ABSTRACT
RED-LIGHT EFFECTS ON BLUE-LIGHT BASED PHOTOTROPISM IN ROOTS AND
HYPOCOTYLS
by Timothy Sindelar
The aim of this research was to clarify the involvement of red-light effects of blue-light
phototropism in roots and hypocotyls of Arabidopsis seedlings. In contrast to the effects in
shoots, we found that red light inhibits blue-light-based phototropism in seedling roots in the
Landsberg ecotype. Our studies show that PHYA and PHYB play a role in inhibition of bluelight phototropism in roots of Landsberg seedlings. However, attenuation of blue-light
phototropism was not seen in roots of Columbia ecotype seedlings. Roots of the Columbia
seedlings displayed a significant enhancement of blue-light phototropism by red light
pretreatment. Inhibition of blue-light phototropism also was observed in roots of C24 ecotype
seedlings, and this inhibition was not seen in a transgenic strain deficient in all phytochromes in
the root only. These data suggest a difference exists in tropism dependent on ecotype, and that
phytochromes are involved in blue-light root phototropism attenuation for applicable ecotypes.
Red-Light Effects on Blue-Light Based Phototropism in Roots and Hypocotyls
A Thesis
Submitted to the
Faculty of Miami University
in partial fulfillment of
the requirements for the degree of
Master of Science
Department of Botany
by
Timothy Sindelar
Miami University
Oxford, Ohio
2013
Advisor________________________
(John Z. Kiss)
Reader_________________________
(Richard E. Edelmann)
Reader_________________________
(Daniel K. Gladish)
Table of Contents
Introduction ..................................................................................................................................... 1
Materials and Methods .................................................................................................................. 14
Results ........................................................................................................................................... 18
Discussion ..................................................................................................................................... 21
Figures........................................................................................................................................... 29
Literature Cited ............................................................................................................................. 39
Appendix ....................................................................................................................................... 46
ii
List of Tables
Table 1: Growth rates for all genotypes and their respective organs examined in either blue or
red-blue-light.
iii
List of Figures
Figure 1: Experimental timeline used for the phototropism studies.
Figure 2: Arabidopsis ecotype Landsberg seedlings during the beginning (0 h) and 24 hr in the
time course experiment of the (A, B) blue-light and (C, D) red-light treatments.
Figure 3: Time course of curvature analysis of Arabidopsis shoots in Landsberg WT, phyA,
phyB, and phyAB. Blue lines represent blue-light treatments, and red lines represent red-bluelight treatment.
Figure 4: Time course of curvature analysis of Arabidopsis roots in Landsberg WT, phyA,
phyB, and phyAB. Blue lines represent blue-light treatments, and red lines represent red-bluelight treatment.
Figure 5: Arabidopsis ecotype Columbia seedlings during the beginning (0 h) and 24 h in the
time course experiment illustrating different intensities of curvature angle in roots and shoots in
(A,B) blue-light and (C,D) red-blue treatments.
Figure 6: Time course of curvature analysis of Arabidopsis seedlings in Columbia WT (A)
shoots and (B) roots.
Figure 7: Time course of curvature analysis of Arabidopsis seedlings in C24 WT and BVR2
transgenic line deficient of all phytochromes in the root.
iv
Acknowledgements and Support
This entire journey would not have been possible without the support of Dr. John Z. Kiss.
Thank you John for constantly making time for me during incredibly busy times in your life; I
never felt like my advisor had left. Your guidance and advice helped me grow as a professional
in this field, and I am proud to say I learned from one of the best. Thank you for inspiring me
and providing for me a role model of an academic scientist.
I would also like to thank Dr. Richard Edelmann for taking on the role of co-advisor after
John left for Ole Miss. Acting as both friend and mentor, you made the transition relatively
painless. While I wasn’t always able to attend, I always looked forward to lunches at the CAMI,
and your classes were always my favorite. Thank you for your friendship and for providing for
me a role model of what an experimental scientist should be.
Thank you to my other two committee members Dr. Nancy Smith-Huerta and Dr. Daniel
Gladish. Your suggestions for the betterment of not only my thesis, but my development as a
scientist were always helpful and very much appreciated.
I also want to thank my fellow “Kissians”, Christina Johnson and Dr. Kathy Millar. Both
of you are brilliant minds and beautiful people. Thank you Christina for introducing me in my
starting days at Miami, and for always having a smile on – it’s infectious. Thank you Kathy for
teaching me the ropes, for taking time out of your own working day to work with me and help
me, and for always pushing me to work harder than the day before.
Most of all, I thank my friends at home and family. To my friends, you all were a
constant source of encouragement, laughter, and helped keep me sane through the many
high-pressure situations I found myself in. You gave me something to work for – coming back
home again. You have no idea what an idea like that can drive a person to accomplish.
To my family, I would have never gotten here without you. I love you all more than
words could ever say; this triumph is as much a result of you as it is of me. Thank you so much
for everything you have done for me. For believing in me, for supporting me, and for teaching
me how to be a good and humble person, I have achieved more than I ever believed myself
capable. You are the most important thing I have, and I hope I have made you proud.
v
Dedication
To John O’ Keefe
My grandfather, my hero
vi
1. Introduction
1.1 General Introduction
Plants are sessile organisms and have adapted mechanisms to deal with environmental
inputs. One such mechanism is a tropism, or a directional response to a stimulus vector (Kiss,
2000). Tropisms cover a wide range of movements, such as phototropism, gravitropism, and
hydrotropism, with light, gravity, and water acting as directional vectors, respectively. Our
laboratory seeks to elucidate facets of tropisms through the model organism Arabidopsis
thaliana, wherein roots exhibit positive gravitropism, growing towards the gravity vector, and
shoots exhibit negative gravitropism, growing away from the gravity vector. Additionally,
positive phototropism is seen in shoots as they grow towards blue light, and roots display
negative phototropism as they grow away from blue light. The pathways of both these
phenomenon are not yet fully understood. It is known, however, that there is cross-talk between
these two pathways and major factors involved in one tropism may be involved in the other. Pure
studies of gravitropism, experiments examining gravity’s influence without light, have been
performed for years (Darwin and Darwin, 1880; Larsen, 1953). Examining pure phototropism,
however, provided a challenge not attemptable until the advent of spaceflight, as gravity is a
ubiquitous force here on Earth. Microgravity provides a novel theatre to conduct phototropic
experiments with very little gravitational interference (Millar et al., 2010).
While the blue wavelength range has been the primary wavelength range of study in
phototropism experiments, it is not the only wavelength that elicits a response from plant organs.
Generally, shoots grow towards blue light, exhibiting positive phototropism, and roots grow
away from blue light, exhibiting negative phototropism (Hubert and Funke, 1937; Kiss 2003).
Red light, however, promotes a positive phototropic response in flowering plants, as assayed by
mutants impaired in gravitropism (Ruppel, 2001). Phytochromes, 120kDa photoreceptor protein
complexes, have been found to be a major player involved in promotion of both blue- and red1
light phototropism in roots (Kiss et al., 2003) and gravitropic responses (Kumar and Kiss, 2006;
Kumar et al., 2008).
Tropisms are traditionally divided into three phases: perception, signal transduction and
response (Kiss, 2000). Major factors involved in phototropism include the phototropins, plant
photoreceptors which respond primarily to UV/blue light, and phytochromes, photoreversible
pigments involved in primary red-light perception (Takemiya et al., 2005; Smith, 2000). As
stated above, Arabidopsis seedlings, along with most flowering plants, have long been
hypothesized to exhibit a phototropic response specifically to blue light (Kimura and Kagawa,
2006). Until recently, red light has not been observed to play a role in directional response in
higher plants, however, it has been observed in the lower plants, such as mosses and ferns. A
study on protonemata of the moss Ceratodon purpureus found that red light induced a positive
phototropic response (Hartmann et al., 1983). Positive growth towards red light has also been
documented in the fern Adiantum capillus-veneris protonema in several studies, revealing an
ancient red-light-sensing photosensory pathway that has been retained in lower plants (Kawai et
al., 2003; Kadota et al., 1982).
However, our lab discovered novel responses to red light in flowering plants during a
recent spaceflight experiment (Millar et al., 2010). We also observed the well-documented redlight-enhanced seedlings to blue light phototropism in the spaceflight experiments. Two
hypotheses surrounded the nature of this enhancement: that red light directly affects blue-light
phototropism through a phytochrome-mediated pathway; or indirectly via an attenuation of
gravitropism. This research is centered on providing a ground study for our previous spaceflight
experiment, and determining the role red light plays in blue-light phototropism in Arabidopsis
plants (i.e., direct or indirect effect).
The five phytochrome protein family members (PHYA-E) in Arabidopsis have been
shown to display both unique and redundant functions during the life of the plant (Quail, 1998;
Franklin and Quail, 2010). The studies in this thesis, as well as the spaceflight experiments,
utilized phytochrome mutants that lack all or nearly all of either phytochrome A, B, or both A
and B. Phytochromes A and B have been shown to be the primary family members involved in
2
red and far red irradiance responses (Kiss et al., 2003; Shen et al., 2009). By eliminating
members of the family and observing the seedling response compared to the wild-type (WT), we
can develop a further understanding of phytochrome involvement of red-light enhancement of
blue-light-based phototropism (Millar et al., 2010). Use of transgenic lines devoid of all
phytochromes (PHYA-PHYE) in either the root or shoot also presented the opportunity to study
spatial-specific roles of phytochromes play in red-light enhancement of blue-light-based
phototropism (Warnasooriya and Montgomery, 2009).
3
1.2 Tropisms
The acquisition of needed light and nutrients is vital for a plant’s survival, prompting
plants to devise mechanisms to orient their organs towards or away from particular stimuli, as
plants cannot move to a new environment when the current one becomes unfavorable. Two of
the most influential and fundamental stimuli during plant development are light and gravity
(Franklin and Quail, 2010; Fukaki et al., 1998). Light, while most notably used for
photosynthesis, is also vital for other growth and developmental processes such as seed
germination, senescence, and seedling growth (Cristie, 2007). As discussed earlier, phototropism
is the directional growth in response to light, and can be separated into the perception,
transduction, and response phase (Kiss, 2000). In flowering plants, the perception of light during
phototropism is mediated primarily by blue light photoreceptors in the phototropin family, nph1
(non-phototropic hypocotyl), also termed PHOT1, NPH3, and NPL1 (non-phototropic
hypocotyls like), also termed PHOT2 (Christie et al., 2001). PHOT1 is responsible for responses
guided by low fluence rates of light and also brief pulses of light, while PHOT2 seems to
function in phototropic responses in high fluence rate conditions (Sakai et al, 2001; Harada et al.,
2003; Oghishi et al., 2004).
In addition, NPH3 has been suggested to bind to NPH1 through a coiled-coil region of its
chromophore binding portion, and is necessary for normal phototropic activity (Motchoulski and
Liscum, 1999). Also necessary for full phototropic response is RPT2 (root phototropism), a
protein included in the NPH3 family that has been suggested to be activated in second-positive
phototropism (Sakai, 2001). Cryptochromes are additional blue-light receptors, and have been
suggested to participate in phototropic modulation; however the degree to which this
participation exists is uncertain (Briggs and Christie, 2002).
Also involved in the blue-light perception of light are the phytochromes, the red/far-red
photoreceptors, and like the phototropins, these protein receptor complexes exhibit a light
intensity dependent response. Phytochrome A and phytochrome B have been found to regulate
4
phototropic responses under low fluences, whereas another photoreceptor is responsible for high
fluency rate light phototropic response (Liscum and Stowe-Evans, 2000). Fluency is not the only
factor that can affect the eventual differential response initiated by photoreceptors - wavelength,
frequency of exposure, and time of exposure are also known to influence facets of plant
development (Quail, 2002).
There is a conformational change of the apoproteins of the photoreceptors upon
perception of light. This change in configuration promotes the activation of the kinase domain,
thereby stimulating phototropic signal transduction. This signal transduction has long been
associated with Ca2+ playing the role of regulator (Gehring et al., 1990). Recent studies have
suggested that phototropins, specifically phot2, play a role in high-fluence rate blue-light
phototropism by altering cytosolic Ca2+ concentration, and that this increase in Ca2+ does not
involve plasma membrane Ca2+ channels (Zhao et al., In press). The origin of calcium release is
not the only disputed facet of the signal transduction phase of phototropism; much of the exact
mechanism is yet to be elucidated.
This signal transduction cascade results in auxin redistribution, which lends to differential
growth of plant organs. Auxin modulates phototropic response via a forked pathway – one
involving the NPH4/MSG1(massugu 1)/TIR5 (transport inhibitor response 5) loci (hereafter
referred to as NPH4), and one paired with AXR1 (AUXIN RESISTANCE) (Correll and Kiss,
2002). The NPH4 locus encodes ARF7 (auxin response factor), which has been shown to be
involved in lateral root production and leaf expansion (Okushima et al., 2007; Wilmoth et al.,
2005). NPH4/ARF7 has been suggested to be a regulator of differential growth responses in
hypocotyls and the formation of lateral roots via a negative feedback loop with MSG2/IAA19
(Tatematsu et al., 2004), an auxin regulated protein often functioning cooperatively with
NPH4/ARF7. NPH4/ARF7 is also involved in the later stages of phototropic signal response and
is thought of as the vertex of gravitropism and phototropism (Haper et al., 2000; Correll and Kiss
2002; Liscum and Stowe-Evans, 2007). ARX1 functions primarily as a “protective enzyme”,
dissembling molecules that would otherwise repress auxin influenced players in phototropism
(Harper et al., 2000; Lincoln et al., 1990).
5
While blue light tends to stimulate the most robust phototropic response, red light has
also been shown to elicit phototropic responses in flowering plants (Chon and Briggs, 1966;
Ruppel et al, 2001; Kumar et al., 2008). Although red-light-induced phototropism is a somewhat
new discovery for flowering plants, red-light-induced phototropism has been long documented in
lower plants, such as ferns (Kadota et al., 1982; Hartmann et al, 1983). Phototropic responses are
generally weaker than gravitropic responses for both blue and red-light dependent phototropism,
however, gravitropism-deficient or weakened mutants made the discovery of red-light-induced
phototropism possible (Ruppel, 2001). The red-light-based response was first discovered in the
roots of Arabidopsis (Ruppel, 2001), but seedlings grown in microgravity conditions have
exhibited a red-light-induced response in the hypocotyls, suggesting that plants have retained a
red-light photosensory system (Millar et al, 2010). Typically, roots responding to red light grow
towards the light vector as do hypocotyls under microgravity conditions, while hypocotyls under
1-g conditions show no phototropic response to red light (Ruppel et al, 2001; Millar et al, 2010).
Investigating red-light phototropism is difficult as the response is weak and masked by 1-g
conditions. For this reason, mutants impaired in gravitropism, such as sgr (shoot gravitropism)
and starch deficient pgm (plastidial phosphoglucomutase) have been proposed as a means to
investigate red-light-induced phototropism on Earth (Vitha et al., 2000).
Red light has also been shown to induce an enhancement of blue-light-induced
phototropism (Liu and Iino, 1996; Janoudi et al., 1997; Lariguet and Fankhauser, 2004).That is
to say, seedlings grown under blue light treated with red light preirradiation display a greater
magnitude of phototropic curvature than those illuminated with blue light alone. In shoots,
PHYA has been shown to be the primary photoreceptor involved with red-light enhancement of
blue-light-induced phototropism (Parks et al., 1996). A remaining question regarding red-lightinduced phototropism is whether red light influences blue-light phototropism by attenuating
gravitropism, or through a direct, phytochrome-related pathway.
As mentioned above, gravity is also a major influence in the growth and development of
plants. The perception of gravity has been explained by multiple models, two of which have
gained considerable support. The first model, the starch-statolith hypothesis, explains gravity
perception via the sedimentation of amyloplasts, a non-pigmented starch producing plastid,
6
which act as statocytes within the root columella cells of the root cap (Iversen and Larsen, 1971).
The second model, the protoplast-pressure hypothesis, places less importance on the amyloplasts
and suggests the entire weight of the cytoplasmic mass acts as an indicator of gravity (Correll
and Kiss, 2002). The starch-statolith hypothesis is the more strongly supported of the two, as
studies have shown that amyloplasts are abundantly found in tissues responding to gravity and
pgm mutants, starchless mutants, have weakened gravity response (Kiss et al., 1989). However,
it has been shown the starch, while important, is not necessary for a gravitropic response (Caspar
and Pickard 1987; Kiss et al., 1997). While these two hypotheses provide two separate
explanations of gravity perception in the plant cell, it may not be one or the other; that perhaps
there may be an amalgamation of the two mechanisms, yielding a “statolith-pressure hypothesis”
(Kiss, 2000).
Another facet of gravity-sensing in gravitropism is hypothesized to incorporate
amyloplasts contact with the endoplasmic reticulum (ER). The ER can be found along the
periphery of the plants cell, where the amyloplasts will eventually sediment in response to
reorientation of the cell. The ER is a known intracellular Ca2+ reservoir, and Ca2+ is a common
signal transduction agent, thus it has been suggested that as amyloplasts sediment to the cell
bottom, they make contact with the ER, triggering Ca2+ release (Perbel and Driss-Ecole, 2003).
There have been several studies that have ultrastructural support for this hypothesis. Highpressure freezing and substitute-freezing methods in electron microscopy have revealed close
contact between amyloplasts and cortical ER (Kiss et al., 1990; Leitz et al., 2009). In tobacco
columella cells, specialized ER termed nodal ER, which is only found at the cell periphery, has
been found (Zheng and Staehelin, 2001).
The cytoskeleton has also been presumed to play a role in gravity-sensing. F-actin, the
filamentous structure of actin, forms a network within plant cells, and disruption or tension
placed on this F-actin mesh could trigger mechanosensitive channels located on a membrane
(Perbel and Driss-Ecole, 2003; Sievers et al., 1991). This hypothesis has been supported by the
discovery of a fine mesh of F-actin fibers surrounding amyloplasts in columella cells (Collings et
al., 2001). These findings are disputed, however, by studies using of Latrunculin B (Lat-B), an Factin disrupting drug, where treatment with Lat-B enhanced amyloplasts sedimentation rather
7
than inhibited it (Hou et al., 2003, 2004). However, Lat-B affects the entire plant, and a more
statocytes specific drug is required for further elucidation of F-actin’s role in gravity sensing
(Morita, 2010).
Signal transduction leads to the response phase, which is hypothesized to occur in the
elongation zone of the root, directly behind the root cap where gravity perception occurs (Kiss,
2000). This suggests that some means of signal transfer is necessary to proceed from the
perception phase to the transduction phase. As stated earlier, Ca2+ has been suggested to be a
signal transduction agent via release from cortical ER after contact with amyloplasts (Perbel and
Driss-Ecole, 2003). This interaction is hypothesized to lead to the response phase of
gravitropism, where auxin, a class of plant hormones, gradients are formed and the auxindependent transduction pathway is engaged (Firn et al., 2000). Following the gravity-induced
signal cascade, both auxin movement and pH change occur after transduction phase, and pH
change regulates auxin efflux via auxin transporter proteins (Correl and Kiss, 2002; Fasano et al.,
2001). Asymmetric auxin distribution then induces differential growth, orienting the root at the
proper angle.
While the two tropisms, phototropism and gravitropism, seem to be exclusive in respect
to each other, it has been shown that there is cross-talk and influence amongst them (Feldman
and Briggs 1987; Hangarter 1997). Our recent spaceflight experiments show quite clearly the
effects gravity has on phototropism, as seedlings exhibited more robust phototropic curvature in
microgravity. Also found was a previously masked red-light-based phototropic response in
Arabidopsis hypocotyls in microgravity (Millar et al., 2010). These phototropic enhancements in
weakened gravity environments demonstrate that the 1 g conditions on Earth influence lightbased responses, as an inverse relationship occurs between gravity intensity and phototropic
curvature. Use of the gravitropism-impaired pgm mutant revealed a red-light-induced positive
phototropic curvature barely detectable in the WT roots (Ruppel et al., 2001). Moss protonemata
grown in microgravity display a fluency-dependent red light response not found on Earth. In
microgravity, high-fluence light produces no response, but low fluency elicits an increased
phototropic curvature (Kern and Sack, 1999).
8
Light is also known to enhance and in some cases, attenuate gravitropism in plants. For
example, in the Merit cultivar of maize, roots grown in the dark grow at a 90⁰ angle relative to
the gravity vector; however, irradiated seedlings display normal gravitropic growth (Feldman
and Briggs, 1987). Red light seems to be the most effective inducer of gravitropic response, and
studies have indicated that phytochromes are responsible for the response. Seedlings of
Arabidopsis grown in the dark normally display orthogravitropic response (roots display positive
gravitropism, hypocotyls display negative). Red light has been shown to disrupt this response,
with seedlings instead growing in arbitrary fashion (Fairchild et al., 2000).
As gravitropism and phototropism have overlapping pathways, so too do photoreceptors
(Quail, 2002; Reed et al., 1994). In addition to regulating red-light perception, PHYA has been
shown to inhibit gravitropic response in both roots and hypocotyls (Correll et al., 2003, Lariguet
and Fankhauser, 2004). Since red-light has been shown to attenuate gravitropism, several studies
have proposed that this could be a mechanism explaining red-light-induced phototropism in
Arabidopsis roots.
9
1.3 Photoreceptors
As discussed above, light perception is achieved via three principal photoreceptors:
cryptochromes, phytochromes, and phototropins. The three are normally separated into “bluelight” (320-500nm) and “red-light” (600-800nm) groups, with cryptochromes and phototropins
comprising the former and phytochromes the latter. Arabidopsis thaliana has at least 10
photoreceptors have been identified, including five phytochrome family members (PHYA-E),
three cryptochromes (CRY1-3), and two phototropins (PHOT1- 2; Takemiya et al., 2005).
Phototropin was first known for its involvement as a blue light receptor in
phototropic bending (Huala et al., 1997), inducing the typical growth pattern of Arabidopsis in
blue light where shoots grow towards the light and roots grow away. While PHOT1 and PHOT2
often function in concert, they do operate in two separate pathways as well. PHOT1 is known to
function in phototropic curvature of organs at lower fluency rates (1-100 μmol m-2 s-1) whereas
PHOT2 is sensitive to the higher fluency rates ( > 10 μmol m-2 s-1; Galen et al., 2004).
As described above, there are three family members of cryptochromes in
Arabidopsis: CRY1-3 (Takemiya, 2005). In phototropism, the primary function of these
photoreceptors is the inhibition of seedling hypocotyl growth in response to blue light (Devlin
and Kay, 2001). It is also known that cryptochromes (CRY1 and CRY2) are necessary for
phytochrome A signaling to the circadian clock via supplying blue-light input to the clock
(Devlin and Kay, 2001). It has also been suggested that both CRY1 and CRY2 work redundantly
to promote floral induction in a phytochrome B (PHYB)-dependent manner (Mockler et al.,
1999).
Phytochrome family members are photoreversible biliproteins that exist as
homodimers with 120 kDa subunits. Each monomer of this dimer is attached to an apoprotein
attached to phtyochromobilin, a linear, light-absorbing tetrapyrrole chromophore (Franklin and
Quail, 2010). Within each subunit exists three domains, the PAS, GAF, and PHY domains. The
PAS domain, a stimulus sensing input module found within all three kingdoms of life, is
10
generally found within proteins function in signal transduction, and has also been found to play
an especially large role in circadian clock proteins. Specificity of sensing has been shown to arise
from cofactor interactions with the PAS fold (Taylor and Zhulin, 1999). The GAF domain is a
cyclic GMP receptor, and similar to the PAS domain, functions in signal transduction and is
found in all three kingdoms of life. The similarities found between the PAS and GAF domains
have been attributed to their evolutionary relationship. Photons are absorbed by phytochrome
chromophores covalently linked to a cysteine residue in the GAF domain of the phytochrome
(Yew-Seng et al., 2000). The PHY domain has been shown to be necessary for structural
integrity of phyotochrome and for the fine tuning of phytochrome activity (Bae and Choi, 2008;
Wagner et al., 2005). Interactions and functions between these three domains are still uncertain
(Rockwell and Lagairas, 2006).
The photoreversibility of phytochromes lends itself to active and inactive forms of the
holoprotein: the Pr form which absorbs red light and the Pfr form which absorbs far-red-light
(Hennig and Schäfer, 2001). When phytochrome is synthesized, it is created in the Pf form, the
inactive form. Conformational change to the active Pfr form occurs upon the absorption of light.
As quality of light changes, so too does the conformation of the phytochrome, between
biologically inactive Pr and active Pfr forms. It is important to note that this is not a “black-andwhite” situation; phytochromes are not all active or all inactive. The absorption specta of the two
conformations is overlapping, and a gradient of Pr and Pfr exists within the plant depending on
light quality (Hennig and Schäfer, 2001).
Phytochromes have long been held responsible for red light absorption and those
processes that respond to red light, such as photoperiodism, circadian rhythm, and shade
avoidance (Devlin et al., 1999). In Arabidopsis, roots do not grow away from red light as they do
in blue light; they exhibit positive phototropism and grow towards the red light (Ruppel et al.,
2001). As stated earlier, red-light responses are much weaker than blue-light responses, and are
often only noticeable in mutants impaired in gravitropism or using highly sensitive
instrumentation (Kiss et al., 2003).
11
Phytochrome has five gene family members in Arabidopsis (PHYA, PHYB,
PHYC, PHYD, and PHYE), and these genes encode the phytochrome proteins PHYA-PHYE.
These proteins are often divided into two groups: the light-labile phytochromes and the lightstabile phytochromes (Reed et al., 1994; Montgomery, 2008). PHYA is the only phytochrome in
the light-labile group, and is the primary phytochrome involved in sensing of far-red light.
PHYB-PHYE comprise the second group, the light-stable phytochromes (Montgomery, 2008).
These phytochromes are notorious for having redundant functions, however, usage of mutant
strains have helped elucidate the function of many of these photoreceptors.
PHYA and PHYB are often reported together, and seem to work in tandem during plant
development in responding to many different environmental stimuli. PHYA is found in high
abundance in etiolated seeds, while PHYB predominates in light-grown seeds (Devlin et al.,
1999). PHYA and PHYB are known to promote cotyledon development in red light and initiate
the synthesis of light-regulated genes when irradiated briefly with red light (Reed et al., 1994).
In addition, PHYA and PHYB are also known to mediate red-light phototropism, as well as
reducing negative gravitropism in roots (Kiss et al., 2003). While not alone sufficient, PHYA and
PHYB are both required for the normal expression of phototropism in Arabidopsis (Janoudi et
al., 1997). Along with PHYE, PHYA and PHYB are necessary for promotion of seed
germination and suppression the elongation of the internode (Heschel et al., 2007; Devlin et al,
1999). PHYC has been shown to work with PHYA in photoperiodic perception, de-etiolation of
leaves and hypocotyls after exposure to darkness, and to function alongside the four other
phytochrome family members in regulation of the leaf architecture (Reed et al., 1994; Franklin et
al., 2003). Usage of phyA, phyB, and phyD mutants has found that PHYB, PHYD, and PHYE
function in shade avoidance syndrome (Devlin et al., 1999).
12
1.4 Research Questions Posed in this Thesis
This study is aimed at elucidating the nature of phytochromes in red-light phototropism
and red-light enhancement of blue-light-induced phototropism, as previous studies have
proposed phytochrome involvement in this enhancement. This research also serves as a followup ground-study for our recent spaceflight experiment aboard the International Space Station
(ISS; Millar et al., 2010). Thus, these studies consider the the following questions: Does
phototropism in response to unidirectional red light occur in flowering plants? Is the
enhancement of blue-light phototropism by red light a direct effect (phototropic pathway), or an
indirect effect (attenuation of gravitropism)? If the promotion of blue-light-induced phototropism
by red light is due to a direct effect, I would expect to see reduction in phototropic sensitivity by
using phytochrome mutants. Furthermore, use of transgenic lines that completely lack all
phytochromes will elucidate whether there is any crosstalk between the roots and shoots during
red-light enhancement of blue-light-induced phototropism. If the promotion is due to an indirect
effect, I would expect to see little to no effect on the phototropic response in the mutants. This
research will help elucidate the pathway by which red-light enhancement of blue-light
phototropism occurs and will also answer questions on the relationship between gravitropism and
phototropism.
13
2. Materials and Methods
2.1. Plant Materials
Wild-type (WT) seeds of ecotype Landsberg erecta (Ler) were used, along with
phytochrome-deficient mutants phyA, phyB, and double mutant phyAphyB. Two transgenic lines
were also used to observe organ-specific activity of phytochromes, and these include
M0062/UASBVR, which lacks all five members of the phytochrome family (PHYA-PHYE) in
the roots (Costigan et al., 2011), and CAB3::pBVR which lacks all phytochromes in the
cotyledons (Warnasooriya and Montgomery, 2009). These transgenic lines are derived from the
C24 and Nossen (No-0) wild-type strains, respectively. Seeds of A. thaliana, ecotype Columbia
(Col), were also used to compare results across ecotypes.
phya-201 mutants stem from hy3 alleles, seedlings characterized by long hypocotyls, of the Ler
ecotype that have undergone ethylmethane sulfonate (EMS) mutagenesis in the M2 generation
(Mx generation denotes successful mutation). phyA mutants were screened initially for a 4 to 8fold increase in hypocotyl length. Seeds of the M3 were then tested for biliverdin IXα reductase
(BVR), a phytochrome chromophore precursor, rescue. Those mutants that did not respond to
BVR treatment were then submitted to immunochemical and spectral detection of PHYA in their
M4 or M5 generation (Nagatani et al., 1993). Seedlings were grown in the dark, and the etiolated
seedlings were then glass homogenized with 1mL of phytochrome extraction buffer (100mM
Tris-HC1, 28 mM 2-mercaptoethanol, 5 mM ethylenediaminetetraacetic acid, and 5mM
phenylmethanesulfonylfluoride at pH 8.3) for every gram of tissue (Nakazawa et al., 1991).
PHYA then underwent immunochemical detection as described by Natagani et al., (1991). M5
seedlings were used for in vivo spectrophotometric viewing of phytochromes. 0.5g of etiolated
leaves were packed into a stainless steel cuvette with glass windows at 4⁰C (Suzuki et al., 1980)
and analyzed using a spectrophotometer (model 3410; Hitachi, Tokyo) set with an actinic
irradiation unit (Nagatani et al., 1989).
14
phyB-8-36 mutants also originated from hy3 alleles of the Ler ecotype and were also subjected to
EMS mutagenesis. PHYB gene sequence clones were found in an A. thaliana Ler genomic
library (Voytas et al., 1990) cloned in λ Fix (Stratagene) via probe found via polymerase chain
reaction (PCR) amplification of genomic DNA (Reed et al., 1993). Amplification of this probe
was achieved using primers 5‘-GACTCATATGATGGCGGGGGAACAG-3 and 5’GCTCAAAGGATTCTTTATCACCIGACAAAT-3 using the NdeI restriction site. The 3’ end of
the PHYB clone was absent, so Ler DNA was amplified with primers complimentary to already
published Columbia cDNA sequences (Sharrock and Quail, 1989).
5’TCTGTTTCTTGCAAATCCCGAGC-3’ and 5’GCTCTAGAGCTGAACGCAAATAATCTCCC-3’ were the primers used, with the latter
containing an XbaI restriction site towards the 5’ end (Reed et al., 1993). Standard methods were
used to sequence the clones, with sections of the gene being sequenced by Lark Sequencing
Technologies, Inc. (Houston, TX). phyB mutant alleles were sequenced via PCR amplification of
portions of the gene. The segments were amplified via asymmetric PCR, and using methods
found in Beitel et al. to sequence these products (1990). Localization occurred in the 8-36 mutant
strain prior to sequencing via denaturing gradient gel electrophoresis (Myers et al., 1987; 1989).
phyAphyB double mutants were distinguished as very long seedlings when grown in white light.
The seeds were crossed between fre-1 (phy201) mutants, which acted as recipients, and phyB-836, which acted as a pollen donor. Genotypes were tested by assessing the F1 phenotype of test
crosses to the original mutants (Reed et al., 1994).
The two transgenic lines, M0062/UASBVR and CAB3::pBVR, stem from spatial-specific
expression of BVR. pUAS1380-BVR lacks all, or effectively all, phytochromes in the roots,
while CAB3::pBVR lacks all, or effectively all, phytochromes in the shoots. These transgenic
lines were created via methods described in Costigan et al. (2011) and were kindly provided by
Dr. Beronda Montgomery (Michigan University, East Lansing, MI).
15
2.2 Growth Conditions for Tropism Studies
Within a laminar flow hood, seeds were surface sterilized with a 70% (v/v) ethanol and
0.002% (v/v) Triton X-100 solution for 5 min, rinsed twice in 95% (v/v) ethanol for 1 min each,
rinsed in an H2O and 0.01% Trition X-100 solution for one min, and then rinsed four times with
sterilized H2O. Seeds were then sown onto sterile, 100 x 100 x 15 mm gridded square petri
dishes containing 1.2% (w/v) Arabidopsis growth medium bacto-agar, as per Kiss et al. (1996)
with one-half-strength Murashige and Skoog salts medium and 1% (w/v) sucrose at pH 5.5. A
layer of nitrocellulose film (Promega Corp., Cat. # V7131) was placed on top of solidified agar.
These plates were then wrapped twice with Parafilm and left for 24 h at 4⁰C (Yamamoto and
Kiss, 2002). After 24 h, 12 seeds were sown per plate, 6 in row B, and 6 in row E. The square
petri dishes were then double-wrapped in Parafilm and given a cold treatment for 1 d at 4⁰C.
Seeds were then placed perpendicular to ground surface such that the plates were upright and
were continuously irradiated with Sylvania Gro-Lux white light fluorescent tubes (70-80 μmol
m-2 s-1) inside of a growth chamber for 96 h (4 d) at 23⁰C.
Four-day-old seedlings were then submitted to one of two light treatments, as
summarized in Fig. 1. After 4 h of darkness, seedlings were either exposed to 40 h of continuous,
unilateral blue light, or one hour of continuous, unilateral red light, followed by 39 h of
continuous, unilateral blue light. Blue (60 – 75 μmol m-2 s-1) and red (20-30 μmol m-2 s-1) light
was delivered via 110V LED panels. Blue light LEDs provided 465nm wavelengths of light, red
light LEDs provided 650nm wavelengths of light.
For studies using phytochrome single mutants and the respective WT, two replicates of
four plates containing 12 seeds were used. For studies using phytochrome double mutants, one
replicate of eight plates were used, as phyAB is known to have a low germination rate in far-redrich light (Reed et al., 1994). For transgenic line CAB3::pBVR and its WT No-0 one replicate of
four plates was used. For transgenic line M0062/UASBVR and its WT C24 one replicate of four
plates and a second replicate of five were used.
16
2.3 Data Collection and Analysis
All length and curvature measurements involved with this study were done using Image
Pro Plus 7.0 (Media Cybernetics Inc., MD) – an image analysis program. In this study,
measurement of tropic curvature considered any growth towards the light stimulus a positive
angle, and any growth away from the stimulus a negative angle.. All seedlings that did not
germinate at time zero, that were 1/3 the size of normal seedlings, that were highly undulate, that
were displaced from the agar surface, or made contact with either the side of the Petri dish, or
another seedling, or the root, or if the shoot grew +/-30⁰ from the gravity vector were omitted
from further analyses (Kiss et al., 1996). Data was taken from plants at designated time points
(t=0 h, 0.5 h, 1 h, 2 h, 4 h, and then every 2 h up to 40h). Sample size ranged from 33-89 plants,
and observations ranged from 1104-2484 for an individual organ and light treatment. Growth
rates were calculated using the formula:
G=
L40 – L0
40h
In this formula, L40 represents the length measured in millimeters at t40 and L0 is the length
measured in millimeters at t=0.
Statistical analysis was performed with SAS 9.2 to examine linear trend against time to
compare mutant or transgenic regression coefficients to their respective wild-types. Linear
regression analysis was performed using the PROC REG procedure in SAS 9.2 (SAS Institute
Inc., NC) in order to establish angle curvature over time. PROC GLM was then used to find if
any difference between genotypes were statistically significant (p < 0.05).
17
3. Results
3.1 Blue Light Only vs. Blue Light with Red Pretreatment in the
Landsberg WT and Phytochrome Mutants
In order to elucidate the nature of phytochrome involvement in red-light-enhancement of
blue-light phototropism, I utilized several phytochrome-deficient mutants in a time course of
curvature analysis and compared the response of the mutants to the WT Ler. These three mutants
(phyA, phyB, and phyAB) were deficient in their respective phytochrome family member in both
roots and shoots (Sharrock and Quail, 1989; Reed et al. 1994). In phototropism studies, both root
and shoot curvatures were measured in blue-light and red-then-blue-light (i.e., blue with a 1 h
pre-treatment with red) treatments.
In the studies of the blue-light phototropic response in shoots, WT Ler seedlings pretreated with red light showed a significant increase (p < 0.05) in phototropic response when
compared with the shoots of blue-light only treated seedlings (Figs. 2, 3A). None of the
phytochrome deficient mutants observed, phyA, phyB, and phyAB, showed any significant
difference (p > 0.05) in phototropic response between blue- and red-blue light treatments (Figs.
3B, 3C, 3D).
In the analysis of the blue-light phototropic response in roots, WT Ler seedlings
pretreated with red light showed a significant increase (p < 0.05) in phototropic response when
compared with the shoots of blue-light only treated seedlings (Fig.4A). This statistically
significant decrease in phototropic root response was conserved in phyA, phyB, and phyAB
mutants and double mutants (Figs.4B, 4C, 4D). However, this decrease in response by red-light
pretreatment was by a smaller relative magnitude in the mutants when compared with the WT.
18
3.2 Blue Light Only vs. Blue Light with Red Pretreatment in the
Ecotype Columbia
In order to further compare the effects of red-light on blue-light phototropism, we
performed a time course of curvature analysis on Arabidopsis thaliana seedlings from the
Columbia ecotype. Columbia seedlings were grown under the same conditions as the
phytochrome mutant seedlings. The shoots of Columbia seedlings showed a significant increase
(p < 0.05) in phototropic curvature when exposed to red-blue light treatments when compared
with the response from blue-light stimulated seedlings (Figs. 5, 6A). In contrast to the
observation of the Ler ecotype, red light pretreated roots of the Columbia ecotype seedlings also
displayed a statistically significant (p < 0.05) increase in phototropic curvature when compared
to blue-light only treated roots (Fig. 6B).
3.3 Blue Light Only vs. Blue Light with Red Pretreatment in Transgenic
Lines Lacking All Phytochromes
Transgenic lines of Arabidopsis that lacked the phytochrome precursor molecule were
used to examine the effects phytochrome have on specific organs or tissues lacking these
phytochromes, and whether there is crosstalk between these organs or tissues (Hopkins and Kiss,
2012). In the studies of blue-light phototropic response in roots, WT seedlings of the C24
ecotype treated with red-blue light showed a significant decrease (p < 0.05) in phototropic
response when compared with the blue-light treated seedlings (Fig. 7A). The roots of transgenic
line M0062/UASBVR, which lacked all phytochromes in the roots, showed a significant increase
in the phototropic response (p < 0.05) when compared with the blue-light treated roots (Fig. 7B).
19
3.4 Growth Rates
Growth rates were measured to determine if the light treatments may have affected
growth, and, in turn, curvature. In general, there were few statistically significant differences
between seedlings subjected to blue light only compared to seedlings with a red-light
pretreatment followed by blue light (Table 1).
20
4. Discussion
4.1 How Do Phytochromes Modulate Red-Light Enhancement?
The most significant result found through this study was the discovery of attenuation of
blue-light phototropic response in the roots of wild-type A. thaliana, ecotype Ler, seedlings when
they were pretreated with red light. Compared with blue-light-only treated seedlings, plants
subjected to a red-light pretreatment (followed by blue) showed a statistically significant
reduction in phototropic response in the roots. For example, roots of seedlings pretreated with
red light had a magnitude of curvature of only -5.1⁰ while those in the blue-light control had a
greater magnitude of -39.2⁰ by the end of the time course study. Mutants deficient in all of either
phytochrome A or phytochrome B also exhibited significantly reduced phototropic curvature in
red-blue-light treatment compared to the blue-light treatment; however, the relative magnitude of
red-light-induced inhibition was less compared to the inhibition in the WT.
The double mutant (phyAB) also exhibited an inhibition of blue-light phototropism with a
red-light pretreatment although the absolute magnitude of the root phototropic curvature was less
than that of the WT. These data suggest that both phytochrome A and B (phyAB) play a role in
the attenuation of blue-light-induced phototropism when pre-treated with red light.
In the hypocotyls of wild-type Arabidopsis seedlings of the Ler ecotype, red-light
pretreatment elicited a significant enhancement of the blue-light-induced response, as has been
reported in previous studies (e.g. Hangarter, 1997; Janoudi et al., 1997; Whippo and Hangarter,
2004). However, this enhancement was attenuated in the phyA, phyB, and phyAB mutants. These
data indicate that both phytochrome A and B are involved in the enhancement of blue-light
phototropism by red light, and that their functions are not redundant.
It should be noted that seedlings used in the present experiments were light-grown
seedlings, which were then subjected to their respective light treatments. Most studies concerned
21
with shoot phototropism, have used etiolated seedlings as these seedlings have been shown to
exhibit a more robust phototropic response than light-grown seedlings (Christie et al., 1998;
Briggs and Huala, 1999; Sakai et al., 2001). There are two explanations for our choice in using
light-grown seedlings over etiolated seedlings. First, this study acts as a ground study to recent
spaceflight experiments performed on the ISS (Millar et. al, 2010; Kiss et al., 2012), and
seedlings used in those experiments were grown in the light. Second, etiolated seedlings, once
illuminated with a light source, will begin to undergo photomorphogenesis. Photomorphogenesis
is a major developmental process; therefore, plants will devote resources to this phenomenon
upon illumination, producing changes throughout the plant. Thus, in an effort to study
phototropism only, light grown seedlings were used.
One of the main goals of this study was to determine the nature of red-light enhancement
of blue-light-induced phototropism. Specifically, we wanted to know whether red-light
enhancement was due to a direct effect through a phytochrome mediated pathway, or an indirect
effect through the attenuation of gravitropism. This question has been investigated in hypocotyls
via ground studies, which report that phytochromes and cryptochromes inhibit negative
gravitropism in light-grown conditions (Lariguet and Frankhauser, 2004; Oghishi et al., 2004).
Our lab has also found that in microgravity, red-light pretreatment prior to continuous blue-light
illumination of hypocotyls does not promote an enhanced phototropic response (Kiss et al.,
2012). These studies combine to suggest an indirect involvement of red-light
Other studies have reported that upon light activation, phytochromes promote the
conversion of endodermal amyloplasts to other plastids. As endodermal amyloplasts are
hypothesized to be statoliths that operate in gravity sensing processes during gravitropic events,
this conversion would lead to an inhibition of negative gravitropism in the shoots due to a
reduction in the number of the statoliths (Kim et al., 2011).
Plant growth regulators have also been reported to be connected to the crosstalk between
phototropic and gravitropic pathways (Brock and Kaufman, 1988; Kaufman and Song, 1987;
Gallego-Bartolomé et al., 2011). For instance, gibberellic acid (GA), a hormone that promotes
cell elongation and growth, has been shown to control the expression of indole-3 acetic acid
22
(IAA) genes. IAA19 is of particular interest in tropic studies, as it interacts with ARF7/NPH3
(auxin response factor 7/non-phototropic hypocotyl 3), which as described earlier, is required for
asymmetric hypocotyl growth. Furthermore, mutants lacking MSG2/IAA9 (MASSUGU2/
Indole-3-Acetic Acid 9) show reduced sensitivity in both gravitropism and phototropism. This
regulation by GA has been suggested to promote a more robust phototropic response (Tatematsu
et al., 2004). Another study illustrated that phytochromes and cryptochromes manage GA
concentration and signaling, thereby regulating tropic growth (Tsuchida-Mayama et al., 2010).
Taken together, phytochromes have been shown to promote hypocotyl phototropism via differing
mechanisms, including attenuation of gravitropism.
4.2 Red-light Effects on Blue-light-induced Phototropism in Roots
Relative to phototropism in shoots, root phototropism, has remained relatively unstudied.
Furthermore, there is little information on red-light effects on root phototropism. However, our
lab has shown in ground and space studies that roots respond positively to red light (Kiss et al.,
2003; Kiss et al., 2012). A gene profile compiled for red-light pathways in A. thaliana roots
revealed that phytochrome kinase substrate 1 (PKS1), a negative regulator of phytochrome-based
responses, is upregulated 1h after irradiation by red light (Molas et al., 2006). Also, it has been
shown that PKS1 and PHYA interact at a subcellular level. Conversion of PHYA from the
inactive (Pr) to active (Pfr) is achieved via a conformational change in response to light, and this
conformational change is coupled with phosphorylation of several different proteins, including
PKS1 (Frankhauser, 1999). This phosphorylation is hypothesized to activate a signaling kinase
cascade that results in action within the cytoplasm and/or nucleus (Smith, 2000).
However, the data in the present study differs from that found on our most recent
spaceflight experiment, where we reported an enhancement of blue-light phototropism by redlight in both 1g and μg conditions in both the roots and shoots of A. thaliana (Kiss et al., 2012).
Seedlings in the spaceflight experiment were grown with light at an intensity of 30-40
23
μmol m-2s-1, whereas seedlings in this study were grown at an intensity of 70-80 μmol m-2 s-1.
Furthermore, 1 g conditions were simulated in spaceflight experiments via centrifugation. As
pgm did not fully encompass microgravity (the hypocotyls responded in microgravity, but not
with pgm), centrifugation may not fully encompass Earth’s gravitational force, and a more
precise gravity control may be require. Therefore, these differences may account for these
results. Additionally, phyAB displayed reduced and delayed blue-light-induced phototropism
compared to all other genotypes examined.
Other studies also suggested that PKS1 mitigates PHYA action in phototropism, and that
PKS1 is indeed necessary for hypocotyl phototropism, leading many researchers to believe that
PKS1 may be a “missing link” between red-light- and blue-light-sensitive photoreceptors
(Lariguet et al., 2006; Molas and Kiss 2008). Additionally, prior studies have shown that both
PHYA and PHYB are both needed for positive red-light phototropism, and that the dearth of
either of these photoreceptors resulted in a negative curvature (Molas and Kiss, 2008). This is
supported by phyA and phyB data in this study; however, the wild-type shows complete
attenuation of blue-light phototropism when pretreated with 1h of red light. The precise
mechanism for this response is not yet known, but may involve PKS1 or inhibition of PHY
transport into the nucleus, preventing red-light-induced gene regulation (Wang and Deng, 2003;
Lorrain et al., 2006; Kami et al., 2012).
24
4.3 Phototropism Among Ecotypes of Arabidopsis
To investigate whether this red-light-induced attenuation of blue-light phototropism
occurs in other strains of Arabidopsis thaliana, we also performed experiments with the ecotype
Columbia (Col) in the same manner as ecotype Landsberg (Ler). As expected, hypocotyls of Col
seedlings showed a significantly enhanced response to blue light after a 1 h pretreatment of red
light, as seen in the Ler ecotype (Hangarter 1997; Janoudi et al., 1997). However, in contrast to
the results with Ler, roots of Col ecotype also showed a significantly enhanced response to blue
light after a red-light pretreatment.
In an effort to reconcile these results, we incorporated another genotype into the study.
C24 is the wild-type to a transgenic line that lacks biliverdin IXα reductase (BVR), a precursor to
the phytochrome chromophore. The roots of the BVR line do not possess any phytochrome
family members (PHYA-E), while the shoots are normal in terms of phytochrome content
(Hopkins and Kiss, 2012; Montgomery, 2008). Time course of curvature analysis of roots of
seedlings of the C24 ecotype revealed attenuation of blue-light phototropism by red-light
pretreatment in the wild-type. This inhibition was removed in the transgenic strain containing no
phytochromes. Through these studies, we have observed differences in tropisms among wildtype strains of Arabiodopsis.
Previous differences in tropisms amongst ecotypes of A. thaliana have been observed in
multiple studies. For example, in regards to two ecotypes discussed above, Col and Ler have
been shown to have varying response margins in the roots when exposed to red light (Kumar et
al., 2008). Ler ecotype has been shown to fluctuate between 30⁰-35⁰, while Col ecotype roots
generally sift between 10⁰-15⁰. Another ecotype, Wassilewskija (WS), shows little to no
response to red light at all (Kumar et al., 2008). Growth rates have also been the subject of
investigation through Arabidopsis ecotypes. It has been shown that ecotypes originating from
higher latitudes have smaller relative growth rates compared to ecotypes found in lower latitudes
(Li et al., 1998). Other studies have noted that different ecotypes of A. thaliana possess different
25
flowering times, different copper tolerances, and water use efficiency (Johnson et al., 2000;
Murphy and Taiz, 1995; Nienhuis et al., 1994). In fact, ecotype dissimilarity is so common that
studies have been undertaken to investigate the proteome of Arabidopsis ecotypes to see what
proteins may take part in ecotype variation (Chavalier et al., 2004).
26
4.3 Conclusions
Plant responses to environmental cues are multifaceted and many aspects still remain to
be elucidated. These responses have been shown to share common players, and to influence each
other. The aim of this research was to clarify the involvement of red-light effects of blue-light
phototropism. Is there a direct phytochrome pathway, or an indirect effect, possibly via
attenuation of gravitropism?
In this study, we found that red light inhibits the blue-light-induced effects of
phototropism in roots of Landsberg ecotype of A. thaliana and that deficiency of PHYA and
PHYB rescued, to some extent, the blue-light response. This suggests that both PHYA and
PHYB play a role in the inhibition of blue-light phototropism in roots of the Ler ecotype by a
mechanism yet to be determined.
However, this attenuation of blue-light phototropism was not observed in roots of the
Columbia ecotype seedlings. Seedlings of the Columbia ecotype displayed a significant
enhancement of blue-light phototropism by red light pretreatment in both the roots and shoots.
Inhibition of blue-light phototropism was seen in roots of C24 wild-type seedlings, and this
inhibition was not observed in roots of the BVR2 transgenic strain, deficient of all phytochromes
in the root.
Taken together, these data suggest that there is a difference in tropisms dependent on
ecotype, and that for ecotypes that do display an attenuation of blue-light phototropism by red
light in the roots, phytochromes seem to be involved. We also observed organ-specific roles of
phytochromes, where phytochrome may attenuate red-light enhancement in the roots but not the
shoots (Ler and C24/BVR2), or may provide an enhancement of blue-light phototropism (Col).
This study is one of very few to investigate not only red-light effects on root
phototropism, but also the phenomenon of red-light enhancement of blue-light phototropism. In
addition, this study not only serves as a ground based reference for our recent spaceflight
27
experiment (Kiss et al., 2012), but also as a consideration of the effect of ecotype on tropic
responses, and provides further support for the differences between dark-grown and light-grown
seedling responses. Additional research delving into the topics of red-light enhancement of bluelight induced phototropism in roots and also on tropic responses in different ecotypes of
Arabidopsis thaliana is suggested, possibly making use of the microgravity environment present
in spacecraft in low Earth orbit.
28
Figures
Figure 1: Experimental timeline used for the phototropism studies.
29
Figure 2: Arabidopsis ecotype Landsberg seedlings during the beginning (0 h) and 24 hr in the
time course experiment of the (A, B) blue-light and (C, D) red-light treatments. Note that
seedlings subjected to red-light pre-treatment exhibit greater phototropic response in shoots and
reduced phototropic response in roots when compared to blue-light treated seedlings.
30
3A
3B
31
3C
3D
Figure 3: Time course of curvature analysis of Arabidopsis shoots in Landsberg WT, phyA,
phyB, and phyAB. Blue lines represent blue-light treatments, and red lines represent red-bluelight treatment. Treatments with the same letter (a, a) are not statistically significant while
treatments with different lettering (a, b) are significantly different (p < 0.05). Error bars represent
+ S.E. Sample size was 72; 60 to 62; 58 to 78; and 31 to 57 for LER WT, phyA, phyB, and
phyAB respectively.
32
4A
4B
33
C
4C
4D
Figure 4: Time course of curvature analysis of Arabidopsis roots in Landsberg WT, phyA, phyB,
and phyAB. Blue lines represent blue-light treatments, and red lines represent red-blue-light
treatment. Treatments with the same letter (a, a) are not statistically significant while treatments
with different lettering (a, b) are significantly different (p < 0.05). Error bars represent + S.E.
Sample size was 64 to 78; 54 to 62; 54 to 70; and 44 to 54 for LER WT, phyA, phyB, and
phyAB respectively.
34
Figure 5: Arabidopsis ecotype Columbia seedlings during the beginning (0 h) and 24 h in the
time course experiment illustrating different intensities of curvature angle in roots and shoots in
(A,B) blue-light and (C,D) red-blue treatments. Note that in red-blue treated seedlings,
phototropic response is greater in both root and shoot when compared to blue-light treated
seedlings.
35
A
B
Figure 6: Time course of curvature analysis of Arabidopsis seedlings in Columbia WT (A)
shoots and (B) roots. Blue lines represent blue-light treatments, and red lines represent red-bluelight treatment. Treatments with the same letter (a, a) are not statistically significant while
treatments with different lettering (a, b) are significantly different (p < 0.05). Error bars represent
+ S.E. Sample size was 52 to 53.
36
A
B
Figure 7: Time course of curvature analysis of Arabidopsis seedlings in C24 WT and BVR2
transgenic line deficient of all phytochromes in the root. Blue lines represent blue-light
treatments, and red lines represent red-blue-light treatment. Treatments with the same letter (a, a)
are not statistically significant while treatments with different lettering (a, b) are significantly
different (p < 0.05). Error bars represent + S.E. Sample size was 90 to 99; and 93 to 94 for C24
and BVR2 respectively.
37
Table 1: Growth rates for all genotypes examined in either blue or red-blue-light. Values shown
in white are for entire seedlings, values shown in light shading are radicle growth rates, and
values shown in dark shading are hypocotyl growth rates. Significance between light treatments
(p < 0.05) denoted by (*). Significance between genotypes sharing a WT within a light treatment
denoted by different lettering (a, b).
Ler WT
phyA
phyB
Ler WT
phyAB
C24 WT
BVR2
No-0 WT
CAB3
Col
Ler WT
phyA
phyB
Ler WT
phyAB
C24 WT
BVR2
No-0 WT
CAB3
Col
Ler WT
phyA
phyB
Ler WT
phyAB
C24 WT
BVR2
No-0 WT
CAB3
Col
Blue Light
Growth Rate (mm hr-1)
0.17 + 0.013 a
0.15 + 0.014 a
0.15 + 0.013 a
0.23 + 0.011 * a
0.19 + 0.016 * b
0.18 + 0.006 * a
0.18 + 0.006 * b
0.22 + 0.013 a
0.20 + 0.011 a
0.26 + 0.013
0.11 + 0.011 a
0.10 + 0.012 ab
0.08 + 0.011 * b
0.19 + 0.001 * a
0.13 + 0.013 b
0.12 + 0.004 * a
0.12 + 0.005 * b
0.17 + 0.011 a
0.15 + 0.009 a
0.19 + 0.011
0.06 + 0.005 ab
0.05 + 0.004 a
0.07 + 0.006 b
0.04 + 0.004 a
0.06 + 0.006 * b
0.06 + 0.002 a
0.06 + 0.002 a
0.06 + 0.004 a 38
0.05 + 0.004 a
0.07 + 0.004
Red then Blue Light
Growth Rate (mm hr-1)
0.16 + 0.010 a
0.15 + 0.010 a
0.17 + 0.010 a
0.14 + 0.013 * a
0.11 + 0.011 * b
0.20 + 0.006 * a
0.21 + 0.008 * b
0.21 + 0.012 a
0.19 + 0.012 a
0.24 + 0.018
0.11 + 0.007 a
0.10 + 0.009 a
0.11 + 0.007 * a
0.10 + 0.011 * a
0.06 + 0.008 b
0.14 + 0.005 * a
0.16 + 0.007 * a
0.16 + 0.01 a
0.15 + 0.009 a
0.19 + 0.014
0.05 + 0.003 a
0.05 + 0.004 a
0.05 + 0.004 a
0.04 + 0.004 a
0.04 + 0.005 * a
0.06 + 0.002 a
0.05 + 0.003 b
0.05 + 0.003 a
0.04 + 0.006 a
0.06 + 0.004
Literature Cited
Bae G, G Choi 2008 Decoding of light signals by plant phytochromes and their interacting proteins.
Ann. Rev. Plant Biol. 59:281-311.
Beitel GJ, SG Clark, HR Horvitz 1990 Caenorhabditis elegans ras gene let-60 acts as a switch in the
pathway of vulval induction. Nature 348:503-509.
Briggs WR, JM Christie 2002 Phototropins 1 and 2: versatile plant blue-light receptors. Trends Plant
Sci. 7:204-210.
Brock TG, PB Kaufman 1988 Altered growth response to exogenous auxin and gibberellic acid by
gravistimulation in pulvini of Avena sativa. Plant Physiol. 87:130-133.
Correll MJ, JZ Kiss 2002 Interactions between gravitropism and phototropism in plants. J. Plant Growth
Regul. 21:89-101.
Chevalier F, O Martin, V Rofidal, AD Devauchelle, S Barteau, N Sommerer, M Rossignol 2004
Proteomic investigation of natural variation between Arabidopsis ecotypes. Proteomics 4:13721381.
Chon, HP, WR Briggs 1966 Effect of red light on the phototropic sensitivity of corn coleoptiles. Plant
Physiol. 41:1715-1724.
Christie JM 2007 Phototropin blue-light receptors. Ann. Rec. Plant Biol. 58:21-45.
Christie JM, P Reymond, GK Powell, P Bernasconi, AA Raibekas, E Liscum, WR Briggs 1998
Arabidopsis NPH1: A flavoprotein with the properties of a photoreceptor for phototropism.
Science 282:1968-1701.
Collings DA, G Zsuppan, NS Allen , EB Blancaflor 2001 Demonstration of prominent actin filaments in
the root columella. Planta 212:392–403.
Correll MJ, KM Coveney, SV Raines, JL Mullen, RP Hangarter, JZ Kiss 2003 Phytochromes play a role
in phototropism and gravitropism in Arabidopsis roots. Adv. Space Res. 231:2203-2210.
Costigan SE, SN Warnasooriya, BA Humphries, BL Montgomery 2011 Root-localized phytochrome
chromophore synthesis is required for photoregulation of root elongation and impacts root
sensitivity to jasmonic acid in Arabidopsis thaliana. Plant Physiol. 3:1138-1150.
Darwin C, F Darwin 1880 The power of movement in plants. John Murray, London.
Devlin PF, SA Kay 2001 Circadian photoperception. Annu. Rev. Physiol. 63:677-694.
Devlin PF, PRH Robson, SR Patel, L Goosey, RA Sharrock, GC Whitelam 1999 Phytochrome D acts in
the shade-avoidance syndrome in Arabidopsis by controlling elongation growth and flowering
time. Plant Physiol. 119:909-915.
39
Fairchild CD, MA Schumaker, PH Quail 2000 HFR1 encodes an atypical bHLH protein that acts in
phytochrome A signal transduction. Genes Dev. 13:2377-2391.
Fasano JM, SJ Swanson, EB Blancaflor, PE Dowd, T Kao, S Gilroy 2001 Changes in root cap pH are
required for the gravity response of the Arabdiposis root. Plant Cell 13:907-921.
Feldman LJ, WR Briggs 1987 Light-regulated gravitropism in seedling roots of maize. Plant Physiol.
83:241-243.
Firn RD, C Wagstaff, J Digby 2000 The use of mutants to probe models of gravitropism. J. Exp. Bot.
51:1323-1340.
Franklin KA, PH Quail 2010 Phytochrome functions in Arabidopsis development. J. Exp. Bot. 61:11-24.
Franklin KA, SJ Davis, WM Stoddart, RD Vierstra, GC Whitelam 2003 Mutant analyses define multiple
roles for phytochrome C in Arabidopsis thaliana photomorphogenesis. The Plant Cell 15:1981–
1989.
Fukaki H, J Wysocka-Diller, T Kato, H Fujisawa, PN Benfey, M Tasaka 1998 Genetic evidence that the
endodermis is necessary for gravitropism in Arabidopsis thaliana. The Plant J. 14:425-430.
Galen C, J Huddle, E Liscum 2004 An experimental test of the adaptive evolution of phototropins: bluelight photoreceptors controlling phototropism in Arabidopsis thaliana. Evolution 58:515-523.
Gallego-Bartolomé J, C Kami, C Fankhauser, D Alabadí, MA Blázquez 2011 A hormonal regulatory
model that provides flexibility to tropic responses. Plant Physiol. 156:1819-1825.
Gehring CA, DA Williams, SH Cody, RW Parish 1990 Phototropism and geotropism in maize
coleoptiles are spatially correlated with increases in cytosolic free calcium. Nature 345:528-530.
Hangarter, RP 1997 Gravity, light and plant form. Plant Cell Environ. 20:796-800.
Harada A, T Sakai, K Okada 2003 Phot1 and phot2 mediate blue light-induced transient increases in
cytosolic Ca2+ differently in Arabidopsis leaves. Proc. Natl. Acad. Sci. (U.S.A) 100:8583-8588.
Harper RM, EL Stowe-Evans, DR Lusse, H Muto, K Tatematsu, MK Watahiki, K Yamamoto, E Liscum
2000 The NPH4 locus encodes the auxin response factor ARF7, a conditional regulator of
differential growth in aerial Arabidopsis tissue. Plant Cell 12:757-770.
Hartmann E, B Klingenberg, L Bauer 1983 Phytochrome-mediated phototropism in protonema of the
moss Ceratodon purpureus brid. Photochem. Photobiol. 38:599-603.
Hennig L, E Schäfer 2001 Both subunits of the dimeric plant photoreceptor phytochrome require
chromophore for stability of the far-red light-absorbing form. J. Biol. Chem. 276:7913-7918.
Heschel MS, J Selby, C Butler, GC Whitelam, RA Sharrock, K Donohue 2007 A new role for
phytochromes in temperature-dependent germination. New Phytol. 174:735-41.
40
Hopkins JA, JZ Kiss 2012 Phototropism and gravitropism in transgenic lines of Arabidopsis altered in
the phytochrome pathway. Physiol. Plant. 145:461-473.
Hou G, VL Kramer, YS Wang, R Chen, G Perbal 2004 The promotion of gravitropism in Arabidopsis
roots upon actin disruption is coupled with the extended alkalinization of the columella
cytoplasm and a persistent lateral auxin gradient. Plant J. 39:113–25.
Hou G, DR Mohamalawari, EB Blancaflor 2003 Enhanced gravitropism of roots with a disrupted cap
actin cytoskeleton. Plant Physiol. 131:1360–73.
Huala E, PW Oeller, E Liscum, IS Han, E Larsen, WR Briggs 1997 Arabidopsis NPH1: a protein kinase
with a putative redox-sensing domain. Science 278:2120-2123.
Hubert B, GL Funke 1937 The phototropism of terrestrial roots. Biologisch Jaaarboek 4:286-315.
Iversen T, P Larsen 1971 The starch statolith hypothesis and the optimum angle of geotropic
stimulation. Physiol. Plant. 25:23-27.
Janoudi A, WR Gordon, D Wagner, P Quail, KL Poff 1997 Multiple phytochromes are involved in redlight-induced-enhancement of first-positive phototropism in Arabidopsis thaliana. Plant Physiol.
113:975-979.
Johnson U, J West, C Lister, S Michaels, R Amasino, C Dean 2000 Molecular analysis of FRIGIDA, a
major determinant of natural variation in Arabidopsis flowering time. Science 290:544-550.
Kadota A, M Wada, M Furuya 1982 Phytochrome-mediated phototropism and different dichroic
orientation of Pr and Pfr in protonema of the fern Adiantum capillus-veneris L. Photochem.
Photobiol. 35:533-536.
Kami C, M Hersch, M Trevisan, T Genoud, A Hiltbrunner, S Bergmann, C Fankhauser 2012 Nuclear
phytochrome A signaling promotes phototropism in Arabidopsis. Plant Cell 24:566-576.
Kaufman PB, IL Song 1987 Hormones and the orientation of growth. In: Plant hormones and their role
in plant growth and development. Martinus Nijhoff Publishers pp. 375-392.
Kawai H, T Kanegae, S Christensen, T Kiyosue, Y Sato, T Imaizumi, A Kadota, M Wada 2003
Responses of ferns to red light are mediated by an unconventional photoreceptor. Science 421:
287-290.
Kern VD, FD Sack 1999 Irradiance-dependent regulation on gravitropism by red light in protonemata of
the moss Ceratodon purpureus. Planta 209:299-307.
Kimura M, T Kagawa 2006 Phototropin and light-signaling in phototropism. Current. Opin. Plant Biol.
9:503-508.
Kim K, J Shin, S Lee, H Kweon, JN Maloof, G Choi 2010 Phytochromes inhibit hypocotyl negative
gravitropism by regulating the development of endodermal amyloplasts through phytochromeinteracting factors. Proc. Natl. Acad. Sci. (U.S.A.) 108:1729-1734.
41
Kiss JZ, KDL Millar, RE Edelmann 2012 Phototropism of Arabidopsis thaliana in microgravity and
fractional gravity on the International Space Station. Planta 236:635-645.
Kiss JZ 2000 Mechanisms of the early phases of plant gravitropism. Crit. Rev. Plant Sci. 19:551-573.
Kiss, JZ, JL Mullen, MJ Correll, RP Hangarter 2003 Phytochromes A and B mediate red-light-induced
positive phototropism in roots. Plant Physiol. 131:1411-1417.
Kiss JZ, MM Guisinger, AJ Miller, KS Stackhouse 1997 Reduced gravitropism in hypocotyls of starch
deficient mutants of Arabidopsis. Plant Cell Physiol. 38:518–25.
Kiss JZ, TH Giddings, LA Staehelin, FD Sack 1990 Comparison of the ultrastructure of conventionally
fixed and high pressure frozen/freeze substituted root tips of Nicotiana and Arabidopsis.
Protoplasma 157:64-74.
Kiss, JZ, R Hertel, FD Sack 1989 Amyloplasts are necessary for full gravitropic sensitivity in roots of
Arabidopsis thaliana. Planta 177:198–206.
Kumar P, JZ Kiss 2006 Modulation of phototropism by phytochrome E and attenuation of gravitropism
by phytochromes B and E in influorescence stems. Physiol. Plant. 127:304-311.
Kumar P, CE Montgomery, JZ Kiss 2008 The role of phytochrome C in gravitropism and phototropism
in Arabidopsis thaliana. Funct. Plant Biol. 35:298-305.
Lariguet P, C Frankhauser 2004 Hypocotyl growth orientation in blue light is determined by
phytochrome A inhibition of gravitropism and phototropin promotion of phototropism. Plant J.
40:826-834.
Larsen P 1953 Influence of gravity on rate of elongation and on geotropic and autotrophic reactions in
roots. Physiol. Plant. 6:735-774.
Leitz G, BH Kang, ME Schoenwaelder, LA Staehelin 2009 Statolith sedimentation kinetics and force
transduction to the cortical endoplasmic reticulum in gravity-sensing Arabidopsis columella
cells. Plant Cell 21:843–60.
Lincoln C, JH Britton, M Estelle 1990 Growth and development of the axr1 mutants of Arabidopsis.
Plant Cell 2:1071-1080.
Liscum E, EL Stowe-Evans 2000 Phototropism: a ‘simple’ physiological response modulated by
multiple interacting photosensory-response pathways. Photochem. Photobiol. 72:273-282.
Liu YJ, M Iino 1996 Phytochrome is required for the occurrence of time dependent phototropism in
maize coleoptiles. Plant, Cell Environ. 19:1379-1388.
Lorrain S, T Genoud, C Fankhauser 2006 Let there be light in the nucleus! Curr. Opin. in Plant Biol.
9:509–514.
42
Millar KDL, P Kumar, MJ Correll, JL Mullen, RP Hangarter, RE Edelmann, JZ Kiss 2010 A novel
phototropic response to red light is revealed in microgravity. New Phytol. 186:648-656.
Mitra A, HK Choi, G An, 1989 Structural and functional analyses of Arabidopsis thaliana chlorophyll
a/b-binding protein (cab) promoters. Plant Mol. Biol. 12:169-179.
Mockler TC, H Guo, H Yang, H Duong, C Lin 1999 Antagonistic actions of Arabidopsis cryptochromes
and phytochrome B in the regulation of floral induction. Dev. 126:2073-2082.
Molas ML, JZ Kiss 2008 PKS1 plays a role in red-light-based positive phototropism in roots. Plant,
Cell, and Env., 31:842-849.
Molas ML, JZ Kiss, MJ Correll 2006 Gene profiling of the red light signalling pathways in roots. J. Exp.
Bot., 57:3217-3229.
Montgomery B.L 2008 Right place, right time: spatiotemporal light regulation of plant growth and
development. Plant Sig. Behav. 3:1053-1060.
Morita MT 2010 Direction gravity sensing in gravitropism. Annu. Rev. Plant Biol. 61:705-720.
Motcholski A, E Liscum 1999 Arabidopsis NPH3: a NPH1 photoreceptor-interacting protein essential
for phototropism. Science 286:961-964.
Murphy A, L Taiz 1995 Comparison of metallothionein gene expression and nonprotein thiols in ten
Arabidopsis ecotypes (correlation with copper tolerance). Am. Soc. of Plant Biol. 109:945-954.
Myers RM, T Maniatis, LS Lerman 1987 Detection and localization of single base changes by
denaturing gradient electrophoresis. Methods. Enzymol. 155:501-527.
Myers RM, VC Sheffield, DR Cox 1989 Mutation detection by PCR, GC-clamps, and denaturing
gradient gel electrophoresis. In: PCR Technology: Principles and Applications for DNA
Amplification, H. Ehrlich, ed. New York Stockton Press pp. 71-88.
Natagani A, J Chory, M Furuya 1991 Phytochrome B is not detectable in the hy3 mutant of Arabidopsis,
which is deficient in responding to end-of-day far-red light treatments. Plant Cell Physiol.
32:1119-1122.
Nagatani, A, RE Kendrick, M Koornneef, M Furuya 1989 Partial characterization of phytochrome I and
II in etiolated and de-etiolated tissues of a photomorphogenetic mutant (lh) of Cucumber
(Cucumis sativus L.) and its isogenic wild type. Plant Cell Physiol., 30:685-690.
Nagatani A, JW Reed, J Chory 1993 Isolation and initial characterization of Arabidopsis mutants that
are deficient in phytochrome A. Plant Physiol. 102:269-277.
Nakazaura M, Y Yoshida, K Manabe 1991 Differences between the surface properties of the PR and
PFR forms of native pea phytochrome, and their application to a simplified procedure for
purification of the phytochrome. Plant Cell Physiol. 32:1187-1194.
43
Nienhuis J, GR Sills, B Martin, G King 1994 Variance for water-use efficiency among ecotypes and
recombinant inbred lines of Arabidopsis thaliana (Brassicaceae). Am. J. Bot. 81:943-947.
Oghishi M, Saji K, Okada K, T Sakai, 2004 Functional analysis of each blue light receptor, cry1, cry2,
phot1, and phot2, by using combinatorial multiple mutants in Arabidopsis. PNAS 101:22232228.
Okuyushima Y, H Fukaki, M Onoda, A Theologis, M Tasaka 2007 ARF7 and ARF19 are involved in
lateral root formation via direct activation of LBD/ASL genes in Arabidopsis. Plant Cell 19:118130.
Perbal G, D Driss-Ecole 2003 Mechanotransduction in gravisensing cells. Trends Plant Sci. 8:498–504.
Quail F 2002 Phytochrome photosensory signaling networks. Nat. Rev. Mol. Cell Biol. 3:85-93.
Quail F 1998 The phytochrome family: dissection of functional roles and signalling pathways among
family members. Phil. Trans. R. Soc. Lond. B. 1399-1403.
Reed, JW, P Nagpal, DS Poole, M Furuya, J Chory 1993 Mutations in the gene for the red/far-red light
receptor phytochrome B alter cell elongation and physiological responses throughout
Arabidopsis development. Plant Cell. 5:147-157.
Reed JW, A Nagatani, TD Elich, M Fagan, J Chory 1994 Phytochrome A and phytochrome B have
overlapping but distinct functions in Arabidopsis development. Plant Physiol. 104:1139-1149.
Rockwell NC, JC Lagarias 2006 The structure of phytochrome: a picture is worth a thousand spectra.
Plant Cell. 18:4-14.
Ruppel NJ, RP Hangarter, JZ Kiss 2001 Red-light-induced positive phototropism in Arabidopsis roots.
Planta 212:424-430.
SAS Institute Inc. 2004 SAS/STAT® 9.1 User’s Guide. Carg. NC: SAS Institute Inc.
Sharrock RA, PH Quail 1989 Novel phytochrome sequences in Arabidopsis thaliana: Structure
evolution and differential expression of a plant regulatory photoreceptor family. Genes. Devel.
3:1745-1757.
Smith H 2000 Phytochromes and light signal perception by plants—an emerging synthesis. Nature
407:585-591.
Shen Y, Z Zhou, S Feng, J Li, A Tan-Wilson, L Qu, H Wang, XW Deng 2009 Phytochrome A mediates
rapid red light–induced phosphorylation of Arabidopsis FAR-RED ELONGATED
HYPOCOTYL1 in a low fluence response. Plant Cell 21:494-506.
Suzuki T, Y Shimazaki, T Fujii, M Furuya 1980 Photoreversible and photoirreversible absorbance
changes in the red and far-red spectral regions in Zea primary roots. Plant and Cell Physiol.
21:1309-1317.
44
Takemiya A, S Inoue, M Doi, T Kinoshita, K Shimazaki 2005 Phototropins promote growth in response
to blue light in low light environments. Plant Cell 17:1120-1127.
Tatematsu K, S Kumagai, H Muto, A Sato, MK Watahaki, RM Harper, E Liscum, KT Yamamoto 2004
MASSUGU2 encodes AUX/IAA19, an auxin-regulated protein that functions together with the
transcriptional activator NPH4/ARF7 to regulate differential growth responses of hypocotyl and
formation of lateral roots in Arabidopsis thaliana. Plant Cell 16:373-393.
Tsuchida-Mayama T, T Sakai, A Hanada, Y Uehara, T Asami, S Yamaguchi 2010 Role of the
phytochrome and cryptochrome signaling pathways in hypocotyl phototropism. Plant J.
62:653-662.
Vitha S, L Zhao, FD Sack 2000 Interaction of root gravitropism and phototropism in Arabidopsis wildtype and starchless mutants. Plant Physiol. 122:453–461.
Voytas DF, A Konieczny, MP Cummings, FM Ausubel 1990 The structure, distribution and evolution of
the Ta1 retrotransposable element family of Arabidopsis thaliana. Genetics 126:713-721.
Wagner JR, JS Brunzelle, KT Forest, RD Vierstra 2005 A light-sensing knot revealed by the structure of
the chromophore-binding domain of phytochrome. Nature 438:325-331.
Wang H, XW Deng 2003 Dissecting the phytochrome A-dependent signaling network in higher plants.
Trends in Plant Sci., 8:172-178.
Warnasooriya SN, BL Montgomery 2009 Detection of spatial-specific phytochrome responses using
targeted expression of biliverdin reductase in Arabidopsis. Plant Physiol. 149:424-433.
Wilmoth JC, S Wang, SB Tiwari, AD Joshi, G Hagen, TJ Guilfoyle, JM Alonso, JR Ecker, JW Reed
2005 NPH4/ARF7 and ARF19 promote leaf expansion and auxin-induced lateral root formation.
Plant J. 43:118-130.
Whippo CW, RP Hangarter 2004 Phytochrome modulation of blue-light-induced phototropism. Plant,
Cell, Environ. 27:1223–1228.
Yew-Seng JH, LM Burden, JH Hurley 2000 Structure of the GAF domain, a ubiquitous signaling motif
and new class of cyclic GMP receptor. EMBO J. 19:5288-5299.
Zhao X, Y Wang, X Qiao, J Wang, L Wang, C Xu, X Zhang In press Phototropins function in highintensity-blue-light-induced hypocotyl phototropism in Arabidopsis by altering cytosolic
calcium. Plant Physiol.
Zheng HQ, LA Staehelin 2001 Nodal endoplasmic reticulum, a specialized form of endoplasmic
reticulum found in gravity-sensing root tip columella cells. Plant Physiol. 125:252–65.
45
Appendix
A1a
A1b
46
A1c
A1d
Appendix 1: Reformatted illustrations of Figures 3a-d. In these figures, data for red-light curvature is
not included in the analysis.
47
A2a
A2b
48
A2c
A2d
Appendix 2: Reformatted illustrations of Figures 4a-d. In these figures, data for red-light curvature is
not included in the analysis.
49
3Aa
3Ab
Appendix 3: Reformatted illustrations of Figures 6a, b. In these figures, data for red-light curvature is
not included in the analysis.
50
4Aa
4Ab
Appendix 4: Reformatted illustrations of Figures 7a, b. In these figures, data for red-light curvature is
not included in the analysis.
51