemaut, P. & Weil, J.H. (1975) Biochim. Biophys. Ada, 407, 223-225.
19. Petrissant, G., Boisnard, M. & Puissant C. (1970) Biochim. Biophys. Ada,
213, 223-225.
20. Schneller, J.M., Schneider, C. & Stahl, A.J.C. (1978) Biochem. Biophys.
Res. Comm., 85, 1392-1399.
21. Carias, J.R., Mouricout, M. & Julien, R. (\9%\)Biochem. Biophys. Res.
Comm., 98, 735-742.
22. Schwob, E., Sanni, A., Fasiolo, F. & Martin, R.P. (1988) Eur. J. Biochem.,
178, 235-242.
23. Mirande, M., Cirakoglu, B. & Waller, J.P. (1983) Eur. J. Biochem., 131,
163-170.
24. Schulman, L.H. & Pelka, H. (1983) Proc.Natl.Acad.Sci. (USA), 80,
6755-6759.
25. Muramatsu, T., Nishikawa, K., Nemoto, F., Kuchino, Y., Nishimura, S.,
Miyazawa, T. & Yokoyama, S. (1988) Nature, 336, 179-181.
26. Schulman, L.H. & Pelka, H. (1988) Science, 242, 765-768.
27. Mcinnel, T., Mechulam, Y., Le Corre, D., Panvert, M., Blanquet, S. &
Fayat, G. (1991) Proc. Nail. Acad. Sci. (USA), 88, 291-295.
28. Mcinnel, T., Mechulam, Y., Blanquet, S. & Fayat, G. (1991)/.Afo/.flio/.,
220, 205-208.
29. Meinnel, T., Mechulam, Y. & Fayat, G. (1988) Nucleic Acids Res., 16,
8095-8096.
30. Guillon, J.M., Meinnel, T., Mechulam, Y., Lazennec, C , Blanquet, S. &
Fayat, G. (1992) J.Mol.Biol., 224, 359-367.
31. Mellot, P., Mechulam, Y., Le Corre, D., Blanquet, S. & Fayat, G. (1989)
J.Mol.Biol., 208, 429-443.
32. Blanquet, S., Iwatsubo, M. & Waller, J.P. (1973) Eur.J. Biochem., 36,
213-226.
33. Sprinzl, M., Hartmann T., Weber, J. & Zeidler, R. (1989) Nucleic Acids
Res., 17, r l - r l 7 2 .
34. Saenger, W. (1983) in Principles of Nucleic Acid Structure, C.R. Cantor
Editor, Springer-Verlag.
35. Petrissant, G.& Boisnard, M. (1974) Biochimie, 56, 787-789.
36. Bjdrk, G.R. (1987) in Escherichia coli and Salmonella typhimurium Cellular
and Molecular Biology, 719-731, F.C. Neidhardt Editor, American Society
for Microbiology, Washington, D.C.
37. Meinnel, T., Mechulam, Y., Lazennec, C , Blanquet, S. & Fayat, G. J.
Mol. Biol. in press
38. Martinis, S.A. & Schimmel, P. (1992) Proc. Natl. Acad. Sci. USA, 89,
65-69.
39. Cummins, C M . , Culbertson, M.R. & Knapp, G. (1985) Mol. Cell Biol.,
5, 1760-1771.
40. Curran, J.F. & Yarus, M. (1987) Science, 238, 1545-1550.
41. Cigan, A.M., Feng, L. & Donahue, T.F. (1988) Science, 242, 9 3 - 9 7 .
42. Wrede, P., Woo, N.H. & Rich, A. (1979) Proc. Natl. Acad. Sci. USA,
76, 3289-3293.
43. Cory, S. and Marcker, K.A. (1970) Eur.J.Biochem., 12, 177-194.