[CAN@R RESEARCH54, 5821-5823, November 15, 19941
Advances in Brief
Highly Efficient Method for Obtaining
MOdified In-Gel Competitive
Hiroki Sasaki, Shintaro
Masaaki Terada2
Nomura,
a Subtracted
Reassociation
Nobu Akiyama,
Genomic DNA Library
by the
Method1
Atsushi Takahashi,
Takashi
Sugimura,
Michio Oishi, and
Genetics Division, National Cancer Center Research Institute, 1-1, Tsukiji 5-chome, Chun-ku@Tokyo W4 [H. S., N. A., A. T., T. S., M. Ti; Department of Pathology, Osaka
Univessity Medical School@1-3. Yamadagaoka@Suita City, Osaka 565 (S. N.]; Institute of Molecular and Cellular Biosciences, The University of Tokyo, J-1, Yayoi 1-chome,
Bw,kyou-kzi, Tokyo 113 (M. 0.1, Japan
Abstract
DNA andcompetitorDNA In thepreviousreports(14),the subtractedDNA
A highlyefficientmethodto obtaina subtractedgenomicDNA library
using 1 MIOft*llet DNA was developed by modification oftbe previously
hl,razy was constructed by direct cloning of DNA fragments to plasmid
vector without pnor removal of competitor-competitor reassodated mole
cules and competitor-target reassociated molecules after each step of subtrac
reported In-gelcompetitivereassoclationprocedure. The modifiedmethod
was based on polymerase chain reaction amplification after selective
@flcatIon
of a target-target reassociated moleculeof subtracted DNA
fragments to increase cloningefficiency.
For a model experimental system, the subtracted DNA library was
coi@tructed alter two cycles of subtractive reassoclation between cervical
cancer DNA fragments containing human papilloma virus DNA and the
iN-toW
exce@ of dephosphorylated
normal tissue DNA fragments which
were size-fractionated In agarose gel. Colony hybridization using human
papilloma virus DNA as a probe revealed that a more than 500-fold
enrichment of human papliloma virus DNA sequences in the subtracted
DNA library could easily be obtained. This simple and emclent method
will enable us to Isolate an unknown foreign DNA fragment and an
unknown amplified DNA fragment which might be present in cancer.
tive reassociation.Therefore,the complexityof the librarywas not sufficient
to recover most of the DNA fragments with altered structure from the total
genomic DNA.
We descril,e here an improvedmethod using a small amountof DNA to
efficiently isolate altered DNA fragments@in which competitor-competitor
reassociated molecules and competitor-target reassociated molecules are in
moved, followed by PCR amplification of the purified target-target reasso
dated molecules Using model experimental systems@we further demon
strated that the modified 10CR method was useful for isolation ofviral DNA
from tissues infected with unknown viruses and for isolation of amplified
DNA sequences from humancancer.
Materials and Methods
Preparation of Competitor and Target DNA. Surgical specimenof human
cervicalcancerDNA(FC-1)containingapproximately10copiesofHPV type 16per
Introduction
Itis well established now that multiple genetic alterations, including
haploid genome (15) and human placenta DNA were isolated by the conventional
those caused by viral integration, occur during the carcinogenic proc
ess. Several methods have been described previously for detection and
isolation of altered chromosomal DNA fragments from mammalian
cells (1—5)By using these methods, isolation of sequences from a
large deleted region in a sex chromosome (6, 7) or from a highly
amplified region in human cancer DNA (8—11)have been reported.
@
However, these methods involve tedious procedures and consume
much time. Furthermore, the sensitivity is quite low, and only highly
amplified sequences have been isolated. Lisitsyn et a!. (12) recently
reported a highly sensitive genomic DNA subtraction method using
liquid hybridization. Human polymorphic DNA markers were effi
cicntly isolated using this method, but they obtained high sensitivity
by decreasing the complexity of target and competitor DNA frag
ments Therefore, we are deprived of a chance to isolate many altered
DNA sequences in human cancer.
We previously descnl,ed a genomic subtractionmethodwhich we termed
the [email protected] (13, 14). The method is based on a subtractive reasso
da&ln in agamse gel between target DNA fragments and large excess
competitor DNA fragments, and we can enrich restriction DNA fragments
with an altered stnicture which have a different migration between target
Received7/21/94;accepted10/6/94.
Thecastsof publicationof thisarticleweredefrayedin partby the paymentof page
charges.Thisarticlemustthereforebe herebymarkedadvertisementin accordancewith
18US.C Section1734solelyto indicatethisfact.
I Supported
in part by a Grant-in-Aid
for A Comprehensive
10-Year
Strategy
for
CancerCcutrolfromtheMinistryofHealthandWelfareofJapan;byGrants-in-Aid
from
theMinistryof HealthandWelfareandfromtheMinistryof Education,
Scienceand
Culture ofJapan; by the Bristol-Myers Squibb Foundation; and by the Uehara Memorial
Foundation.
2To whomrequestsforreprintsshouldbe addressed.
3 The abbreviations used are: 10CR, in-gel competitive reassociation; PCR, polymer
see dials rcaction HPV, human papilloma virus.
phenol procedure(16) Each DNA was digestedwith MboI to completion.Total
amountsof 100 gg of placentaDNA digestswere treatedwith bacterialalkaline
phosphatasefordephosphotylation.DNAwas precipitatedwithethanolanddinOlVed
in Th (10 mMTriS-WJ,pH 7.5-1 mMEDTA)buffer.This dephosphorylatedDNA
digestwas unclonableto BamHI.digestedvectorsandwas usedas a competitorDNA.
MboI-digestedDNA from cervicalcancerwithoutphosphatasetreatmentwere don
ableto BamHI-cleavedvectorsand used as a targetDNA.
IGCR. One of thetargetDNA was mixedwith 100 ,@gof thecompetitor
DNA, and the mixturewas loadedonto an agarosegel (1% SeakemGTG; FMC).
After electrophoresis, a portion of the gel where 05- to 2.0 kilobases DNA
fragments migrated was excised with a razor blade. The portion was placed in an
alkaline solution (03 M NaOH-0.6 M NaG) for 30 min at room temperature. This
processwas repeatedonce morewith a freshalkalinesolution.The gel was then
rinsed twice with distilled water and incubated in reassociation buffer [(50%
formamide, 25 mM sodium phosphate buffer(pH 6.8), 1 MNaCl, 5 mat EDTA, and
10% (w/v) polyethylene glycol 8000@for 20 mis at room temperature. After
re@ng the incubationthree times,each time with fresh reassociationbuffer, the
gel was incubated in the same reassociation buffer for 24 h at 45°C.After
incubation,thegelwasthenrinsedtwicewithTEbuffer,andDNAwasrecovered
from the gel with Geneclean kit (BiolOl, La Jolla, CA).
Purification of Subtracted DNA Fragments and PCR Amplification.
The recoveredDNA was self-circularizedin 0.5 ml of volume by the self
circularizationmethod(17). In this step,only target-targetreassociatedmole
cules could be circularized.DNA was purifiedwith a Genecleankit. After
boiling and cooling, the solution was treated with mung bean nuclease, which
is a single-strand DNA specific exonuclease to remove uncircularized mole
cules. DNA was precipitatedwith isopropylalcohol using glycogen (GIBCO
BRL, Grand Island, NY) as a carrier and dissolved in it buffer. DNA was
redigestedwith MboI to linearizeagain, precipitatedwith isopropyl alcohol,
anddissolved in 10 ,.d of TE buffer.Two ,.d of the DNA samplewere ligated
with F-J adaptor (Fig. 2) by using a ligation kit (TAKARA, Kyoto, Japan). The
ligatedmixturewas amplifieddirectlyby PCRwith 1 @g
of F oligonucleotide,
5'-AACAGCTATGACCATGTCCAACG-3',
as a primer. The cycling condi
5821
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1994 American Association for Cancer Research.
HIGHLYEFFICIENTMETHODFOR GENOMICDNA SUBTRACtiON
tions were 2 mm of denaturation at 94°C,2 mm of annealing at 55°C,and 2
F oligonucleotlde
mm of polymerization at 72°C.The cycle was repeated 30 times (Thermocy
@
cler; Perkin-Elmer/Cetus).
After phenol
extraction
and ethanol
5 ,3 I
precipitation,
the PCR products were dissolved in TE buffer.
AACAGCTATGACCATGTCCAACG
- 3'
TTGTCGATACTGGTACAGGTTGCCTAGP
by the strategy shown in Fig. 1. The PCR products (Fig. 3) were redigested by
Mbol and ligated to BamHI-cleaved
and alkaline phosphatase-treated
pUC18
-5'
J oligonucleotide
Construction ofSubtracted Library. Subtracted librarieswere constructed
Fig. 2. Sequencesof F-J adaptorto amplify the purifiedsubtractedDNA molecules.
The oligonucleotides were synthesized on an Applied Biosystems 381A DNA synthesizer
vectorDNA(PharmaciaLKB,Piscataway,NJ). Escherichiacoil strainDH5a
and were purified by OPC column (Applied Biosystems, Inc., Foster City, CA). The
cells were transformed with the ligation mixture and selected for ampicillin
resistance. Recombinant clones were estimated by analysis based on the blue/white
phosphorylated J oligonucleotide and the F oligonucleotide were annealed.
colordistinction.Forconstructionof thesecond-roundsubtractedlibrary,thePCR
product after MboI digestion was used as target DNA with dephosphorylated
placenta DNA as competitor,and the process as describedin the constructionof
from HPV sequences in the PCR product after first subtraction. After
second subtraction, which was only performed between 1 ,ag of target
DNA and 100 ,.ag of competitor DNA, 1.4 and 0.8 kilobases DNA
the first-round subtracted library was repeated again.
fragments were detected as shown in Fig. 3. Although several mdc
General Methods Isolation of plasmid DNA by the alkaline lysis proce
dure and colony hybridization were as described (16). For Southern blotting
pendent trials were performed, intensities of 1.4 and 0.8 kilobases
(18), restriction endonuclease-digested genomic DNAS, plasmid DNAS, and DNA fragments, which are at the integration site of HPV (15), were
PCR productswere fractionatedon agarosegels. The DNASwere transferred always higher than those of other HPV DNA fragments. The PCR
onto Hybond-N@nylon membrane (Amersham, Arlington Heights, IL). Hy
products were redigested by MboI and ligated to pUC18/BamHI/CIAP
bridization probes were labeled in vitro using a multiprime-labeling kit (Am
(Pharmacia LKB), and competent DH5a cells were transformed with
ersham). Hybridizations were performed at 65°Covernight. The membranes
the ligation mixture. Recombinant clones as the first-round subtracted
were washed three times with 0.1X standard saline citrate-0.1% (w/v) sodium
dodecyl sulfate (1X standard saline citrate = 0.15 M NaC1-0.015 M sodium library were estimated to be 1 X i0@by blue/white colony assay, and
@
citrate) at 65°Cfor 30 mm. Autoradiography
was performed at —80°C
using
KodakXAR-5 films with intensifyingscreens.
Results
Construction of Subtracted Library. Subtracted libraries were
constructed by the strategy shown in Fig. 1. Cervical cancer DNA and
placenta DNA were digested by MboI. The placenta DNA-digest was
dephosphorylated by bacterial alkaline phosphatase to change it into
an unclonable form and was used as a competitor DNA. One @g
of the
MboI-digests from cervical DNA and 100 p.g of the competitor DNA
were mixed and electrophoresed in a 1% agarose gel. A portion of the
gel containing 0.5- to 2.0 kilobases DNA fragments was treated with
an alkaline solution to denature DNA and then incubated with the
reassociation buffer to reassociate DNA. DNA fragments were recov
ered from the gel. After self-circularization, self-circularized mole
cules were purified, ligated with F-i adaptor (Fig. 2), and amplified by
PCR using F oligonucleotide as a primer. The PCR product was
digested by MboI for second-round subtractive reassociation. One @g
of the digest and 100 p.g of competitor dephosphorylated placenta
DNA were mixed, and the denaturation and reassociation of 0.5 to 2.0
kilobases DNA in the gel after electrophoresis were repeated to obtain
a target-target-reassociated DNA molecule, followed by ligation to
F-J adaptor, and amplification by PCR. After electrophoresis of the
PCR products, Southern blot hybridization was carried out with the
whole HPV16 DNA probe as shown in Fig. 3. We detected all major
DNA fragments (2.6, 1.6, 1.4, 0.9, 0.8, and 0.5 kilobases) originating
@
PreparatIon ofa target from cervical
@
cancer DNA with Insertion of HPV 16.
: 100
r@
P@5h1t5 DNA
Subtractive reassociatlon in gel
@
@
Cloning
to pUC IS I Bas,Hl
Cloning
were
obtained
as the second-round
Estimation of Enrichment for HPV DNA Fragments in the
Subtracted Library. By Southern blot analysis, we confirmed that
more than four different sizes of HPV DNA fragments were included
in 4000 clones of the second-round subtracted library (data not
shown). Colony hybridization using a highly purified HPV DNA
probe was carried out to calculate exactly the ratio of enrichment for
HPV DNA fragments. From the first-round subtracted library, a
positive signal for the presence of HPV DNA could be detected in
about one of ten thousand colonies, while such a signal could be
detected in one of about two hundred colonies from the second-round
subtracted library (Table 1). In contrast, we could see no signal in 10@
recombinant colonies from the nonsubtracted library, which was con
structed from DNA recovered directly from agarose gel (Table 1).
Therefore, it was concluded that a more than 500-fold enrichment of
HPV sequences was obtained in the second-round subtracted library.
( I St
PCRamplification
ofthesubtracted
DNA
Competitor
sequences
@
clones
We have described here the modified 10CR method. Its usefulness
was demonstrated by its application to the differential cloning of HPV
DNA from cervical cancer DNA by the modified 10CR method. We
have changed the original procedure in the following two points: (a)
target and competitor DNA fragments were prepared by digestion
with the four bases cutter, MboI, to include most of the HPV DNA
$
Subtractivereassociatlon in gel
recombinant
subtracted library. We also tried a third-round subtraction to obtain
more enrichment. After the second subtraction, the PCR product was
digested by MboI for third-round subtractive reassociation. 0.5 @g
of
the digest and 50 @gof competitor DNA were mixed, and denatur
ation and renaturation in gel after electrophoresis were performed.
After self-circularization of DNA fragments recovered from the gel,
self-circularized molecules were purified and ligated with F-J adaptor;
then PCR amplification was performed using F oligonucleotide as a
primer. However, we failed the enrichment of HPV sequences by PCR
amplification with F oligonucleotide, even after a 50-cycle of PCR.
Moreover, we tried PCR amplification again using another adaptor,
but there was no enrichment of HPV sequences (data not shown).
Discussion
Agaroee gel electrophoreals
$
4 X
( 2 nd
PCRamplifIcation
ofthesubtracted
DNA
to pUC 18 I BamHI
Fig. 1. Flow diagram for construction of genomic subtracted library. For detailed
procedures, see the text.
ranging in size from 0.5 to 2.0 kilobases
and to increase the
chance of isolating altered DNA sequences in cancer; (b) we intro
duced PCR amplification of the reassociated target-target DNA mol
ecules after removal of competitor-competitor reassociated molecules
and target-competitor reassociated molecules to increase cloning ef
ficiency. By this modified procedure, HPV DNA sequences were
enriched to the ratio of 1:200 in the subtracted DNA library con
5822
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1994 American Association for Cancer Research.
HIGHLYEFFICIENTMETHODFOR GENOMICDNASUBTRACTiON
4567
123
kb
Fig. 3. HPV sequences in PCR products from
subtractive reassociation. Southern blots of 20 ,.@g
(Lanes I and 4)or 5 pg(Lane
@
2) ofcervical cancer
DNA cleaved with MboI, 0.5 g@gof PCR product
after first subtraction (Lane 3), and 0.1 @g
of PCR
pmducts after second subtraction (which were per
formed between 0.01 @g
(Lane 5), 0.1 pg (Lane
kb
2.6 —@
2.6—@-.@
1.6
1.4 —@“-SS
1.6
1@4—•@‘-
6), or 1 @Lg(Lane
7) of targetDNA and100g.@g
of
competitorDNA)were hybridizedwith a whole
HPV type 16 DNA as a probe. Sizes (kilobases) of
HPV DNA fragments are indicated on the left and
m@dk.
01,9
08
I
0.5 —@-
05 —@ .@
References
sequencesLibraryNo.
TabIc1 Estimatesof enrichmentforHPV
1. Roninson, L B. Detectionand mapping of homologous,repeated and amplified DNA
positive/
sequences by DNA renaturation in againse gels Nucleic Acids Res., 11: 5413-5431, 1983.
2. Lamar, E. E., and Palmer, E. Y-encoded, species-specific DNA in mice: evidence that
the Y chromosome exists in two polymorphic forms in inbred strains. Cell, 37:
171—177,
1984.
examined―(Yield)Cycle No.
0
Cycle 1
Cycle 20/100,000
a Number
of
clones
8/100,000
560/100,000(1/12,500)
hybridized
with
HPV
probe
out
of
(1/178)
the
number
of
3. Wieland, I., Bolger, 0., Asouline, G., and Wigler, M. A method for difference
cloning: gene amplification following subtractive hybridization. Proc. NatI. Aced.
recombinant
clonesexaminedfromunsubtracted
library(Cycle0), thefirstroundsubtracted
library
Sci. USA, 87: 2720—2724, 1990.
4. Brilliant, M. H., Gondo, Y., and Eicher, E. M. Direct molecular identification of the
(Cycle 1), and the second round subtracted library (Cycle 2).
mouse pink-eyed unstable mutation by genomic scanning. Science (Washington DC),
252:566—569,
1991.
5. Hatada, I., Haysshizaki, Y., Hirotsune, S., Komatsubara, H., and Mukai, T. A
structed after two cycles of subtractive reassociation, while no HPV
DNA containing clone was detected in the original library of 10@
recombinant clones. This procedure can be useful to isolate unknown
foreign DNA, if any, from DNA samples. The cloning of amplified
DNA fragments in specific rat tissue by the original IGCR method has
been demonstrated previously (16). The modified 10CR method
genomic scanning method for higher organisms using restriction sites ss landmarks.
Proc. Nati. Aced. Sci. USA, 88: 9523—9527, 1991.
6. Kunkel, L M., Monaco, A. P., Middlesworth, W., Ochs, H. D., and Latt, S. A. Specific
cloning of DNA fragments absent from the DNA ofa male patientwith an X chromosome
deletion. Proc. Nail. Aced. Sri. USA, 82: 4778—4782 1985.
7. Nussbaum, R. L, Lesko, J. G., Lewis, R. A., Ledbetter, S. A., and Ledbetter, D. H.
should be quite effective in the isolation of amplified sequences, espe
daily those with rearrangementwhich have a differentmigrationbetween
normal tissue DNA fragments and cancer DNA fragments. In fact, we
have successfully isolated a few unknown DNA fragments with ampli
fication of more than 5-fold from human esophageal cancer cell lines.4
Itis now well established that alterations of multiple genes, including
oncogenes and tumor suppressor genes, are required for conversion of a
normal cell to fully malignant cells with metastasis and invasive capacity.
Although there have been more than 80 oncogenes which have been
reported, only a limited number of oncogenes are actually altered in
human cancer, and the number of tumor suppressorgenes is less than 10.
There must be many unknown cancer-related genes, the structures of
which change during carcinogenesis. The method described here is effi
aent enough to isolate unknown foreign DNA and amplified DNA
sequence& The failure of enrichment of HPV DNA molecules after the
third cycle may be due to low concentration of the target DNA molecules
and presence of a large amounts of molecules without the adaptor
sequence after the second subtraction. In addition, some of the single
stranded DNA might be resistant to mung bean nuclease due to the
Isolation of anonymous DNA sequences from within a submicroscopic X chromo
somal deletion in a patient with choroideremia, deafness, and mental retardation.
Proc. Nati. Aced. Sci. USA, 84: 6521—6525, 1987.
8. Kinzler, K. w., Bigner, S. H., Bigner, D. D., Trent, J. M., Law, M. L, O'Brien, S. J.,
Wong, A. J., and Vogelstein, B. Identification of an amplified, highly expressed gene
in a human glioma. Science (Washington DC), 236: 70—73,1987.
9. Nakatani, H., Tahara, E., Yoshida, T., Sakamoto, H., Suzuki, T., Watanabe, H.,
Sekiguchi, M., Kaneko,Y., Sakurai,M., Terada,M., and Taksshi, S. Detection of
amplified DNA sequences in gastric cancers by a DNA renaturation method in gel.
Jpn.J. CancerRes. (Gann), 77: 849—853,1986.
10. Nakatani, H., Sakamoto, H., Yoshida, T., Yokota, J., Tahara, E., Sugimura, T., and
Terada, M. Isolation of an amplified DNA sequence in stomach cancer. Jpn. J. Cancer
Rex. (Gann), 81: 707—710,1990.
11. Hattori, Y., Odagiri, H., Nakatani, H., Miyagawa, K., Naito, K., Sakamoto, H., Katoh,
0., Yoshida, T., Sugimura, T., and Terada, M. K-sam, an amplified gene in stomach
cancer, is a member of the heparmn-bindinggrowth factor receptor genes. Proc. NatI.
Aced. Sci. USA, 87: 5983—5987, 1990.
12. Lisitsyn, N., Lisitsyn, N., and Wigler, M. Cloning the differences between two
complex genomes. Science (WashingtonDC), 259: 946—951,1993.
13. Yokota, H., Iwasaki, T., Takahashi, M., and Oishi, M. A tissue-specific change in
repetitive DNA in rats. Proc. Natl. Aced. Sci. USA, 86: 9233—9237,
1989.
14. Yokota, H., and Oishi, M. Differential cloning of genomic DNA: cloning of DNA
with an altered primary structure by in-gel competitive reassociation. Proc. NatI.
Aced. Sci. USA, 87: 6398—6402,1990.
formation of double-strandDNAS,and those molecules might be served
15. Takebe, N., Tsunokawa, Y., Nozawa, S., Terada, T., and Sugimura, T. Conservation
of E6 and E7 regions of human papilloma virus type 16 and 18 present in cervical
as a primer for PCR. This procedure is not yet sufficiently sensitive
enough to isolate sequences in small homozygously deleted regions
16. Sambrook, E. M., Fritsch, E. F., and Maniatis, T. Molecular Cloning: A Laboratory
found in cancer cells or sequencesat the break pointoftranslocation (data
not shown). Further improvement of this method is required to isolate
these forms of altered sequences in human cancer.
4 N. Akiyama,
unpublished
cancers. Biochem. Biophys. Res. Commun., 143: 837—844,1987.
Manual.ColdSpringHarbor,
NY:ColdSpringHarborLaboratory,
1989.
17. Ochman, H., Medhora, M. M., Ganza, D., and HartI, D. L. Amplification of franking
sequences by inverse PCR. In: M. A. Innis, D. H. Gelfand and J. J. Shinsky (eds.),
PCR Protocols. San Diego, CA: Academic Press, Inc., 1990.
18. Southern, E. M. Detection of specific sequences among DNA fragments separated by
gel electrophoresis. J. Mol. Biol., 98: 503—515,1975.
data.
5823
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1994 American Association for Cancer Research.
Highly Efficient Method for Obtaining a Subtracted Genomic
DNA Library by the Modified In-Gel Competitive Reassociation
Method
Hiroki Sasaki, Shintaro Nomura, Nobu Akiyama, et al.
Cancer Res 1994;54:5821-5823.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/54/22/5821
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1994 American Association for Cancer Research.