The 5ⴕ End of the Pea Ferredoxin-1 mRNA Mediates
Rapid and Reversible Light-Directed Changes in
Translation in Tobacco1
Eric R. Hansen, Marie E. Petracek2*, Lynn F. Dickey3, and William F. Thompson
Department of Botany, North Carolina State University, Raleigh, North Carolina 27695
Ferredoxin-1 (Fed-1) mRNA contains an internal light response element (iLRE) that destabilizes mRNA when light-grown
plants are placed in darkness. mRNAs containing this element dissociate from polyribosomes in the leaves of transgenic
tobacco (Nicotiana tabacum) plants transferred to the dark for 2 d. Here, we report in vivo labeling experiments with a
chloramphenicol acetyl transferase mRNA fused to the Fed-1 iLRE. Our data indicate that the Fed-1 iLRE mediates a rapid
decline in translational efficiency and that iLRE-containing mRNAs dissociate from polyribosomes within 20 min after plants
are transferred to darkness. Both events occur before the decline in mRNA abundance, and polyribosome association is
rapidly reversible if plants are re-illuminated. These observations support a model in which Fed-1 mRNA in illuminated
leaves is stabilized by its association with polyribosomes, and/or by translation. In darkness a large portion of the mRNA
dissociates from polyribosomes and is subsequently degraded. We also show that a significant portion of total tobacco leaf
mRNA is shifted from polyribosomal to non-polyribosomal fractions after 20 min in the dark, indicating that translation of
other mRNAs is also rapidly down-regulated in response to darkness. This class includes some, but not all, cytoplasmic
mRNAs encoding proteins involved in photosynthesis.
Light affects plant gene expression at many levels,
including transcription, mRNA stability, translation,
and post-translational steps (Thompson and White,
1991; Harter et al., 1994; Mayfield and Cohen, 1998),
and multiple levels of regulation may affect the expression of a particular gene. Ferredoxin-1 (Fed-1), a
nuclear gene from pea encoding the major chloroplast isoform of ferredoxin, exemplifies this complexity. Fed-1 mRNA abundance is regulated by light at
the level of transcription initiation in etiolated seedlings (Gallo-Meagher et al., 1992). In green leaves,
however, Fed-1 mRNA abundance is regulated primarily by changes in mRNA stability (Elliot et al.,
1989; Petracek et al., 1998b). In green leaves Fed-1
mRNA levels decline during extended dark periods
and increase dramatically upon 6 h of re-illumination
(Dickey et al., 1992). Most of this light effect persists
when Fed-1 mRNA is transcribed from the constitu-
1
This work was supported by the National Science Foundation
(grant no. MCB–9507396), the National Institutes of Health (grant
no. GM43108 to W.F.T. and L.F.D.), and the U.S. Department of
Agriculture (grant no. 98 –35301–7012 to M.E.P.). E.R.H. was supported by the U.S. Department of Education, Graduate Assistance
in Areas of National Need-Interdisciplinary Doctoral Program in
Biotechnology. This research was supported by the Oklahoma
Agricultural Experiment Station (project no. H–2427).
2
Present address: 246 NRC, Oklahoma State University, Stillwater, OK 74078.
3
Present address: Biolex, 480 Hillsboro Street, Suite 100, Pittsboro, NC 27312.
* Corresponding author; e-mail marie petracek@biochem.
okstate.edu; fax 405–744 –7799.
770
tive CaMV 35S-promoter (light:dark ratio [L:D] is 4to 5-fold) (Elliot et al., 1989). The element responsible
for this post-transcriptional light regulation is the
internal light regulatory element (iLRE). The Fed-1
iLRE is contained within the 89-base untranslated
region (5⬘ UTR) and the first one-third (141 bases) of
the coding region. Fusion to the iLRE confers light
responsiveness on normally non-responsive mRNAs
(Dickey et al., 1992). Direct half-life measurements
using a repressible promoter system (Gatz, 1995)
have confirmed that this light effect results from a
change in mRNA stability. In the leaves of plants
transferred from light to darkness, the half-life of
Fed-1 mRNA decreases from 2.4 h to 1.2 h (Petracek et
al., 1998b).
Two lines of evidence suggest that changes in
translation are required for the observed changes in
Fed-1 mRNA stability. First, light effects on Fed-1
mRNA abundance are observed only when the Fed-1
iLRE contains an open reading frame (Dickey et al.,
1994, 1998). Second, Fed-1 mRNA is preferentially
associated with polyribosomes in illuminated leaves
but dissociates when plants are kept in darkness
(Petracek et al., 1997; Dickey et al., 1998) or treated
with 3-(3, 4-dichlorophenyl)-1,1-dimethylurea, an inhibitor of photosynthetic electron transport (Petracek
et al., 1998b). The dissociation of Fed-1 mRNA from
polyribosomes in the presence of 3-(3, 4-dichlorophenyl)-1,1-dimethylurea correlates with a decline in
mRNA half-life similar to that observed in darkness,
suggesting that photosynthesis is essential for Fed-1
mRNA translation and stability in the light (Petracek
et al., 1998b).
Plant Physiology, February 2001, Vol. 125, pp. 770–778, www.plantphysiol.org © 2001 American Society of Plant Physiologists
In Vivo Light-Regulated Translation of Pea Ferredoxin mRNA
These observations led us to propose that mRNAs
containing the Fed-1 iLRE are translated more efficiently in photosynthetically active cells and that the
process of translation and/or the presence of ribosomes on the mRNA reduces its degradation. That
translating ribosomes can provide protection from
degradation has been well described in prokaryotic
systems (e.g. Iost and Dreyfus, 1995). In this paper
we present time-course data on polyribosome association and translation efficiency of a model mRNA
containing the Fed-1 iLRE. Consistent with our
model, dark-induced dissociation of this mRNA from
polyribosomes is rapid and reversible, and in vivo
labeling data indicate that its rate of translation declines prior to the decrease in its abundance. It is
interesting that other mRNAs, including full-length
pea Fed-1 mRNA, endogenous tobacco (Nicotiana
tabacum) Fed-1 mRNA, and endogenous tobacco Lhcb
mRNA, were also rapidly released from ribosomes in
the dark, suggesting they may be regulated by a
translational mechanism similar to that regulating
Fed-1. Not all photosynthesis-related mRNAs show
this response, but we suggest that an important subclass of leaf mRNAs exhibit a translation-mediated
response to changes in photosynthetic activity.
RESULTS
Translational Efficiency Declines during a Light-toDark Transition
We used two approaches to examine the translational response of Fed-1 mRNA. Both involved a reporter mRNA constructed by fusing chloramphenicol
acetyltransferase (CAT) mRNA to the Fed-1 iLRE as
previously described (Dickey et al., 1998; Fig. 1). Our
first approach involved in vivo labeling with a mixture of [35S]Met and [35S]Cys, followed by immunoprecipitation of the fusion protein with an antibody
against CAT. To avoid wound effects, we applied
the 35S-precursors to the leaf surfaces of intact seedlings for 2.5 h. (In our hands, this is the shortest time
period during which a sufficient amount of label
is absorbed and incorporated into protein.) Figure 2
and Table I show that incorporation of [35S]Met and
[35S]Cys into the Fed-1 iLRE::CAT fusion protein was
5.8-fold less in the dark than in the light. In contrast,
transgenic 35S::Fed-1 5⬘ UTR::CAT plants showed only
a 1.7-fold decrease in incorporation into CAT protein,
whereas control plants containing a 35S::CAT transgene showed a 1.4-fold decrease.
Given the rapid decline in translational activity, it
was of interest to know whether or not there was a
similarly rapid change in mRNA abundance. After
2.5 h of darkness, Fed-1 iLRE::CAT mRNA abundance
declined 2.4-fold (Table I). This decline continued
until 6 h, when Fed-1 iLRE::CAT mRNA levels were
reduced by approximately 4- to 5-fold relative to
those in light-treated leaves (Fig. 2B; Table I; Dickey
et al., 1992). Thus, the effect of darkness on Fed-1
Plant Physiol. Vol. 125, 2001
Figure 1. Diagrams of the transgenes used. Shown are the gene
constructs used to transform tobacco plants. Except for 35S::FedA,
plants expressing these constructs were previously characterized, as
indicated. A, 35S::CAT (Petracek et al., 1997); B, 35S::Fed-1
5⬘-UTR::CAT (Dickey et al., 1998); C, 35S::Fed-1 iLRE::CAT (Dickey
et al., 1998); D, 35S::Fed-1 (Dickey et al., 1992); E, 35S::PetE::Nos
(Helliwell et al., 1997); F, 35S::FedA was constructed to achieve
transcription at the transcriptional start site reported for the endogenous gene (Somers et al., 1990; Vorst et al., 1990).
iLRE::CAT mRNA abundance is not complete at
2.5 h. CAT control and Fed-1 5⬘ UTR::CAT mRNAs
showed minimal decreases after 2.5 h of darkness,
consistent with previous mRNA abundance measurements indicating that there is little, if any, light
effect on mRNA produced by these transgenes
(Dickey et al., 1992).
An estimate of the change (⌬) in translational
efficiency for each mRNA was made by dividing the
relative amount of 35S-incorporation into CAT protein by the corresponding relative mRNA abundance value (Table I). The resulting ratio reflects the
difference in translational efficiency (amino acid incorporation per unit mRNA) of Fed-1 iLRE::CAT
mRNA in leaves exposed to light or darkness. Table
I shows that the translational efficiency Fed-1
iLRE::CAT mRNA was 2.4-fold greater in the light
than during the first 2.5 h of darkness. In contrast,
CAT and Fed-1 5⬘ UTR::CAT mRNAs exhibited no
change in translational efficiencies between the light
and dark.
When the labeling period was lengthened to 6 h,
35
S-incorporation into Fed-1 iLRE::CAT protein in
the dark decreased slightly from that observed after
2.5 h (Table I). However, this additional decline
notably was more than offset by a further decrease
in Fed-1 iLRE::CAT mRNA abundance, resulting in a
less dramatic change in the translational efficiency
after 6 h darkness than after 2.5 h. We conclude that
an initial decline in translational activity is followed
by a decline in mRNA abundance, but that mRNA
surviving the decline continues to be actively
translated.
771
Hansen et al.
Figure 2. Autoradiograph of immunoprecipitated proteins from tobacco plants labeled for 2.5 h. Six-week-old plants grown on a 12-h
light/dark cycle were labeled in the light (L) or dark (D) for 2.5 h.
Sample volumes were adjusted to represent an equal number of
counts taken up in the tissue. Fed-1 iLRE:CAT fusion protein has
lower mobility than CAT, as predicted by its higher Mr. A, Radioactivity in immunoprecipitated CAT or CAT fusion proteins was measured with a Phosphorimager as described in “Materials and Methods.” The boxes around the Fed-1 iLRE:CAT and CAT protein bands
represent the approximate area counted. Background was estimated
by moving the boxes to a position immediately above the protein
bands. Resulting total counts are as follows: Fed-1 iLRE::CAT L
(462,000), D (65,000), CAT L (61,000), D (72,000), and Fed-1
5⬘-UTR::CAT L (47,000), and D (57,000). B, RNA was extracted from
the light- and dark-treated samples shown in A and 5 ␮g of total
RNA was analyzed by northern-blot analysis using 32P-labeled antisense CAT.
Polyribosome Association Decreases
Rapidly in the Dark
As a second approach, and to more closely follow
the kinetics of translational and mRNA abundance
changes, we asked how polyribosome association
and mRNA abundance change with time after transfer to darkness. We knew that Fed-1 mRNA dissociates from polyribosomes during 2 d in darkness and
becomes associated with polyribosomes upon reillumination for 2 h (Petracek et al., 1997). However,
these experiments did not provide kinetic information about the early phase of the response. Therefore,
we placed tobacco plants containing the 35S::Fed-1
iLRE::CAT transgene in darkness for 20, 40, or 60 min
prior to isolation of polyribosomes and total mRNA.
Polyribosomes were extracted and fractionated on
Suc gradients as described in “Materials and Methods.” The gradients were then fractionated, and the
RNA in each fraction examined on northern blots
hybridized with a probe for CAT sequences. Examples of northern analyses from a typical series of Suc
gradients are presented in Figure 3A. Quantitative
phosphorimager analysis of several gradients allowed
772
us to calculate the percentage of Fed-1 iLRE::CAT
mRNA in the polyribosome fractions (Fig. 3B). These
data show that Fed-1 iLRE::CAT mRNA dissociates
very rapidly after the onset of darkness, with maximal
dissociation being achieved within 20 min.
Next, we asked if the decline in Fed-1 iLRE::CAT
mRNA abundance preceded or followed polyribosome dissociation. We measured the relative abundance of Fed-1 iLRE::CAT mRNA in RNA samples
taken 20, 40, and 60 min after transfer to darkness
(Fig. 3C). Fed-1 iLRE::CAT mRNA declined only
gradually during the first hour of darkness. At 20
min we did not detect a statistically significant decrease, even though most of the mRNA had dissociated from polyribosomes at this time. After 40 and 60
min of darkness, mRNA levels were still approximately 80% and 50%, respectively, of what they had
been in the light (Table I). It is clear that most if not
all of the decline in Fed-1 iLRE::CAT mRNA abundance occurs after dissociation of polyribosomes.
We asked if the polyribosome dissociation of Fed-1
iLRE mRNAs was unique or if other plant mRNAs
are also rapidly dissociated from polyribosomes in
the dark. Figure 3D shows UV absorbance profiles of
polyribosome gradients corresponding to the time
points presented in Figure 3A. Even at 20 min there
was a substantial reduction in the area under the
polyribosome peaks and a concomitant increase in
non-polyribosomal material, indicating that many
mRNAs dissociate from polyribosomes in darkness
with kinetics similar to that of the Fed-1 iLRE::CAT
mRNA.
The Decline in Polyribosome-Associated mRNA Is
Rapidly Reversed upon Re-Illumination
Fed-1 mRNA abundance increases when plants are
returned to the light after an extended dark treatment
(3 d) (Elliot et al., 1989), and this increase is accompanied by an increase in polyribosome association
(Petracek et al., 1997). However, our previous reillumination experiments have not examined the kinetics of these processes. In view of the rapid changes
that occur after transfer to darkness, it was of interest
to obtain kinetic data for the re-illumination response. Tobacco plants containing the 35S::Fed-1
iLRE::CAT transgene were transferred to darkness
for 60 min and then returned to the light for 30, 60, or
120 min. Northern analysis of polyribosome gradients (Fig. 4, A and B) showed that the proportion of
Fed-1 iLRE::CAT mRNA in the polyribosomal fraction
increases from 30% at the end of the dark period to
55% after 30 min in the light, and reaches 70% after
2 h. As there is a similarly rapid increase in mRNA
abundance (Fig. 4C), the total translational potential
must increase even more dramatically. We conclude
that the iLRE-mediated decline in translational activity is rapidly reversed when plants are returned to
the light and that the increase probably involves both
pre-existing and newly synthesized mRNA.
Plant Physiol. Vol. 125, 2001
In Vivo Light-Regulated Translation of Pea Ferredoxin mRNA
Table I. [35S]Met/Cys incorporation, mRNA abundance, and relative translational efficiency after
transfer to darkness
Vessels containing eight 6-week-old tobacco plants were either transferred to the dark or left in the
light and [35S]Met/Cys was applied. Labeling time indicates the length of time the plants were exposed
to the [35S]Met/Cys. Sample size (n) refers to the number of vessels used for protein labeling. For each
experiment, mRNA was extracted from plants in an additional container. Differences in label uptake in
the light and dark were determined from total protein extract radioactivity and the volume of immunoprecipitate loaded in the wells of the gel was corrected by the corresponding percent difference for
each light-dark set. 35S-labeled transgenic protein was quantified by Phosphorimager analysis. L:D
represents light:dark ratios. The change in translational efficiency (⌬ Translational Efficiency) is obtained by dividing amino acid incorporation ratios by mRNA abundance ratios.
Transgene
Labeling Time
Amino Acid
Incorporation
35S⬋Fed-1 iLRE⬋CAT
35S⬋Fed-1 5⬘ UTR⬋CAT
35S⬋CAT
35S⬋Fed-1 iLRE⬋CAT
2.5 h (n ⫽ 5)
2.5 h (n ⫽ 6)
2.5 h (n ⫽ 5)
6 h (n ⫽ 3)
5.8 (1.1)
1.7 (1.1)
1.4 (0.5)
6.7 (1.2)
mRNA
Abundance
⌬ Translational
Efficiency
2.4 (0.2)
1.7 (0.2)
1.3 (0.4)
4.2 (1.1)
2.4
1.0
1.1
1.6
L:D (SE)
Polyribosome Association of Other Photosynthetic and
Non-Photosynthetic Genes
To determine whether CAT sequences contributed
to the rapid decline in the association of Fed-1
iLRE::CAT mRNA with polyribosomes, we measured
polyribosome association of full length Fed-1 mRNA
after a brief dark treatment. Like Fed-1 iLRE::CAT
mRNA, full length Fed-1 mRNA dissociates from
polyribosomes after 20 min of darkness (Fig. 5).
However, 35S::CAT mRNA showed no changed in
polyribosome association under the same conditions
(M.E. Petracek, data not shown). Together these results indicate that the rapid dissociation did not require CAT sequences.
If the rapid changes in polyribosome association
are not unique to pea Fed-1 mRNA, they may represent an important form of post-transcriptional control. Thus, we measured the polyribosome association of several mRNAs encoding photosynthetic and
non-photosynthetic proteins, using leaves harvested
in the light or after 20 min of darkness. Figure 5
shows that full-length transgenic Fed-1, endogenous
tobacco Fed-1, and endogenous tobacco Lhcb mRNAs
all dissociate from polyribosomes in darkness,
suggesting that these mRNAs are regulated by a
translational mechanism similar to that of Fed-1
iLRE::CAT. The rapid response of Lhcb mRNA also
suggested that this mechanism might affect other
genes for photosynthesis-related proteins. However,
it is notable that the dissociation pattern of the transgenic pea Fed-1 mRNA is different from that of both
Lhcb and endogenous tobacco Fed-1 mRNA. For all
three mRNAs in the dark, a substantial portion of
the mRNA shifts to non-polyribosomal fractions,
whereas a lesser portion remains in the polyribosome
fractions. In the case of pea Fed-1 mRNA, however,
Figure 5 shows that mRNAs remaining in the polyribosome fractions are associated with fewer ribosomes, shifting from fractions 8 and 9 in the light to
fractions 6 and 7 in the dark. No such shift was
Plant Physiol. Vol. 125, 2001
L:D
observed for endogenous tobacco Fed-1 mRNA and
Lhcb mRNA, suggesting that in these cases the number of ribosomes per translated mRNA remains the
same.
The mRNAs of two other photosynthetic transgenes in tobacco, 35S::FedA (Arabidopsis ferredoxin)
(Caspar and Quail, 1993; Bovy et al., 1995) and
35S::PetE (pea plastocyanin) (Helliwell et al., 1997),
do not display appreciable declines in polyribosome
association in the dark (Fig. 5). PetE mRNA has been
shown to increase by 5.3-fold when etiolated seedlings containing 35S::PetE constructs were exposed to
light (Helliwell et al., 1997), and we have shown that
PetE mRNA increases 3-fold when plants held for
40 h in the dark are re-illuminated for 6 h (Table II).
Because light has little effect on the 35S-promoter, we
interpret both sets of results as indicating changes in
the stability of PetE mRNA. However, in contrast
to the Fed-1 response, these changes may take place
in the polyribosomal fraction.
Plants in which FedA is transcribed from the 35Spromoter do not show appreciable changes in FedA
mRNA abundance or polyribosome association in
re-illumination experiments (Table II; Bovy et al.,
1995; M. Petracek, unpublished data). Although these
results are not fully understood, they emphasize the
likelihood that not all nuclear-encoded photosynthetic mRNAs display the translation-linked mRNA
stability response documented for pea Fed-1.
In addition to mRNAs associated with photosynthesis, we also examined polyribosome profiles for
the non-light regulated endogenous tobacco mRNA,
eIF-4A10 (GenBank accession no. X79009), which encodes a translation initiation factor. Polyribosome
association of this mRNA also did not decline in the
dark (Fig. 5). Taken together, these observations suggest that a subset of nuclear-encoded photosynthetic
genes is translationally regulated through a mechanism similar to pea Fed-1.
773
Hansen et al.
DISCUSSION
Figure 3. Polyribosome association of Fed-1 iLRE::CAT mRNA in
plants transferred from light to dark. Transgenic 35S::Fed-1
iLRE::CAT tobacco were transferred to the dark for the time indicated, beginning during the 4th h of the light phase (time 0) of the
12-h-light/12-h-dark cycle. A, Autoradiograms of northern blots of
Fed-1 iLRE::CAT mRNA fractionated on a Suc density gradient and
resolved by gel electrophoresis. Fractions are labeled 1 through 12
from the top to the bottom of the gradient. The resulting gels were
blotted to nylon membrane and hybridized with 32P-labeled antisense probe for CAT sequences. Fractions 1 to 5 from the top of the
gradient contain mRNA not associated with polyribosomes, whereas
fractions 6 to 12 contain polyribosomal mRNA. The time that plants
were in darkness is indicated in minutes. Sample sizes were not the
same on each gradient so signal strengths on the northern blots can
be directly compared only within a given gradient. B, Percent polyribosome association of Fed-1 iLRE::CAT mRNA after 0, 20, 40, and
60 min in the dark. The percentage of mRNA in the polyribosomal
fractions is calculated from Phosphorimager analysis of three separate experiments including the northern blots shown in 4A. C,
Change in Fed-1 iLRE::CAT mRNA abundance after 0, 20, 40, and 60
min in the dark. Data was derived by Phosphorimager analysis of
northern blots of 5 ␮g of total mRNA hybridized with 32P-labeled
CAT specific antisense RNA. Each time point represents the average
of at least three different experiments. Total abundance is shown
relative to the abundance at zero time. D, UV A254 profiles of
polyribosome fractionations were recorded after ultracentrifugation
by pumping the gradient through a cuvette. Sample extracts included
chloroplast ribosomes as well as cytoplasmic ribosomes, yielding
multiple ribosomal subunit peaks (approximately fractions 2–4). The
x axis is labeled with numbers indicating the approximate posi774
We have shown that mRNA containing the Fed-1
iLRE ceases translation and dissociates from polyribosomes soon after photosynthetically active green
leaves are transferred from light to darkness. Polyribosome dissociation reached a maximum by 20 min
in the dark, well before a significant decline in
mRNA abundance. This observation provides strong
additional support for a model (Petracek et al., 1998a)
in which Fed-1 mRNA is protected from degradation
in the light by association with ribosomes and/or the
act of translation.
The decrease we observe in translational efficiency
(translational activity per unit mRNA) of Fed-1
iLRE::CAT mRNA is associated with a shift from the
polyribosomal to the non-polyribosomal fractions.
This shift occurs quite soon after the onset of darkness. We therefore propose that iLRE-containing
mRNAs dissociate from polyribosomes prior to the
onset of increased degradation, resulting in a transient accumulation of Fed-1 iLRE::CAT mRNA in the
non-polyribosomal fractions. Because this pool of
“free” mRNA is translationally inactive, its presence
decreases the average translational efficiency of the
mRNA population, even though the small amount of
mRNA remaining on polyribosomes may still be actively translated. At later times, the amount of free
mRNA decreases, probably as the result of preferential degradation (Petracek et al., 1998b). If polyribosomal messages continue to be translated normally,
the resulting decrease in free mRNA would account
for the increase in translational efficiency (translation
per unit of mRNA present anywhere in the cell) that
we observe between 2.5 and 6 h of darkness.
Our data are most consistent with a model in which
translational initiation, rather than translational elongation or termination, is the principal process affected by the light to dark transition. If elongation or
termination was blocked in darkness, one would expect polyribosome association to remain high, as observed for RbcS mRNA in Amaranth seedlings (Berry
et al., 1988). Untranslated mRNAs might then be
degraded while still associated with ribosomes, and
there would be no accumulation of free mRNA. In
contrast, we observe a rapid and transient accumulation of free Fed-1 iLRE::CAT and Fed-1 mRNA (fraction 2 in Figs. 3A and 5). This accumulation is strongly
suggestive of reduced translational initiation.
Although PetE mRNA regulation seems similar to
that of Fed-1 mRNA in many respects (Helliwell et al.,
1997), we detected no increase in the nonpolyribosomal PetE mRNA in the dark. The apparent
tion of the fractions collected for the northern analysis shown in A
through C. Polyribosomal and non-polyribosomal portions of the
gradient are indicated. Fractions 4 and 5 represent the monosome
peak. The sensitivity of the chart recorder was increased by a factor
of two at the position indicated by the arrow. The y axis indicates the
relative UV A254.
Plant Physiol. Vol. 125, 2001
In Vivo Light-Regulated Translation of Pea Ferredoxin mRNA
in translation of all proteins. However, we believe it
is more likely to reflect a selective effect on the translation of a few abundant mRNAs encoding highly
expressed photosynthetic proteins. As a first step in
testing this hypothesis, we have identified a number
of other transcripts that are preferentially depleted in
the polyribosome fraction shortly after transfer to
darkness. Almost all encode proteins known to be
involved in photosynthesis (M.E. Petracek, unpublished data). Although it is clear that not all
photosynthesis-related mRNAs are regulated this
way, further investigation may reveal a regulatory
subclass in which mRNA stability is strongly influenced by rapid changes in translational initiation.
MATERIALS AND METHODS
Plasmid Construction and Tobacco Transformation
Figure 4. Reversible dissociation/re-association of Fed-1 iLRE::CAT
mRNA. Transgenic 35S:: Fed-1 iLRE::CAT tobacco were transferred
to the dark for 1 h, beginning during the 4th h of the light phase as
described for Figure 3. Plants were then transferred back to the light
for the indicated times prior to harvest. A, Autoradiograms of northern blots of Fed-1 iLRE::CAT mRNA fractionated on a Suc density
gradient. Fractions are labeled 1 through 12 from the top to the
bottom of the gradient. RNA was purified from each fraction and
analyzed by gel-blot hybridization using a32P-labeled antisense
probe for CAT sequences. Different gradients were not loaded
equally so band intensities can be compared only within a given
gradient. B, Percentage of polyribosome association of Fed-1
iLRE::CAT mRNA after 0, 30, 60, and 120 min of re-illumination. The
percentage of mRNA in the polyribosomal fractions is calculated
from Phosphorimager data for three separate experiments, including
northern blots shown in A. C, Change in Fed-1 iLRE::CAT mRNA
abundance following 1 h of dark and various periods of reillumination. The relative amount of Fed-1 iLRE::CAT hybridizing
RNA was calculated from at least three different experiments at each
time point. Data were derived by Phosphorimager analysis of northern blots hybridized with a 32P-labeled CAT -specific antisense RNA
probe. Abundance is shown relative to that at zero time.
lack of a change in polyribosome association during
either a 20-min (Fig. 5) or a 40-h dark treatment (M.E.
Petracek, data not shown) may indicate that PetE
mRNA translation does not respond to darkness.
However, an alternative possibility that we consider
more likely is that PetE mRNA is very rapidly degraded in the absence of polyribosomal protection
and thus cannot be detected in non-polyribosomal
fractions.
In dark-treated plants, a decline in total polyribosomal mRNA parallels the changes we have observed for mRNA containing the Fed-1 iLRE. This
decline implies a considerable decrease in translation
within the cell, which is consistent with our observation that darkness reduced total amino acid incorporation by 30% in a 2.5-h labeling period (E.R. Hansen,
data not shown). In principle, this decline in isotope
incorporation could result from a uniform decrease
Plant Physiol. Vol. 125, 2001
All plasmids for the production of transgenic plants
were made by inserting the appropriate sequences behind
the 35S-promoter of pBi121 (Jefferson, 1987). Plasmids
were transferred into Agrobacterium tumafaciens by triparental mating and transgenic tobacco (Nicotiana tabacum)
were derived via Agrobacterium sp.-mediated leaf disc
transformation into tobacco (cv SR-1 and cv Petite Havana)
plants (Horsch et al., 1985). Line 1520 contains the 35S::CAT
transgene (Petracek et al., 1997); line 2910 contains the
35S::5⬘-UTR Fed-1::CAT transgene (Dickey et al., 1998); and
line 1458 contains 35S::Fed-1 iLRE::CAT (Dickey et al., 1998)
transgene and includes the entire 230-bp Fed-1 iLRE (GenBank accession no. M31713; nt 677–907). Line 312,
35S::Fed-1 contains the Fed-1 transcribed and terminator
sequences, and line 35S::PetE (GenBank accession no.
X16082; nt 760–1,319) tobacco plants were as described
previously (Helliwell et al., 1997).
The 35S::FedA plasmid was constructed as follows. We
wanted an Arabidopsis FedA transgene that initiates transcription at the natural FedA initiation site. We performed
two-step PCR. TC2 (Caspar and Quail, 1993), which contains
the entire FedA mRNA sequence and promoter, was used as
a template in the first PCR reaction to generate an approximately 800-bp product. A hybrid oligonucleotide (5⬘ TCATTTCAT T TGGAGAGGAATAATCCTCAAAAATCTCAA 3⬘)
composed of the last 19 nt of the CaMV 35S-promoter (up to
the transcriptional start site) and the first 20 nt of the FedA 5⬘
UTR (underlined) was used as the 5⬘ primer. The 3⬘ primer
(5⬘ CAGGAGCTCTCTAGAGAATTATCAATCTAAGATT 3⬘)
was homologous to the antisense 3⬘ portion of FedA with SacI
and XbaI sites (underlined) added. A second PCR reaction
was performed as described (Dickey et al., 1994). Specifically,
the resulting approximately 800-bp PCR product from the
first PCR step was used as a 3⬘ primer on a 35S-promoter
template with the 5⬘ primer (5⬘ TGCAAGCTTCCCACAGAATGGTTAGAGAGGC 3⬘) designed to have homology to
the 5⬘ end of the 35S-promoter while incorporating a HindIII
site (underlined). The resulting approximately 1,600-bp fusion PCR product consists of the 35S-promoter and FedA
transcript and directs transcriptional initiation at the native
FedA transcription start site without the addition of 35S775
Hansen et al.
Figure 5. Polyribosome association of transgenic and endogenous mRNAs. Wild-type tobacco or plants containing various
transgenes (35S::Fed-1, 35S::FedA, or 35S::PetE) or wild-type tobacco plants (for endogenous genes) were transferred to
darkness for 20 min as described in Figure 3 or allowed to remain in the light before harvest. Following Suc gradient
ultracentrifugation, RNA from the resulting gradient fractions 1 through 12, numbered from the top to bottom of the gradient,
were resolved by gel electrophoresis. The resulting gels were blotted to nylon membrane and hybridized with 32P-labeled
antisense gene-specific probes as indicated. The polyribosome association profile for each mRNA is representative of two
to three independent experiments. Different gradients were not loaded equally so signal strengths on the northern blots can
be compared only within the same gradient.
promoter sequences on the transcript (M.E. Petracek, unpublished data). The approximately 1,600-bp PCR product was
digested with HindIII and SacI and ligated into the HindIII/
SacI sites of pGPTV-Kan (Becker et al., 1992) and transformed
into Agrobacterium tumefaciens strain LBA4404 by triparental
mating (Elliot et al., 1989).
Plant Growth
Transgenic seeds were germinated in petri dishes on
sterile solid Murashige and Skoog media containing 0.8%
(w/v) Phytagar (Life Technologies, Grand Island, NY) and
kanamycin (300 mg/mL). After 3 weeks, resistant seedlings
were transferred to Plant-Cons (ICN Pharmaceutical, Costa
Mesa, CA) containing sterile solid Murashige and Skoog
Table II. Light:dark mRNA accumulation ratios following 40-h
dark treatment and 6-h re-illumination
Plants for determining mRNA 40-h-D ⫹ 6-h-L/40-h-D accumulation were placed in the dark for 40 h and either kept in the dark or
re-illuminated for an additional 6 h. The mRNA abundance data is
the result of at least three independent experiments using 5 ␮g of
total mRNA. The resulting gels for both the polyribosome analysis
and mRNA abundance were blotted to nylon membrane and hybridized with 32P-labeled antisense gene-specific probes as indicated.
776
Gene or Transgene
L/D ⫾
35S⬋Fed-1
Endogenous Fed-1
Endogenous Lhcb
35S⬋FedA
35S⬋PetE
4.0 ⫾ 1.4
2.4 ⫾ 0.4
10.5 ⫾ 3.4
1.5 ⫾ 0.2
3.0 ⫾ 0.2
SE
media, at a density of 8 to 10 seedlings per container. The
seedlings were grown for an additional 3 weeks in a
growth chamber at 22°C using a 12-h light/12-h dark cycle
with 12 fluorescent and six incandescent lamps that produced a light fluence of approximately 240 ␮mol m⫺2 s⫺1
between 380 and 780 nm.
For polyribosome experiments, the Plant-Cons were
wrapped in three layers of aluminum foil. After 20, 40, or
60 min of darkness, the containers were unwrapped and
leaves were harvested in the dark. For some experiments,
plants were placed in the dark for 1 h, followed by reillumination. In these experiments, containers with plants
were wrapped in aluminum foil as above. After 1 h of
darkness, the foil was removed and leaves were harvested
after 0, 30, 60, and 120 min in the light. All samples were
harvested directly into liquid nitrogen and subsequently
stored at ⫺80°C. Frozen tissue was broken into small fragments (2–4 mm2) and mixed with a glass rod while immersed in liquid nitrogen. Separate portions of the resulting powder were then used for total RNA extraction and
polyribosome analysis.
For in vivo labeling experiments, pairs of Plant-Cons
with similar plants were used for light to dark comparisons
and analyzed together. Closed containers are beneficial in
these experiments for several reasons. First, leaves of
plants grown under tissue culture conditions have thinner
cuticles and absorb radioactive label at higher rates than
plants grown in open air. Second, the closed containers
prevent the release of volatile radioactive compounds during labeling. Also, the use of sterile conditions reduces the
problem of incorporation of radioactive amino acids by
epiphytic bacteria.
Plant Physiol. Vol. 125, 2001
In Vivo Light-Regulated Translation of Pea Ferredoxin mRNA
RNA Analysis
For mRNA abundance measurements, total RNA was
prepared from each sample, 5 ␮g was run in each lane and
analyzed by RNA-blot (northern) analysis as described
previously (Elliot et al., 1989). Polyribosome analysis was
performed using a modification of a published protocol
(Davies and Abe, 1995). These modifications have been
previously described in detail (Petracek et al., 1997); the
following provides a brief summary. Approximately 100–
250 mg of leaf tissue were used for each gradient. In
general, lower quantities of tissue resulted in less mRNA
degradation. We avoided weighing samples prior to grinding and extraction to prevent even slight tissue thawing
(and thus mRNA degradation). Therefore, different gradients were not loaded equally, and the total signal on northern blots cannot be compared between different treatments. Sample extracts were centrifuged for 15 min at
9,000g to remove plant debris, but the polyribosomes were
not pelleted. Extract (750 ␮L) was loaded directly onto a
14-mL 15% to 60% (w/v) Suc gradient. After ultracentrifugation for 3.5 h in an AH-629 rotor at 88,300g, the gradient
was fractionated using an ISCO syringe pump fractionator
(ISCO Separations, Lincoln, NE). One-milliliter fractions
were dripped directly into phenol:chloroform:isoamylalcohol supplemented with 25 ␮L of 10% (w/v) SDS, 20 ␮L
of 0.5 m EDTA, and 5 ␮L of 100 mm aurin tricarboxylic acid,
followed rapidly by ethyl alcohol precipitation with sodium acetate of the aqueous phase. Following glyoxylation,
one-third of each fraction was loaded onto a phosphatebuffered 1.5% (w/v) agarose gel. Hybridizations were carried out using antisense RNA probes as described (Dickey
et al., 1992). mRNAs were quantified using a Phosphorimager (Molecular Dynamics, Sunnyvale, CA) to detect radioactive signals after RNA-blot hybridization.
Labeling with
35
S-Amino Acids
The plants in each Plant-Con were labeled with 250 ␮Ci
of ⬎1,000 Ci (37.0 TBq)/mmol [35S]Met and [35S]Cys
(EXPRE35S35S Labeling Mix, NEN Life Science Products,
Boston) diluted to 200 ␮L of final volume in water, 0.1%
(v/v) Tween 20, with no additional buffer. The label was
spotted on the leaves with a pipettor and spread with a soft
paintbrush. Immediately after application of 35S-amino acids, containers for dark-labeling were wrapped in aluminum foil, and all Plant-Cons were returned to the growth
chamber for 2.5 h. Plants were then harvested, rinsed
briefly in water containing 1 mm unlabeled Met, frozen in
liquid nitrogen, and stored at ⫺80°C until samples were
prepared.
Protein Extraction and Immunoprecipitation
Labeled plant tissue (0.5–1.0 g) was ground to a fine
powder under liquid nitrogen. Three milliliters of phosphate buffered saline containing 0.8 mm phenylmethylsulfonyl fluoride, 10 mm diethyl-dithiocarbamate, 1 ␮g
mL⫺1 aprotinin (Sigma, St. Louis), 1 ␮g mL⫺1 transEpoxysuccinyl-l-leucylamido (4-guanidino) butane (SigPlant Physiol. Vol. 125, 2001
ma), and 0.5% (v/v) ␤-mercaptoethanol were added to the
sample, along with approximately 0.2 g of insoluble polyvinylpolypyrolidone (Sigma). Upon thawing, the sample
was briefly ground and transferred to a 15-mL round bottom snap-cap tube (Falcon) and centrifuged at 9,400g for 15
min in a Sorvall SA600 rotor to remove debris. The supernatant was transferred into two 2.2-mL Eppendorf tubes
and centrifuged at 13,100g at 4°C for 30 min. The supernatant was transferred to a new tube and centrifuged for an
additional 30 min at 4°C. To avoid excessive protein degradation, equal volumes of protein extract from light and
dark samples were used immediately for immunoprecipitation. The remaining total protein extract was used to
calculate relative uptake of radiolabeled amino acid in the
light compared to the dark. The amount of immunoprecipitated product used for SDS-PAGE was adjusted to account for greater label uptake in the light.
For immunopreciptitation of CAT-containing proteins,
0.85 mL of the final supernatant was combined with 60 ␮L
of immobilized anti-CAT antibody sepharose beads (Eppendorf 5 Prime, Boulder, CO) and shaken on a rotary
shaker for 2.5 h at room temperature. The suspension was
transferred to a 2-mL Select-D column (Eppendorf 5 Prime,
Boulder, CO) and washed four times with 2 mL of
phosphate-buffered saline containing 0.2% (v/v) Nonidet
P-40 (Sigma). We determined by ELISA that the immobilized anti-CAT antibody removed more than 99.9% of the
Fed-1 iLRE::CAT fusion protein from extracts. The sepharose bead suspension was transferred to a 1.5-mL Eppendorf tube with 1.2 mL of wash solution and spun for 2 min
at 700g. The supernatant was removed and mixed with 60
␮L of 5⫻ SDS sample loading buffer (Ausubel et al., 1998).
The samples were incubated at 50°C for 30 min and 100°C
for an additional 30 min to release the CAT fusion proteins
from the antibodies (Ausubel et al., 1998), and centrifuged
for 20 s at 13,100g. Aliquots of the resulting supernatant
were loaded onto a 14 ⫻ 14 cm 16% (w/v) SDSpolyacrylamide gel with a 19:1 acrylamide:bisacrylamide
ratio (Amresco, Dallas). Aliquots (60 ␮L) were loaded from
dark-treated samples, and the volume of light-treated samples loaded was adjusted using the calculations of total
uptake of labeled amino acid.
The gel was run overnight at a constant 60 V (5 V/cm),
then electroblotted to Immobilon membrane (Millipore,
Bedford, MA) using a NovaBlot semi-dry blotter (LKB,
Bromma, Sweden). To prevent excessive heating, the blotter was run at 0.8 milliamps cm⫺2 constant current, until
the voltage increased from 8 to 30 V, and then at constant
voltage for 2 h. Autoradiographs were obtained directly
from the blots, and the amount of radioactively labeled
CAT protein in each sample was determined by Phosphorimager analysis of the blots (Molecular Dynamics).
Background on the blots was estimated by measuring the
radioactivity in each lane immediately above the CAT fusion-protein bands.
Total protein in extracts was determined by Bradford
Analysis using a reagent supplied by Bio-Rad (Hercules,
CA). ELISA assays were performed with a CAT ELISA kit
777
Hansen et al.
from Eppendorf 5 Prime, using the protocol supplied by
the manufacturer.
ACKNOWLEDGMENTS
We are grateful to Tim Caspar for providing the TC2
(FedA) plasmid, Cris Kuhlemeier for the eIF-4A10 plasmid,
and John Gray for providing both 35S::PetE transgenic
tobacco as well as the PetE plasmid. We thank the Southeastern Plant Environment Laboratory (Raleigh, NC) for
providing controlled-environment plant growth space.
This study was approved for publication by the Director,
Oklahoma Agricultural Experiment Station.
Received May 16, 2000; returned for revision July 12, 2000;
accepted October 2, 2000.
LITERATURE CITED
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman
JG, Smith JA, Struhl K (1998) Current protocols in molecular biology. Curr Protocols Mol Biol 2: 10.16.11–
10.16.13
Becker D, Kemper E, Schell J, Masterson R (1992) New
plant binary vectors with selectable markers located
proximal to the left T-DNA border. Plant Mol Biol 20:
1195–1197
Berry JO, Carr JP, Klessig DF (1988) mRNAs encoding
ribulose-1,5-bisphosphate carboxylase remain bound to
polysomes but are not translated in amaranth seedlings
transferred to darkness. Proc Natl Acad Sci USA 85:
4190–4194
Bovy A, Van den Berg C, De Vrieze G, Thompson WF,
Weisbeek P, Smeekens S (1995) Light-regulated expression of the Arabidopsis thaliana ferredoxin gene requires
sequences upstream and downstream of the transcription initiation site. Plant Mol Biol 27: 27–39
Caspar T, Quail PH (1993) Promoter and leader regions
involved in the expression of the Arabidopsis ferredoxin
A gene. Plant J 3: 161–174
Davies E, Abe S (1995) Methods for isolation and analysis
of polyribosomes. Methods Cell Biol 50: 209–222
Dickey LF, Gallo-Meagher M, Thompson WF (1992) Light
regulatory sequences are located within the 5⬘ portion of
the Fed-1 message sequence. EMBO J 11: 2311–2317
Dickey LF, Nguyen T-T, Allen GC, Thompson WF (1994)
Light modulation of ferredoxin mRNA abundance requires an open reading frame. Plant Cell 6: 1171–1176
Dickey LF, Petracek ME, Nguyen T, Hansen ER, Thompson WF (1998) Light regulation of Fed-1 mRNA requires
an element in the 5⬘-untranslated region and correlates
with differential polyribosome association. Plant Cell 10:
475–484
Elliot RC, Dickey LF, White MJ, Thompson WF (1989)
cis-acting elements for light regulation of Pea Ferredoxin
778
I gene expression are located within transcribed sequences. Plant Cell 1: 691–698
Gallo-Meagher M, Sowinski DA, Elliot RC, Thompson
WF (1992) Both internal and external regulatory elements
control expression of the pea Fed-1 gene in transgenic
tobacco seedlings. Plant Cell 4: 389–395
Gatz C (1995) Novel inducible/repressible gene expression. Methods Cell Biol 50: 411–424
Harter K, Kircher S, Frohnmeyer H, Krenz M, Nagy F,
Schafer E (1994) Light-regulated modification and nuclear translocation of cytosolic G-Box binding factors in
parsley. Plant Cell 6: 545–559
Helliwell CA, Webster CI, Gray JC (1997) Light-regulated
expression of the pea plastocyanin gene is mediated by
elements within the transcribed region of the gene. Plant
J 12: 499–506
Horsch RB, Fry FE, Hoffman NL, Eicholtz D, Rogers SG,
Fraley RT (1985) A simple and general method for transferring genes into plants. Science 227: 1229–1231
Iost I, Dreyfus M (1995) The stability of Escherichia coli lacZ
mRNA depends upon simultaneity of its synthesis and
translation. EMBO J 14: 3252–3261
Jefferson RA (1987) Assaying chimeric genes in plants: the
GUS gene fusion system. Plant Mol Biol Rep 5: 387–405
Mayfield SP, Cohen A (1998) Translational regulation in
the chloroplast. In J Bailey-Serres, DR Gallie, eds, A Look
beyond Transcription: Mechanisms Determining mRNA
Stability and Translation in Plants. American Society of
Plant Physiologists, Rockville, MD, pp 174–179
Petracek ME, Dickey LF, Hansen ER, Sowinski DA,
Nguyen T-T, Allen GC, Thompson WF (1998a) Dependence of Fed-1 light regulation on translation. In J BaileySerres, DR Gallie, eds, A Look beyond Transcription:
Mechanisms Determining mRNA Stability and Translation in Plants. American Society of Plant Physiologists,
Rockville, MD, pp 96–101
Petracek ME, Dickey LF, Huber S, Thompson WF (1997)
Light-regulated changes in abundance and polyribosome
association of ferredoxin mRNA are dependent on photosynthesis. Plant Cell 9: 2291–2300
Petracek ME, Dickey LF, Nguyen TT, Gatz C, Sowinski
DA, Allen GC, Thompson WF (1998b) Ferredoxin-1
mRNA is destabilized by changes in photosynthetic electron transport. Proc Natl Acad Sci USA 95: 9009–9013
Somers DE, Caspar T, Quail PH (1990) Isolation and characterization of a ferredoxin gene from Arabidopsis thaliana. Plant Physiol 93: 572–577
Thompson WF, White MJ (1991) Physiological and molecular studies of light-regulated nuclear genes in higher
plants. Annu Rev Plant Physiol Plant Mol Biol 42:
423–466
Vorst O, van Dam F, Renske O-T, Smeekens S, Weisbeek
P (1990) Tissue-specific expression directed by an Arabidopsis thaliana pre-ferredoxin promoter in transgenic tobacco plants. Plant Mol Biol 14: 491–499
Plant Physiol. Vol. 125, 2001