Am J Physiol Renal Physiol 303: F1363–F1369, 2012.
First published September 19, 2012; doi:10.1152/ajprenal.00273.2012.
Connective tissue and its growth factor CTGF distinguish the morphometric
and molecular remodeling of the bladder in a model of neurogenic bladder
Cengiz Z. Altuntas,1 Firouz Daneshgari,1 Kenan Izgi,1,2 Fuat Bicer,1,2 Ahmet Ozer,1,3 Cagri Sakalar,4
Kerry O. Grimberg,1 Ismail Sayin,1,5 and Vincent K. Tuohy4
1
Urology Institute, University Hospitals Case Medical Center and Department of Urology, Case Western Reserve University
School of Medicine, Cleveland, Ohio; 2Department of Chemistry, Cleveland State University, Cleveland, Ohio; 3Department
of Genetics, Case Western Reserve University School of Medicine, Cleveland, Ohio; 4Department of Immunology, Lerner
Research Institute, Cleveland Clinic, Cleveland, Ohio; and 5Department of Biology, Case Western Reserve University,
Cleveland, Ohio
Submitted 11 May 2012; accepted in final form 28 August 2012
bladder remodeling; multiple sclerosis; transforming growth factor␤3; connective tissue growth factor
[e.g., multiple sclerosis (MS)]
may lead to the development of neurogenic bladder (NGB) and
lower urinary tract dysfunctions (LUTD), including urinary
incontinence, urgency frequency, and urinary retention (28).
NGB occurs in ⬎96% of patients with MS for longer than 10
MANY NEUROLOGICAL DISEASES
Address for reprint requests and other correspondence: F. Daneshgari,
Urology Institute, Univ. Hospitals Case Medical Center; Dept. of Urology,
Case Western Reserve Univ. School of Medicine; 11100 Euclid Ave., Lakeside
Bldg., Ste. 4554, Cleveland, OH 44106 (e-mail: [email protected]).
http://www.ajprenal.org
years (3). Unfortunately, current treatment modalities for NGB
do not relieve the entire spectrum of symptoms.
Experimental autoimmune encephalomyelitis (EAE) has
been used successfully to study neurological deficits in MS.
The role of central nervous system (CNS) inflammation in the
pathogenesis of EAE has been well documented (13, 26). T cell
lineage cells produce proinflammatory cytokines that contribute to EAE disease by inducing the expression of inflammatory
genes and reactivation of other neural antigens, reactive CD4 T
lymphocytes, and a subsequent inflammatory response within
the CNS. We previously reported that LUTD typical of NGB
occurred during EAE (2), which may be related to changes in
the molecular phenotype of the bladder. For example, a role for
nerve growth factor (NGF)-driven increased expression of type
I collagen was demonstrated in inflamed rat bladders in a
cyclophosphamide-induced cystitis model (8). Increased NGF
and glial cell-derived neurotrophic factor (GDNF) was shown
in other animal models of bladder inflammation (9, 27) and in
the urine of patients with interstitial cystitis (19). Changes in
expression of alternatively spliced smooth muscle myosin
heavy chain (SMMHC) isoforms and decreased total SMMHC
expression were demonstrated in a rat model of partial bladder
outlet obstruction (31). Connective tissue growth factor (CTGF;
also known as CCN2) has been recognized as a promoter of
epithelial-mesenchymal transition (EMT) and fibrosis (5, 7,
10, 16), and its expression can be induced by all three
isoforms of transforming growth factor-␤ (TGF-␤) (6).
Following our published report demonstrating the utility of
EAE as a model of NGB (2), we have begun a series of studies
to address the long-standing research questions related to
NGB. In the current study, we aimed to understand the impact
of NGB on the gross and targeted molecular phenotype of the
bladder.
MATERIALS AND METHODS
Generation of EAE mice. Female SJL/J mice (n ⫽ 130; Jackson
Laboratory, Bar Harbor, ME) were immunized for induction of EAE
at 8 –10 wk of age. The encephalitogenic p139 –151 peptide of myelin
proteolipid protein (PLP 139 –151, HSLGKWLGHPDKF; serine substituted for cysteine at residue 140) was synthesized at our institution
using standard solid phase methodology and FMOC side chain protected amino acids (2). The peptide was purified ⬎97% by reversephase high-pressure liquid chromatography, and amino acid composition was confirmed by mass spectrometry.
EAE was induced as described previously (30). Briefly, SJL/J mice
were injected subcutaneously in the abdominal flank on day 0 with
200 ␮g of PLP 139 –151 and 400 ␮g Mycobacteria tuberculosis
1931-857X/12 Copyright © 2012 the American Physiological Society
F1363
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 17, 2017
Altuntas CZ, Daneshgari F, Izgi K, Bicer F, Ozer A, Sakalar C,
Grimberg KO, Sayin I, Tuohy VK. Connective tissue and its growth
factor CTGF distinguish the morphometric and molecular remodeling
of the bladder in a model of neurogenic bladder. Am J Physiol Renal
Physiol 303: F1363–F1369, 2012. First published September 19,
2012; doi:10.1152/ajprenal.00273.2012.—We previously reported
that mice with experimental autoimmune encephalomyelitis (EAE), a
model of multiple sclerosis (MS), develop profound urinary bladder
dysfunction. Because neurogenic bladder in MS patients causes
marked bladder remodeling, we next examined morphometric and
molecular alterations of the bladder in EAE mice. EAE was created in
female SJL/J mice by immunization with the p139 –151 encephalitogenic peptide of myelin proteolipid protein in complete Freund’s
adjuvant, along with intraperitoneal injections of Bordetella pertussis
toxin. Seventy days after immunization, mice were scored for the
level of neurological impairment and then killed. Spinal cord sections
were assessed for demyelination, inflammation, and T cell infiltration;
the composition of the bladder tissue was measured quantitatively;
and gene expression of markers of tissue remodeling and fibrosis was
assessed. A significant increase in the bladder weight-to-body weight
ratio was observed with increasing neurological impairment, and
morphometric analysis showed marked bladder remodeling with
increased luminal area and tissue hypertrophy. Despite increased
amounts of all tissue components (urothelium, smooth muscle, and
connective tissue), the ratio of connective tissue to muscle increased significantly in EAE mice compared with control mice.
Marked increases in mRNA expression of collagen type I ␣2, tropoelastin, transforming growth factor-␤3, and connective tissue
growth factor (CTGF) were observed in EAE mice, as were decreased
levels of mRNAs for smooth muscle myosin heavy chain, nerve
growth factors, and muscarinic and purinergic receptors. Our results
suggest that bladder remodeling corresponding to EAE severity may
be due to enhanced expression of CTGF and increased growth of
connective tissue.
F1364
CONNECTIVE TISSUE-LED BLADDER REMODELING IN EAE MICE
Table 1. Classification of neurological disability
Clinical Score
Observed Neurological Disability
CS1
Paralysis of tail only
Tail paralysis
Clumsy gait
Poor ability to right body
Hind limb weakness
Incomplete paralysis of hind limbs
Complete paralysis of hind limbs
Morbidity
CS2
CS3
CS4
CS5
CS, clinical score.
RESULTS
EAE mice showed signs of neurological deficits beginning
on day 10 after immunization, with cycles of remission and
relapse with varying CS levels during the remaining observation period (Fig. 1 shows the mean CS progression of 15 mice
through day 74). Control SJL/J mice immunized with CFA
alone showed no impairment throughout the entire time period.
Seventy days after immunization, the spinal cords of the
CFA-immunized control group showed no inflammatory cell
infiltration, whereas those of the EAE mice consistently
showed conventional signs of CNS inflammation that correlated with clinical deficit (Fig. 2C), often marked by large
perivascular inflammatory cell infiltrations of dorsal and ventral columns along with peripheral infiltrations (Fig. 2, A and
B). We previously showed by CD4 immunostaining that inflammatory cells infiltrating the spinal cord in a similar EAE
model were predominantly CD4⫹ T cells (12). In addition,
Table 2. The specific primer sequences used for quantitative real-time PCR
Gene
Sense
Antisense
SMMHC
COL1A2
TROPOELASTIN
NGF
GDNF
P2RX1
M3
CTGF
TGF-␤3
␤-Actin
TGGAGGCCAAGATTGCAC
GCAGGTTCACCTACTCTGTCCT
ACCAGCTGCTGCTGCTAAA
AATTAGGCTCCCTGGAGGTG
TCCAACTGGGGGTCTACG
CCGAAGCCTTGCTGAGAA
AGGACTGGAGTGGGACAGC
TGACCTGGAGGAAAACATTAAGA
CCCTGGACACCAATTACTGC
GGTCATCACTATTGGCAACG
GGCCGCCTGTTTCTCTCT
CTTGCCCCATTCATTTGTCT
ATATGTCGGGATGCCAACTC
TGGACTGCACGACCACAG
GACATCCCATAACTTCATCTTAGAGTC
GGTTTGCAGTGCCGTACAT
AGATGCCATTGCTGGTCATA
AGCCCTGTATGTCTTCACACTG
TCAATATAAAGGGGGCGTACA
ACGGATGTCAACGTCACACT
COL1A2, collagen type 1, alpha 2; SMMHC, smooth muscle myosin heavy chain; NGF, nerve growth factor; GDNF, glial cell-derived neurotrophic factor;
CTGF, connective tissue growth factor; M3, muscarinic acetylcholine receptor 3; P2RX1, purinergic receptor X1; TGF-␤3, transforming growth factor-␤3.
AJP-Renal Physiol • doi:10.1152/ajprenal.00273.2012 • www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 17, 2017
H37RA (Difco, Detroit, MI) in 200 ␮l of an emulsion of equal
volumes of water and complete Freund’s adjuvant (CFA) (Difco).
Age-matched control mice were injected with water and CFA only.
On days 0, 3, and 7, each mouse was injected intraperitoneally with
0.2 ␮g of purified Bordetella pertussis toxin (List Biological Laboratories, Campbell, CA). Fifteen mice were weighed and scored daily
for signs of neurological impairment according to clinical score (CS)
criteria (Table 1) up to 74 days after induction. All protocols were
approved by the Institutional Animal Care and Use Committee of
Case Western Reserve University.
Tissue procurement. Seventy days after immunization, mice were
killed by asphyxiation with CO2 followed by cervical dislocation,
bladders and spinal cords were harvested, and bladders were weighed.
For characterization of bladder morphology, bladders were equilibrated for 20 min at 37°C in Krebs buffer aerated with 95% O2-5%
CO2 to maintain pH 7.4. Bladders were sectioned at the equatorial
midline, fixed in 10% neutral formalin, dehydrated, and embedded in
paraffin. Serial 5-␮m tissue sections were placed on microscope
slides, dewaxed, and rehydrated for routine hematoxylin and eosin
(H&E) and Masson’s trichrome staining.
Morphometric analysis of spinal cord. Spinal cords were removed
and fixed in 10% neutral formalin overnight. Paraffin-embedded tissue
was cut into 5-mm-thick sections and then stained with H&E and
luxol fast blue to assess the inflammation and demyelination, respectively (12). The severity of tissue injury and inflammation was
analyzed by researchers masked to sample identity. Images were
collected using a Leica SCN400 Slide Scanner.
Image processing. Image analysis was done as described previously with modifications (17). In brief, stained slides were scanned
with a Leica SCN400 Slide Scanner (Buffalo Grove, IL), and digital
images of whole cross sections of spinal cord and urinary bladder
were saved for analysis. The images were analyzed with Image-Pro
Plus (version 7.0; Media Cybernetics, Bethesda, MD). The software
can distinguish regions stained with different colors and quantitatively
measure the areas. Inflammatory cell accumulation (H&E) and the
demyelination area (luxol fast blue) on the spinal cord sections were
measured and expressed as percentages. Masson’s trichrome-stained
slides were used to determine the three components of bladder tissues
(urothelium, collagen, and smooth muscle). In all cases, the images
were processed by the same investigators, who were unaware of
treatment group assignments.
Quantitative real-time reverse transcription polymerase chain
reaction. Total RNA was extracted from whole bladders of CFA
control mice and EAE mice at different CS levels 70 days after
immunization, using TRIzol according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). cDNA was synthesized from the
total RNA using a Super Script III cDNA Synthesis Kit (Invitrogen).
Primers for SMMHC, collagen type I ␣2 (COL1A2), tropoelastin,
NGF, GDNF, purinergic receptor P2X1 (P2RX1), muscarinic acetylcholine receptor 3 (M3), CTGF, TGF-␤3, and ␤-actin were designed
using the Universal Probe Library Assay Design Center (Roche,
Mannheim, Germany; Table 2). Quantitative real-time polymerase
chain reaction (qRT-PCR) was performed using a Sybr Green PCR
Master kit (Foster City, CA) with an ABI Prism 7500 Sequence
Detection System (Applied Biosystems, Foster City, CA). After confirming that the mean levels of ␤-actin mRNA did not differ significantly between the EAE and CFA mice, data from the genes of
interest were normalized to ␤-actin and expressed relative to the CFA
control using the comparative threshold cycle method.
Statistical analysis. Morphometric analyses in Table 3 and qRTPCR experiments comparing two groups were evaluated with unpaired, two-tailed Student’s t-tests. For other experiments comparing
CS1– 4 and CFA mice, including some qRT-PCR results, one-way
ANOVA with Tukey’s post hoc test for comparisons between groups
was used. The mean and SD of each group was calculated. P ⬍ 0.05
was considered significant.
F1365
CONNECTIVE TISSUE-LED BLADDER REMODELING IN EAE MICE
Table 3. Histological observations in bladder cross sections 70 days after immunization
CFA (n ⫽ 6)
CS1 (n ⫽ 6)
CS2 (n ⫽ 7)
CS3 (n ⫽ 10)
CS4 (n ⫽ 9)
2.3 (0.07)
0.2 (0.1)
2.6 (0.13)
0.4 (0.09)
3.1 (0.54)
0.4 (0.16)
3.5 (0.58)
0.7 (0.05)
4.0 (1.39)
0.8 (0.29)
0.0015
⬍0.0001
1.5 (0.05)
0.5 (0.03)
0.3 (0.02)
1.6 (0.17)
0.6 (0.05)
0.4 (0.06)
1.9 (0.41)
0.8 (0.11)
0.5 (0.03)
2.0 (0.48)
0.9 (0.12)
0.5 (0.04)
2.2 (0.7)
1.1 (0.13)
0.7 (0.22)
0.0434
⬍0.0001
⬍0.0001
P*
2
Morphometric measurement of area, mean mm (SD)
Wall area
Lumen area
Tissue area, mean mm2 (SD)
Smooth muscle
Collagen
Urothelium
Tissue area, mean % (SD)
Smooth muscle
Collagen
Urothelium
Thickness of bladder compartments, mean (SD)
Smooth muscle/outer perimeter
Urothelium/inner perimeter
60.4 (4.7)
24.4 (2.5)
15.2 (2.4)
60.3 (2.6)
24.7 (1.6)
15.0 (2.2)
57.6 (2.1)
26.4 (2.9)
16.0 (2.1)
56.6 (2.9)
25.7 (1.9)
17.5 (2.3)
⬍0.0001
0.0071
0.0097
0.16 (0.01)
0.025 (0.00)
0.14 (0.02)
0.024 (0.00)
0.12 (0.03)
0.023 (0.00)
0.11 (0.02)
0.015 (0.00)
0.08 (0.03)
0.015 (0.00)
⬍0.0001
⬍0.0001
n, No. of animals. CFA, complete Freund’s adjuvant. *P value from 1-way ANOVA. Significant differences (P ⬍ 0.05) from pairwise comparisons by Tukey’s
post hoc test were as follows: wall area, CFA vs. CS3&4, CS1 vs. CS4; lumen area, CFA vs. CS3&4, CS1 vs. CS3&4, CS2 vs. CS3&4; collagen area, CFA
vs. CS2-4, CS1 vs. CS2-4, CS2 vs. CS4, CS3 vs. CS4; urothelium area, CFA vs. CS2-4, CS1 vs. CS4, CS2 vs. CS4, CS3 vs. CS4; smooth muscle %, CFA vs.
CS3&4; collagen %, CFA vs. CS3&4; urothelium %, CFA vs. CS4; smooth muscle thickness, CFA vs. CS2-4, CS1 vs. CS4, CS2 vs. CS4; urothelium thickness,
CFA vs. CS3&4, CS1 vs. CS3&4, CS2 vs. CS3&4.
spinal cords of EAE mice demonstrated increased demyelination that correlated with clinical deficit (Fig. 3).
The early mean body weight was similar for all groups. By
day 70 postimmunization, the bladder weight-to-body weight
ratio had increased significantly with increasing CS of EAE
mice compared with the CFA-immunized group (Fig. 4A).
Histological examination showed bladder hypertrophy and
lumen dilation in the EAE mice relative to the CFA control
mice, corresponding with increasing CS (Fig. 4B). Automated
digital imaging was used to quantify the cross-sectional area
and composition of bladder tissue. The total cross-sectional
wall and lumen areas of the bladder (at the equatorial midline)
increased significantly with the increase of CS from one to four
in EAE mice compared with CFA controls (Table 3).
Collagen and urothelium areas were significantly elevated in
bladder cross sections of EAE CS1– 4 mice, whereas the
smooth muscle area was significantly higher in CS2– 4 mice
compared with CFA-immunized control mice (Table 3). The
percentage of collagen in cross sections of CS2– 4 mice bladders was increased, as was the percentage of urothelium in
CS3– 4 mice bladders, compared with control mice. However,
the percentage of smooth muscle area in EAE mice bladders
decreased with increasing CS from CS2 through CS4 (Table 3
and Fig. 5). A gradual decrease of smooth muscle thickness,
which was calculated as smooth muscle area divided by the
length of the outer perimeter of cross-sectional area, was
A
10
Inflammatory cells, %
C
B
6
*
4
*
*
2
0
Fig. 1. Clinical score (CS) evaluation of experimental autoimmune encephalomyelitis (EAE) up to 74 days after induction. EAE was induced by immunization of 6-wk-old female SJL/J mice with PLP 139 –151. After immunization, mice were examined daily for neurological deficit on a score of 1 to 5
(Table 1). Data are mean CS over time in 15 mice with actively induced EAE.
Error bars show ⫾ SD.
*
8
CFA
CS1
CS2
CS3
CS4
Fig. 2. A: enlarged image of hematoxylin and eosin (H&E)-stained dorsal
column section from an EAE CS4 mouse showing infiltrating cells.
B: H&E-stained spinal cord section from an EAE CS4 mouse (left) and
captured inflammatory cells in the same section colored red (right) by using
image-Pro Plus (version 7.0; Media Cybernetics). C: quantification showed
increasing inflammatory cell infiltrations that correlated with clinical deficit in
EAE mice. Values are means of 5 mice/group ⫾ SD. P ⬍ 0.0001 by 1-way
ANOVA. Tukey’s post hoc test revealed significant differences (P ⬍ 0.05) in
comparisons of complete Freund’s adjuvant (CFA) control mice vs. each CS
level (*), as well as CS1 vs. CS2– 4, CS2 vs. CS4, and CS3 vs. CS4.
AJP-Renal Physiol • doi:10.1152/ajprenal.00273.2012 • www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 17, 2017
64.8 (1.5)
21.9 (1.6)
13.3 (0.9)
F1366
CONNECTIVE TISSUE-LED BLADDER REMODELING IN EAE MICE
were not significantly different in EAE mice relative to CFA
control mice (data not shown).
A
DISCUSSION
B
Unmyelinated area, %
60
*
*
CS1
CS2
*
*
40
20
0
CFA
CS3
CS4
Fig. 3. A and B: luxol fast blue-stained spinal cord section (left) and captured
unmyelinated and demyelinated parts in red color in the same section (right) of
a representative CFA control mouse (A) and a mouse with EAE CS4 (B), using
image-Pro Plus (version 7.0; Media Cybernetics). C: quantification of luxol
fast blue-stained spinal cord sections revealed increasing unmyelinated and
demyelinated area percentages that correlated with CS of EAE mice. Values
are means of 5 mice/group ⫾ SD. P ⬍ 0.0001 by 1-way ANOVA. Tukey’s
post hoc test revealed significant differences (P ⬍ 0.05) in comparisons of
CFA control mice vs. each CS level (*), as well as CS1 vs. CS3&4 and CS2
vs. CS4.
significant in CS2– 4 relative to the CFA control group (Table
3). A decrease of urothelium thickness, calculated as urothelium area divided by inner perimeter length, was significant in
CS3 (P ⬍ 0.05) and CS4 (P ⬍ 0.001) mice.
Comparison of gene expression by qRT-PCR in whole
bladders of EAE CS3 mice relative to CFA control mice 70
days after immunization revealed a significant decrease in
SMMHC level, whereas the connective tissue markers
COL1A2 and tropoelastin were increased significantly (P ⬍
0.001; Fig. 5). Levels of the mRNAs for neurotrophic factors
NGF and GDNF were significantly downregulated in remodeled CS3 bladders compared with controls, suggesting that
EAE results in decreased autonomic innervation of the bladder
smooth muscle (P ⬍ 0.001; Fig. 6, A and B). Gene expression
of purinergic and muscarinic receptors P2RX1 and M3, respectively, key mediators of neurologically controlled bladder contraction, were also significantly lower in CS3 mice bladders
relative to controls, which could result in altered bladder
contractile function in EAE mice.
Gene expression levels of two signaling proteins for fibrosis,
CTGF and TGF-␤3, were significantly upregulated in EAE
mice compared with CFA controls, corresponding with increased clinical deficit in the EAE mice (P ⬍ 0.0001 by 1-way
ANOVA; Fig. 6C). The levels of TGF-␤1 and TGF-␤2 mRNAs
Fig. 4. A: increase of bladder weight-to-body weight ratio in EAE mice with
increasing CS compared with CFA control mice. Crossbars are means of 7–9
mice/group; error bars indicate ⫾ SD. P ⬍ 0.0001 by 1-way ANOVA. Tukey’s
post hoc test revealed significant differences (P ⬍ 0.05) in CFA control mice
vs. CS3&4, CS1 vs. CS3&4, and CS2 vs. CS4. B: representative images of
H&E-stained equatorial sections of bladder in CFA control and EAE (CS1– 4)
mice. C: image analysis of a Masson’s trichrome-stained equatorial section of
a urinary bladder demonstrating measurement of smooth muscle, collagen, and
urothelium areas by color segmentation. Smooth muscle (red), collagen (blue),
and urothelium (pink) were recognized and captured by automated digital
image analyzer for measurements of percentages of total tissue cross-sectional
area.
AJP-Renal Physiol • doi:10.1152/ajprenal.00273.2012 • www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 17, 2017
C 80
MS and other neurological deficits such as spinal cord injury
and spina bifida cause LUTD, collectively referred to as NGB.
It is not entirely understood how disturbances in neurological
pathways result in NGB. However, patients with MS plaques
interrupting the neural pathways connecting the pontine micturition center to the sacral micturition center develop a combination of storage and voiding problems, or a condition
specific to neurogenic conditions, detrusor sphincter dyssynergia (DSD) (15). DSD is among the most difficult conditions to
treat and causes severe bladder complications in MS patients
that may lead to other complications such as overflow incontinence, vesico-ureteral reflux, and renal failure.
The remarkable changes frequently observed in patients with
NGB include marked thickening of the bladder wall, formation
CONNECTIVE TISSUE-LED BLADDER REMODELING IN EAE MICE
of trabeculae, outpouching of the wall called “cellulae formation,” and an erythematous urothelium (Fig. 7). However,
studies still have not determined why and how these changes
occur in the bladder. Furthermore, it is unclear if potentially
permanent changes contribute to clinical manifestations of
NGB. A translational approach and an animal model that
mimics the clinical phenotype are essential to determine the
associations between the nervous system and LUTD.
EAE is an established model commonly used in MS research
(22). Shortly after immunization, SJL/J mice develop acute
EAE and severe multilimb weakness and/or paralysis followed
by a remitting-relapsing stage of disease, with ultimate chronic
progression (21, 24, 30). This chronic-progressive stage of
EAE is characterized by sustained limb paresis or paralysis and
marked CNS demyelination and neurodegeneration particularly pronounced in the spinal cord. Our previous study (2)
described the development of LUTD during EAE progression
that was loyal to the clinical phenotype. In the present study,
we report a significant increase in the bladder weight-to-body
weight ratio corresponding to the degree of neurological deficit
(CS) in this model of NGB. All major components of the
bladder wall were increased in the EAE mice 70 days after
immunization, leading to a larger bladder with dilation of the
lumen, in agreement with the increased bladder volumes detected by ultrasound in another murine EAE model 60 days
postimmunization (1). Interestingly, the areas expressed as
percentages of total tissue area were also increased in collagen
and in urothelium, but decreased in smooth muscle, indicating
that collagen and urothelium contributed larger proportions to
the increased mass in the remodeled bladder in EAE. In
addition, the decreased ratio of smooth muscle to collagen
correlated with the level of CS of the animals. These findings
differ from previous studies of the bladder in other disease
models such as spinal cord injury, diabetes mellitus, and
obstruction, in which bladder hypertrophy and, particularly, an
increase of detrusor smooth muscle in response to elevated
bladder burden and distension were reported (11, 14, 18, 25).
In our exploration of the molecular portfolio of the bladder
remodeling, we found decreased expression of SMMHC
mRNA in EAE CS3 mice relative to CFA control mice,
whereas COL1A2 and tropoelastin were increased significantly. Thus, those alterations in gene expression, as the first
step in alterations of the protein activities and thus tissue
remodeling, confirmed the morphometric analyses of the bladder remodeling in which the increase in the amount of connective tissue was greater than that of muscle. Gene expression of
neurogenic components, including NGF, GDNF, muscarinic
receptors, and purinergic receptors, all decreased in EAE CS3
mice relative to CFA controls, which may indicate neurological
function impairment in the bladder. Although our results differ
from the increased NGF and GDNF expression observed in the
bladders of rats with spinal cord injury, cyclophosphamide-induced cystitis, and other sources of bladder inflammation (9, 27),
we assessed gene expression at a later time point than in those
studies; thus, we cannot rule out increased neurotrophic factor
expression in the acute phase of EAE in our model.
Our findings of increased expression of CTGF and TGF-␤3
mRNAs in EAE mice in direct proportion to CS level parallel
the correspondence of increased connective tissue and bladder
remodeling with CS. Those results further support our contention and that of others that a significant part of NGB is reflected
in increased fibrosis and present an interesting possible pathophysiological pathway. CTGF has been recognized as a promoter of fibrosis, neovascularization, embryonic processes,
wound healing, bone development, and, more recently, EMT,
which may be a driver of fibrosis (5, 10, 20). Interestingly, an
increase in CTGF expression has also been reported in rat
urinary bladder after surgical outlet obstruction (7). TGF-␤ is
a potent inducer of EMT and CTGF expression, and its effects
may be mediated by CTGF (4, 29). Although most of those
studies have involved the TGF-␤1 isoform, TGF-␤3 has been
shown to induce CTGF expression through Smad3 in intervertebral discs of rats and mice (23). Clarification of the functional
roles of CTGF and TGF-␤3, as well as identification of
additional signaling proteins and pathways related to activation
of bladder remodeling in NGB, have the potential to open a
gate to several lines of new research that may subsequently
lead to untangling of the complexities related to bladder remodeling and LUTD seen in NGB.
A potential limitation of this study is that we did not attempt to
correlate the extent of bladder remodeling with the degree of NGB
severity, including measurements of hyperreflexic/overactive vs.
areflexic/decompensated bladder, and DSD. In addition to requiring additional techniques specially adapted to the mouse, such as
simultaneous cystometry and external urethral sphincter electromyography to identify DSD, such studies will likely require
additional time points and frequent CS monitoring of the EAE
mice. The latter view stems from our observed correlation of
AJP-Renal Physiol • doi:10.1152/ajprenal.00273.2012 • www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 17, 2017
Fig. 5. A: the collagen area-to-smooth muscle area ratio increased significantly
with the increase of neurological deficits in EAE mice compared with CFA
controls. Crossbars are means of 6 –10 mice/group; error bars indicate ⫾ SD.
P ⫽ 0.0024 by 1-way ANOVA. Tukey’s post hoc test revealed significant
differences (P ⬍ 0.05) in CFA control mice vs. CS3&4. B: the mRNA level of
smooth muscle myosin heavy chain (SMMHC) was decreased at EAE CS3,
whereas the connective tissue markers collagen type I ␣2 (COL1A2) and
tropoelastin were increased significantly relative to CFA control mice. Values
are means of 8 mice/group ⫹ SD. *Significantly different from CFA control
(P ⬍ 0.025) by Student’s t-test with Welch’s correction for unequal variances.
F1367
F1368
CONNECTIVE TISSUE-LED BLADDER REMODELING IN EAE MICE
bladder remodeling with CS level 70 days after immunization,
when all of the EAE mice most likely had undergone one or more
remission/relapse cycles. That suggests the possibility of a degree
of reversibility of remodeling during remissions that could affect
the progression of bladder dysfunction. Our forthcoming functional study takes into consideration the potential fluctuation in
NGB progression owing to the remitting/relapsing model.
We conclude that EAE-caused neurological disability in
mice contributes to marked bladder remodeling that proportionally worsens with increasing neurological deficit. Although
all three components of detrusor smooth muscle, urothelium,
and connective tissue contribute to the increased bladder mass,
the role of connective tissue is more prominent and potentially
detrimental. The prominence of molecular constituents and
signaling factors of fibrosis open a gate for further exploration
of the role of connective tissue in the bladder remodeling and
LUTD of NGB. The EAE mouse is a useful model for translational studies of NGB.
ACKNOWLEDGMENTS
We acknowledge the use of the Leica SCN400 Slide Scanner in the
Genetics Department Imaging Facility at Case Western Reserve University
made available through a National Center for Research Resource Shared
Instrumentation Grant (1S10RR-031845). We thank Patricia Conrad for assistance with analyzing the images and use of the Imaging Facility.
GRANTS
This study was funded partially by National Institutes of Health Grants
HD-061825 (to F. Daneshgari) and R01CA-14035 (to V. K. Tuohy).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
Author contributions: C.A., F.D., and V.K.T. conception and design of
research; C.A., K.I., F.B., A.O., C.S., and I.S. performed experiments; C.A.,
K.I., F.B., A.O., C.S., K.O.G., and I.S. analyzed data; C.A., K.I., F.B., A.O.,
C.S., I.S., and V.K.T. interpreted results of experiments; C.A. and K.O.G.
prepared figures; C.A., F.D., K.O.G., and V.K.T. drafted manuscript; C.A. and
K.O.G. edited and revised manuscript; C.A., F.D., K.I., F.B., A.O., C.S.,
K.O.G., I.S., and V.K.T. approved final version of manuscript.
REFERENCES
1. Al-Izki S, Pryce G, Giovannoni G, Baker D. Evaluating potential
therapies for bladder dysfunction in a mouse model of multiple sclerosis
with high-resolution ultrasonography. Mult Scler 15: 795–801, 2009.
AJP-Renal Physiol • doi:10.1152/ajprenal.00273.2012 • www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 17, 2017
Fig. 6. Total mRNA was isolated from whole bladder of
EAE mice and CFA control mice 70 days after immunization, and quantitative real-time polymerase chain reaction
(qRT-PCR) was performed. A: gene expression levels of
neurotrophic factors nerve growth factor (NGF) and glial
cell-derived neurotrophic factor (GDNF) were significantly
downregulated in remodeled bladders of EAE CS3 mice
compared with control mice, as an indicator of neuronal
impairment in bladder. B: expression levels of purinergic
receptor P2RX1and muscarinic receptor M3 were decreased
significantly, which could affect bladder contractile function in EAE mice. Values in A and B are means of 8
mice/group ⫾ SD. *Significantly different from CFA control (P ⬍ 0.04) by Student’s t-test with Welch’s correction
for unequal variances. C: gene expression levels of fibrosis
signaling proteins connective tissue growth factor (CTGF)
and transforming growth factor-␤3 (TGF-␤3) were significantly increased in bladder tissue of EAE mice compared
with CFA controls and corresponding with CS level. Values
are means of 6 mice/group ⫾ SD. P ⬍ 0.0001 by 1-way
ANOVA for both CTGF and TGF-␤3. Significant differences (P ⬍ 0.05) by Tukey’s post hoc test were found for
CTGF in EAE CS4 mice compared with every other CS
level and CFA control mice, and for TGF-␤3 in all pairwise
comparisons of CFA vs. EAE mice or EAE mice of different CS levels with each other, except CFA vs. CS1.
CONNECTIVE TISSUE-LED BLADDER REMODELING IN EAE MICE
Cellulae
Fig. 7. Cytoscopic image from a patient with neurogenic bladder due to
multiple sclerosis, showing marked remodeling, including trabeculation, outpouching of the wall called “cellulae formation,” and an erythematous
urothelium.
2. Altuntas CZ, Daneshgari F, Liu G, Fabiyi A, Kavran M, Johnson JM,
Gulen MF, Jaini R, Li X, Frenkl TL, Tuohy VK. Bladder dysfunction
in mice with experimental autoimmune encephalomyelitis. J Neuroimmunol 203: 58 –63, 2008.
3. Borello-France D, Leng W, O’Leary M, Xavier M, Erickson J, Chancellor MB, Cannon TW. Bladder and sexual function among women with
multiple sclerosis. Mult Scler 10: 455–461, 2004.
4. Brigstock DR. Inhibitors of connective tissue growth factor (CCN2)mediated fibrogenesis: underlying mechanisms and prospects for antifibrotic therapy. In: CCN Proteins in Health and Disease. New York, NY:
Springer Science⫹Business Media, 2010.
5. Burns WC, Twigg SM, Forbes JM, Pete J, Tikellis C, Thallas-Bonke
V, Thomas MC, Cooper ME, Kantharidis P. Connective tissue growth
factor plays an important role in advanced glycation end product-induced
tubular epithelial-to-mesenchymal transition: Implications for diabetic
renal disease. J Am Soc Nephrol 17: 2484 –2494, 2006.
6. Cannito S, Novo E, di Bonzo LV, Busletta C, Colombatto S, Parola M.
Epithelial-mesenchymal transition: from molecular mechanisms, redox
regulation to implications in human health and disease. Antioxidants
Redox Signal 12: 1383–1430, 2010.
7. Chaqour B, Whitbeck C, Han JS, Macarak E, Horan P, Chichester P,
Levin R. Cyr61 and CTGF are molecular markers of bladder wall
remodeling after outlet obstruction. Am J Physiol Endocrinol Metab 283:
E765–E774, 2002.
8. Chung CW, Zhang QL, Qiao LY. Endogenous nerve growth factor
regulates collagen expression and bladder hypertrophy through akt and
MAPK pathways during cystitis. J Biol Chem 285: 4206 –4212, 2010.
9. Dupont MC, Spitsbergen JM, Kim KB, Tuttle JB, Steers WD. Histological and neurotrophic changes triggered by varying models of bladder
inflammation. J Urol 166: 1111–1118, 2001.
10. Gupta S, Clarkson MR, Duggan J, Brady HR. Connective tissue growth
factor: potential role in glomerulosclerosis and tubulointerstitial fibrosis.
Kidney Int 58: 1389 –1399, 2000.
11. Hanai T, Ma FH, Matsumoto S, Park YC, Kurita T. Partial outlet
obstruction of the rat bladder induces a stimulatory response on proliferation of the bladder smooth muscle cells. Int Urol Nephrol 34: 37–42,
2002.
12. Kang Z, Altuntas CZ, Gulen MF, Liu C, Giltiay N, Qin H, Liu L, Qian
W, Ransohoff RM, Bergmann C, Stohlman S, Tuohy VK, Li X.
Astrocyte-restricted ablation of interleukin-17-induced Act1-mediated signaling ameliorates autoimmune encephalomyelitis. Immunity 32: 414 –
425, 2010.
13. Kolls JK, Linden A. Interleukin-17 family members and inflammation.
Immunity 21: 467–476, 2004.
14. Lincoln J, Haven AJ, Sawyer M, Burnstock G. The smooth muscle of
rat bladder in the early stages of streptozotocin-induced diabetes. Br J
Urol 56: 24 –30, 1984.
15. Litwiller SE, Frohman EM, Zimmern PE. Multiple sclerosis and the
urologist. J Urol 161: 743–757, 1999.
16. Liu FY, Xiao L, Peng YM, Duan SB, Liu H, Liu YH, Ling GH, Yuan
F, Chen JX, Fu X, Zhu JL. Inhibition effect of small interfering RNA of
connective tissue growth factor on the expression of vascular endothelial
growth factor and connective tissue growth factor in cultured human
peritoneal mesothelial cells. Chin Med J (Engl) 120: 231–236, 2007.
17. Liu G, Daneshgari F. Temporal diabetes- and diuresis-induced remodeling of the urinary bladder in the rat. Am J Physiol Regul Integr Comp
Physiol 291: R837–R843, 2006.
18. Nagatomi J, Gloeckner DC, Chancellor MB, DeGroat WC, Sacks MS.
Changes in the biaxial viscoelastic response of the urinary bladder following spinal cord injury. Ann Biomed Eng 32: 1409 –1419, 2004.
19. Okragly AJ, Niles AL, Saban R, Schmidt D, Hoffman RL, Warner TF,
Moon TD, Uehling DT, Haak-Frendscho M. Elevated tryptase, nerve
growth factor, neurotrophin-3 and glial cell line-derived neurotrophic
factor levels in the urine of interstitial cystitis and bladder cancer patients.
J Urol 161: 438 –441, 1999.
20. Shi-Wen X, Leask A, Abraham D. Regulation and function of connective tissue growth factor/CCN2 in tissue repair, scarring and fibrosis.
Cytokine Growth Factor Rev 19: 133–144, 2008.
21. Sobel RA, Tuohy VK, Lu ZJ, Laursen RA, Lees MB. Acute experimental allergic encephalomyelitis in SJL/J mice induced by a synthetic
peptide of myelin proteolipid protein. J Neuropathol Exp Neurol 49:
468 –479, 1990.
22. Steinman L, Zamvil SS. Virtues and pitfalls of EAE for the development
of therapies for multiple sclerosis. Trends Immunol 26: 565–571, 2005.
23. Tran CM, Markova D, Smith HE, Susarla B, Ponnappan RK, Anderson DG, Symes A, Shapiro IM, Risbud MV. Regulation of CCN2/
connective tissue growth factor expression in the nucleus pulposus of the
intervertebral disc: Role of smad and activator protein 1 signaling. Arthritis Rheum 62: 1983–1992, 2010.
24. Tuohy VK, Lu Z, Sobel RA, Laursen RA, Lees MB. Identification of an
encephalitogenic determinant of myelin proteolipid protein for SJL mice.
J Immunol 142: 1523–1527, 1989.
25. Uvelius B. Detrusor smooth muscle in rats with alloxan-induced diabetes.
J Urol 136: 949 –952, 1986.
26. Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B.
TGFbeta in the context of an inflammatory cytokine milieu supports de
novo differentiation of IL-17-producing T cells. Immunity 24: 179 –189,
2006.
27. Vizzard MA. Changes in urinary bladder neurotrophic factor mrna and
ngf protein following urinary bladder dysfunction. Exp Neurol 161:
273–284, 2000.
28. Wein AJ. Lower urinary tract dysfunction in neurologic injury and
disease. In: Campbell-Walsh Urology, edited by Wein AJ. Philadelphia,
PA: Elsevier, 2007.
29. Xu J, Lamouille S, Derynck R. TGF-beta-induced epithelial to mesenchymal transition. Cell Res 19: 156 –172, 2009.
30. Yu M, Johnson JM, Tuohy VK. A predictable sequential determinant
spreading cascade invariably accompanies progression of experimental
autoimmune encephalomyelitis: a basis for peptide-specific therapy after
onset of clinical disease. J Exp Med 183: 1777–1788, 1996.
31. Zhang X, Seftel A, Disanto ME. Blebbistain, a myosin II inhibitor, as a
novel strategy to regulate detrusor contractility in a rat model of partial
bladder outlet obstruction. Plos One 6: e25958, 2011.
AJP-Renal Physiol • doi:10.1152/ajprenal.00273.2012 • www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 17, 2017
Trabeculae
F1369