Insight into the activation mechanisms of Src, Abl, and their ancestors
Master’s Thesis
Presented to
The Faculty of the Graduate School of Arts and Sciences
Brandeis University
Department of Biology
Dorothee Kern, Advisor
In Partial Fulfillment
of the Requirements for the Degree
Master of Science
in
Biology
by
Sarita Biswas
May 2016
Acknowledgements
I would like to thank Roman Agafonov, Dorothee Kern, and the rest of the Kern lab for
all of the help and support throughout the past two years. I have learned so much from all of you
and am grateful for all of your guidance. Roman, I cannot thank you enough for all of your
patience and instruction. You have taught me so much, not only about how to do research, but
more importantly how to be a better scientist and student. Thank you to my friend and peer
Ayantu Temesgen for help with developing activity assays and for always responding to my late
night messages asking about protein purification. It has been a great pleasure to work alongside
you in the Kern lab. A final thank you to all of my friends, family, and teammates for supporting
me and pushing me to do my best work. I could not have done this without any one of you.
ii
Abstract
Insight into the activation mechanisms of Src, Abl and their ancestors
A thesis presented to the department of Biology
Graduate School of Arts and Sciences
Brandeis University
Waltham, MA
By Sarita Biswas
Src and Abl are two tyrosine kinases that have similar structures but different activation
and inhibition mechanisms. Previous studies and crystal structures have given insight on the
structures of Abl and Src which include information on vital tyrosine residues, regulatory
domains and myristoyl groups. In order to investigate these regulatory mechanisms and their
evolution over time, we reconstructed a common ancestor of Src and Abl and the common
ancestors between Abl/Src and the Tec and Fer families of kinases. We wanted to create a
methodology to examine the evolution of kinase regulation not only qualitatively, but also
quantitatively. We started with the well-known Src and Abl, and compared their abilities to
autophosphorylate and their rates of activity via a kinetic assay that measured kcat, the number of
conversions of substrate molecule per second by a single active site. We manipulated different
regulatory elements, so that we could investigate the differential modes of regulation of these
kinases. Once these methods were well developed, we repeated them on early ancestors of Src
and Abl, so that we could study how regulation had evolved over time.
iii
Table of Contents
Acknowledgements……………………………………………………………………………......ii
Abstract…………………………………………………………………………………………...iii
List of figures……………………………………………………………………………………..vi
List of abbreviations…………………………………………………………………………......vii
Introduction………………………………………………………………………………………..1
Protein kinases…………………………………………………………………………….1
Fer…………………………………………………………………………………………2
SH2 domain……………………………………………………………………….3
Kinase domain…………………………………………………………………….3
Regulation and phosphorylation……………………………………………..........3
Tec………………………………………………………………………………………....4
SH3, SH2, and Kinase Domains: structure and regulation………………………..4
Effect of phosphorylation on activity……………………………………………..5
Src…………………………………………………………………………………………6
Inactive state………………………………………………………………………6
Activation by phosphorylation and desphosphorylation…………………………..7
Active state………………………………………………………………………...8
Negative regulation by Csk………………………………………………………..9
Abl…………………………………………………………………………………………9
Inactive state……………………………………………………………………..10
Autophosphorylation and activation……………………………………………..10
Goals and experimental design…………………………………………………………………..12
Results and discussion…………………………………………………………………………...13
Regulation of Src ………………………………………………………………………..13
iv
Regulation of Abl………………………………………………………………………...18
Summary – Src and Abl………………………………………………………………….25
Regulation of ancestors…………………………………………………………………..26
Autophosphorylation and activation loop phosphorylation……………………...27
Effect of C-terminal tail on Ancestors 86 and 103………………………………37
Conclusions………………………………………………………………………………………39
Future directions…………………………………………………………………………………42
Materials and methods…………………………………………………………………………...43
Protein purification………………………………………………………………………43
Site directed mutagenesis………………………………………………………………...43
Western blots…………………………………………………………………………….44
Coupled assay……………………………………………………………………………45
High pressure liquid chromatography……………………………………………………46
Protein Phosphorylation for use in Kinetic Assays………………………………………46
References………………………………………………………………………………………..48
v
List of Figures
Figure 1: Families of non-receptor tyrosine kinases and resurrected ancestors………………… 2
Figure 2: Active and Inactive States of Src……………………………………………………... 6
Figure 3: Crystal structure of Src kinase domain in inactive and active states…………………. 7
Figure 4: Active and Inactive States of Abl…………………………………………………….. 9
Figure 5: Src autophosphorylates at Y416 in the activation loop……………………………..... 13
Figure 6: Csk phosphorylates Src at Y527 in tail……………………………………………..... 14
Figure 7: Kinetic assays on full length Src show insight into regulation……………………..... 15
Figure 8: Effects of regulatory elements on Src activity……………………………………….. 16
Figure 9: Autophosphorylation of full length wild type Abl at Y244 and Y412………………. 19
Figure 10: Autophosphorylation of Y244 and Y412 independent of each other………………..20
Figure 11: Kinetic assays on full length Abl show insight into regulation…………………….. 21
Figure 12: Effects of regulatory elements on Abl activity……………………………………... 23
Figure 13: Autophosphorylation of Ancestor 76, 86, and 103………………………………..... 27
Figure 14: Activation loop is major autophosphorylation site in Ancestor 76………………..... 29
Figure 15: Ancestor 76 not regulated by phosphorylation……………………………………... 30
Figure 16: Activation loop is autophosphorylation site in Ancestor 86……………………….. 31
Figure 17: Phosphorylation has increasing effect on activity of Ancestor 86………………….. 32
Figure 18: Activation loop is major autophosphorylation site in Ancestor 103………………... 34
Figure 19: Phosphorylation has significant effect on Ancestor 103 activity………………….... 35
Figure 20: C-terminal tail negatively affects ancestor activity…………………………………. 37
Figure 21: Src shows an equilibrium among states…………………………………………….. 39
Figure 22: Primers used in the polymerase chain reaction for each mutant…………………..... 44
Figure 23: Sequences of binding peptides used in the assay & Structure of myristoyl group…. 45
vi
List of Abbreviations
ADP = Adenosine Diphosphate
Anc = ancestor
ATP = Adenosine Triphosphate
BSA = Bovine Serum Albumin
Csk = C-terminal Src kinase
DNA = deoxyribonucleic acid
FPLC = Fast Protein Liquid Chromatography
HPLC = High Pressure Liquid Chromatography
IPTG = Isopropyl β-D-1-thiogalactopyranoside
KD = kinase/catalytic domain
LDH = lactate dehydrogenase
MBP = maltose binding protein
Mg = Magnesium
MgCl2 = Magnesium Chloride
mL = milliliter
mM = millimolar
NaCl = sodium chloride
NADH = Nicotinamide Adenine Dinucleotide
NBT/BCIP = nitro-blue tetrazolium and 5-bromo-4-chloro-3'-indolyphosphate
nm = nanometer
nM = nanomolar
p = phosphorylated
PCR = polymerase chain reaction
PEP = phosphoenolpyruvate
PK = pyruvate kinase
SDM PCR = site directed mutagenesis polymerase chain reaction
SH2 = Src homology 2
vii
SH3 = Src homology 3
TCEP = Tris(2-carboxyethyl)phosphine
Tris = Trsiaminomethane
µL = microliter
µM = micromolar
up = unphosphorylated
WT = wild type
Y244F = Tyrosine to Phenylalanine mutant at residue 244
Y324F = Tyrosine to Phenylalanine mutant at residue 324
Y328F = Tyrosine to Phenylalanine mutant at residue 328
Y412F = Tyrosine to Phenylalanine mutant at residue 412
YopH = Yersinia tyrosine phosphatase
viii
INTRODUCTION
Protein Kinases
There are about 500 human protein kinases, which are enzymes that phosphorylate Ser,
Thr and Tyr amino acids through the transfer of a phosphate group from ATP. Phosphorylation
by these kinases can often function to turn a protein “on” or “off,” and thus plays a central role in
cell communication. If a protein becomes stuck in the “on” position, this can lead to uncontrolled
cell growth and, ultimately, cancer. Therefore these kinases must be tightly regulated in order to
control cell development. To enable differential regulation of different pathways all kinases
employ different mechanisms of activation and inhibition that are rather complex and poorly
understood. This question is of particular interest since as has been recently shown selective
kinase inhibitors, which are the major anti-cancer drugs, may take advantage of differential
regulation (Agafonov et al., 2014). Thus, development of the new cancer therapeutics requires
deep understanding of the kinase activation mechanisms. Tyrosine kinases share many structural
and functional aspects – of particular importance is an intracellular kinase domain. This kinase
domain plays a similar role in the TK family, triggering downstream signal transduction and
activation. Autophosphorylation occurs at a conserved tyrosine residue in the activation loop,
which generally results in displacement of the activation loop from the activation site. This in
turn leads to increased kinase activity (Dengjel 2009).
1
Figure 1: Families of non-receptor tyrosine kinases and resurrected ancestors. The sequences of
modern-day tyrosine kinases from different families were used in a Bayesian phylogenetic
analysis with Ser/Thr kinases as the out-group. We reconstructed the sequences of ancestors 76,
86, and 103.
Fer
Fer is the oldest evolutionarily of the kinases of interest. It is thought to play roles in
regulating cytoskeletal rearrangements, as well as mediating cell to cell, receptor to ligand, and
cell to matrix signaling. Activation by cytokines, immunoglobulins, or growth factors can lead to
malignant cell transformations. Like Src, Abl, and Tec, Fer contains a Src homology domain
(SH2) domain and a kinase domain. (Greer 2002). Unlike the other three tyrosine kinases, Fer
does not contain an SH3 domain, indicating that this domain may have evolved at a later time.
2
SH2 Domain
The SH2 domain is a non-catalytic domain, but it can still modulate kinase activity. It is
responsible for key interactions that are necessary for activation, including association with the
PDGF receptor and other important substrates (Greer 2002). When two missense mutations were
inserted into the SH2 N terminal domains, Fer activity was completely abolished. This indicates
that this domain is necessary for the activation of Fer, and likely plays a role in the
conformational change and increase in kinase activity (Craig 1999).
Kinase Domain
The structure of the kinase domain of Fer has not yet been solved, but it is thought that
there is a flexible arm that connects the SH2 domain with the kinase domain. There are known to
be conserved tyrosine residues near the active site, with at least two phosphorylation sites in the
kinase domain. One site is the conserved residue in the activation loop, which is seen in many
other tyrosine kinases as well. Fer is regulated only by positive regulation, and is not negatively
regulated by an intramolecular interaction between the SH2 domain and the tyrosine in the
activation loop as is Src (Greer 2002).
Regulation and Phosphorylation
There are known to be three sites at which Fer autophosphorylates, but only one site has
definitively been identified. This site is the conserved residue in the activation loop, as
previously mentioned (Greer 2002). Another site is thought to be located in the N terminal region
of the protein, as it may provide a binding site for the SH2 domain or another phosphotyrosine.
While Fer can autophosphorylate, autophosphorylation is not necessary for activation (Craig
1999). Fer can also be activated and phosphorylated by other proteins upstream. For example,
3
PDGF stimulation induces tyrosine phosphorylation, and an increase in activity. Additionally,
the CC domains can mediate interactions with other proteins which also increases activity (Greer
2002).
Tec
Tec is the next oldest ancestor, evolutionarily. It contains Src homology 3 and 2 domains
(SH3 and SH2), and a kinase domain, as do Src and Abl. As in the other tyrosine kinase, there is
a linker that connects the SH2 domain to the kinase domain, which plays a central role in
regulation and activation (Joseph 2011).
SH3, SH2, and Kinase Domains: structure and regulation
In Src, the isolated kinase domain is active. However, in Tec, the isolated kinase domain
is catalytically inert. This indicates that there are other factors besides just the kinase domain
which lead to activation. As mentioned above, one of these factors is the SH2-kinase domain
linker, which is extremely important for the activation of Tec. In fact, disruption of this linker
leads to the inactivation of the kinase (Joseph 2011). It is also positively regulated by the
autophosphorylation of Y180 in the SH3 domain, and by phosphorylation by another kinase, in
trans, at the tyrosine residue in the activation loop (Joseph 2009). The question of interest is
“how do these residues get phosphorylated, and what effect does this have on enzymatic
activity?” It is known that Y180 is autophosphorylated via an intramolecular mechanism in cis
(Joseph 2007). Direct docking between the SH2 domain and the kinase domain brings the SH3
domain to the active site where Y180 can be phosphorylated. This docking interaction is a direct
interaction between a site on the kinase domain, separate from the active site, and a
4
complementary site on the substrate, separate from the phosphorylation site (Joseph 2007). The
interaction is distinct from the docking interaction that occurs between Src and Csk. The active
conformation is stabilized by a set of residues known as the regulatory spine. The
phosphorylation of the tyrosine in the activation loop, in trans, drives the conformational
equilibrium of the regulatory spine to an assembled state. It spans the kinase domain from the C
to the N terminal, and is only assembled into an organized structure when Tec is in the active
conformation. Interestingly, in the absence of the SH2-kinase domain linker, the regulatory spine
fails to form, and thus the active conformation is not stabilized (Joseph 2011). This is why the
catalytic activity is reduced.
Effect of Phosphorylation on Activity
It is thought that autophosphorylation of the residue in SH3 domain has little, if any,
effect on the Tec kinase family. The disruption of the autophosphorylation site in the SH3
domain only very slightly affects downstream signaling. In addition, the activity of this mutated
protein has essentially the same catalytic activity (Joseph 2009). However, the phosphorylation
of the activation loop tyrosine is key for the activation of the kinase. It is this interaction that
helps to drive the conformational change of the kinase and stabilize the active state. Disruption
of this tyrosine leads to catalytic impairment of Tec (Joseph 2011).
5
Src
Src consists of the SH3 and SH2 domains, a kinase domain, and a regulatory tail. It can
be autophosphorylated at a residue in the activation loop, and can be phosphorylated by Csk in
trans at a residue on the tail (Okada 2012).
Figure 2: Schematic representation of active and inactive conformations of Src kinase. Src is
regulated positively by the autophosphorylation of Y416 in the active site and regulated
negatively by the phosphorylation of Y527 by Csk in the tail.
Inactive state
In cells, 90-95% of Src is phosphorylated at Y527, the residue in the tail. The
phosphorylation of this residue stabilizes the inactive conformation of the enzyme (Rososki
2005). The inactive state is a “closed” structure in which the SH2 and SH3 domains are localized
to the backside of the kinase domain. This conformation is stabilized by a few interactions. The
SH2 domain forms a salt bridge with the phosphorylated Y527, and the SH3 domain binds via a
polyproline linker. Additionally, a hydrogen bond between Glu310 and Lys295, which is
6
required for MgATP binding, is disrupted (Okada 2012). In this conformation, neither the SH2
nor the SH3 domain is accessible to ligands (Rososki 2005).
Figure 3: Crystal structure of Src kinase domain in inactive and active states
Figure 3: The inactive conformation (a) and inactive conformation (b) show changes in the
activation loop, C-helix, switching of the electrostatic network formed between Lys295, Glu310,
Arg409 and Tyr416, and alignment of residues L325, M314, F405 and H38 to form a
hydrophobic regulatory spine in the active state. The regulatory spine is critical for the catalytic
activity of the kinase. c and d show a closer up view of the regulatory spine (Shukla 2014).
7
Activation by phosphorylation and desphosphorylation
A simplified model of the activation and inactivation of Src follows. The activation of
Src requires the desphosphorylation of Y527 (by a phosphatase) and the phosphorylation of
Y416 (by autophosphorylation). First, activated receptors interact with the SH2 and SH3
domains, which opens up the closed conformation. Then, phosphatases dephosphorylate Y527,
which begins to stabilize the active conformation. Finally, the activated Src autophosphorylates
at Y416 to lock the catalytic pocket into the fully active conformation. The phosphorylation of
this residue decreases the affinity of the SH2 and SH3 domains to the kinase domain, further
stabilizing the active state (Okada 2012).
There are small levels of phosphorylation seen at Y527, which is also due to
autophosphorylation, but this is not as significant. Src autophosphorylates much more quickly
and to a greater extent at Y416 as compared to Y527 (Osusky 1995). The autophosphorylation of
Y527 must occur at a much higher concentration of Src, and it occurs a bit slower than does
Y416 (Osusky 1995).
Active state
Once in the active state, Src can bind ATP and substrates in the active site of the kinase
domain. There is a small lobe and a large lobe in the kinase domain, which both play different
roles. The small lobe is responsible for the anchoring and orienting of ATP, and the large lobe is
responsible for the binding of the protein substrate. The catalytic/active site is the cleft that is
between the two lobes. To open or close the cleft, the lobes can move relative to each other. In
the active and open conformation, the cleft is accessible to ATP binding – ATP binds and ADP is
released (Rososki 2005). Again, this is an oversimplified model, and as described later, what we
8
really see is an equilibrium between the open and closed state. The enzyme can exist in different
forms along that equilibrium.
Negative regulation by Csk
Csk, a non-receptor tyrosine kinase, is a negative regulator of Src (Okada 2012). In its
inactive form, Src is phosphorylated at Y527 in the C-terminal tail, and the phosphorylation of
this residue increases its affinity for the SH2 domain (Okada 2012). This places an effective
“lock” on the SH2 domain, helping to stabilize the inactive conformation. Phosphorylation of
this residue does not occur via autophosphorylation, but rather through trans-phosphorylation by
Csk (Rososki 2015).
Abl
The Abl kinase consists of the SH3 and SH2 domains, a kinase domain, and an N
terminal cap with a myristoylation site. It can be autophosphorylated at two residues – Y412 in
the activation loop, and Y244 in the SH2 linker (Hantschel 2000).
Figure 4: Schematic representation of active and inactive conformations of Abl kinase. A key
step in activation is the phosphorylation of Y244, which breaks the interaction between the SH3
domain and the linker, opening up the conformation.
9
Inactive state
Under basal conditions, Abl is not phosphorylated, and is in its inactive state. The
inactive state of Abl is a closed conformation, slightly similar to that of Src. In this
conformation, neither of the previously mentioned tyrosine residues are phosphorylated. The
activation loop tyrosine can form a hydrogen bond with an aspartate residue nearby. This causes
the activation loop to mimic the binding mode of substrates and block the active site (Panjarian
2013). In addition, the SH3 and SH2 domains dock onto the back of the kinase domain,
stabilizing the closed state. The myristoyl group is attached to a binding pocket in the kinase
domain, which induces a bend in what is called the I helix. This interaction stabilizes the docking
of the SH2 domain to the kinase domain. In Abl, the SH2 domain is bound directly to the kinase
domain, while in Src the SH2 interacts with the kinase domain indirectly via the C terminal tail
(Nagar 2006). The SH3 domain interaction is stabilized by binding to a linker that connects the
SH2 and kinase domains (Panjarian 2013).
Autophosphorylation and activation
The phosphorylation of Y244 breaks the interaction between the SH3 domain and the
linker, which begins to open up Abl into the active state. The phosphorylation of the activation
loop tyrosine stabilizes the open confirmation, providing easier access to substrate (Panjarian
2013). When Abl is allowed to autophosphorylate, there is roughly a 5 fold increase in activity
(Tanis 2003). However, when a double mutant (Y244F and Y412F) of Abl is allowed to
autophosphorylate, there is still a 4 fold increase in activity. This implies that there are other
residues that can be autophosphorylated that also play a role in the activation of Abl (Tanis
2003).
10
Abl can be activated by other mechanisms besides phosphorylation (Nagar 2006). For
example, removal of the myristoyl group leads to a constitutively active form of Abl. A proline
rich ligand also disrupts the SH3 domain and activates Abl. Moreover, the kinase domain by
itself has higher catalytic activity than does the full length protein, which suggests that the kinase
domain is responsible for the activity of Abl and is restricted by the docking of the other domains
and the myristoyl group (Hantschel 2000).
11
GOALS AND EXPERIMENTAL DESIGN
In order to investigate the evolution of kinase regulation over time, we recreated an
evolutionary tree of Src, Abl, Tec, Fer and their ancestors. The ancestors were resurrected and
studied to better understand this progression of regulation. We wanted to create a methodology
with which to quantitatively assess differential modes of regulation, in addition to the already
well-established qualitative methods. Beginning with Src and Abl, we compared abilities to
autophosphorylate, and studied the effect of the phosphorylation of specific tyrosine residues –
the activation loop tyrosine in both Src and Abl, and the tyrosine in the kinase domain-SH2
linker in Abl. We then measured their rates of activity via a kinetic assay that measured kcat. In
this assay, we manipulated different regulatory elements, so that we could investigate the
differential modes of regulation of these kinases. Positive regulatory elements included binding
peptides and phosphorylation, and negative regulatory elements included the addition of a
myristoyl group with Abl, and the phosphorylation of the C-terminal tail in Src. Once these
methods were well developed, we repeated them on early ancestors of Src and Abl, so that we
could study how regulation had evolved over time. Overall, we found that the ancestors were
active with catalytic rates comparable to Src and Abl, and the effect of phosphorylation was
greater on more modern enzymes.
12
RESULTS AND DISCUSSION
Regulation of Src
In order to better understand the regulation of Src and Abl, we compared their activities
and abilities to autophosphorylate. We manipulated different regulatory elements, including the
phosphorylation of specific tyrosine residues, and the use of different peptides that bound to the
regulatory domains. We also engineered specific mutations to help us characterize the roles of
each of the key tyrosine residues within Src and Abl. To do this, we used site-directed
mutagenesis, and expressed the mutant DNA in E. Coli (BL21 strain). Like the other proteins,
the mutants were purified using the ATKA FPLC system.
Figure 5: Src autophosphorylates at Y416 in the activation loop
a.
b.
Figure 5: Time points are noted underneath in minutes. Std indicates the standard that was used.
Src was autophosphorylated with the following conditions: 1mM TCEP, 500 mM NaCl, 50 mM
Tris, 5 µM Src, 20 mM Mg, 5 mM ATP, 150 mM PEP, 9.4 units/mL PK, and 13.5 units/mL
LDH at pH 8, 25°C. PK and PEP were needed because Src has unproductive hydrolysis of ATP.
We need these recycling enzymes to ensure that there was enough ATP in the assay. a. Western
blot done on autophosphorylated Src. Phosphorylated protein was monitored by a primary
antibody that recognized pY527 and fluorescent secondary antibody for detection. b. Western
blot done on autophosphorylated Src. Phosphorylated protein was detected by a primary
antibody that recognized pY416, with detection by the same secondary antibody. Less of the
Y527 residues are phosphorylated as compared to Y416, indicating the bulk of the
autophosphorylation occurs at Y416.
We co-expressed Src with a Yersinia tyrosine phosphatase (YopH), to ensure that all
tyrosine residues were dephosphorylated. In these assays we used site specific antibodies that
13
bind to and recognize specific tyrosine residues. The two residues we were interested in were
Y416 in the activation loop, and Y527 in the C-terminal tail. A fluorescent secondary antibody
was used that bound to the primary antibody and allowed us to detect the phosphorylation of
these specific residues. After autophosphorylation assays, it can be clearly noted that Src
autophosphorylates primarily at Y416 (figure 5). There is only residual phosphorylation present
at Y527 in the C-terminal tail, which indicates that another kinase is necessary to phosphorylate
this residue – Src cannot autophosphorylate here. Negative regulation of Src requires another
kinase, such as the aforementioned tyrosine kinase Csk.
Figure 6: Csk phosphorylates Src at Y527 in tail
c.
a.
b.
Figure 6. Time points are noted underneath in minutes. Std indicates the standard that was used.
Src was phosphorylated by Csk, conditions were: 1mM TCEP, 500 mM NaCl, 1 µM Src, 10 µM
Csk, 150 mM PEP, 9.4 units/mL PK, 13.5 units/mL LDH, 20 mM Mg, 50 mM Tris, and 5 mM
ATP at pH 8 and 25°C. a. Undetectable phosphorylation at Y416. b. Csk phosphorylates at Y527
in the tail. c. Quantification of the bands seen in blots b. There is undetectable phosphorylation at
Y416, and significant phosphorylation seen at Y527, indicating Csk phosphorylates Y527 in the
tail.
As previously mentioned, Csk is a tyrosine kinase that phosphorylates Y527 in the Cterminal tail, inactivating it (Okada 2012). Csk specifically recognizes and phosphorylates Src at
Y527 in the tail, and not at Y416 in the activation loop. As seen in figure 4, there is no detectable
phosphorylation that can be seen at Y416, indicating that Csk specifically phosphorylates Y527,
14
and not all tyrosine residues in the sequence. This specific recognition allows for negative
regulation of Src, stabilizing a closed and inactive conformation of Src (Howell 1994).
After developing a methodology to selectively phosphorylate specific tyrosine residues,
we used these same methods to selectively modify the kinases and looked at the effect this had
on kinase activity. To do this we used a coupled assay, as described in the methods section. The
activity can be calculated from the slope and the enzyme concentration.
Figure 7: Kinetic assays on full length Src show insight into regulation
a.
b.
Src pY416 kinetic assays
Src pY527 kinetic assays
c.
Figure 7: Unphosphorylated Src was at 50 nM, all of the assays with pY416 were at 3 nM,
pY527 was at 730 nM, pY527 with SH2 binding peptide was at 100 nM, pY527 with SH3
binding peptide was at 100 nM, pY527 with both SH3 and SH2 peptides were at 25 nM, and
pY527 and pY416 were at 60 nM. Each of the SH3/SH2 binding peptides were added at 2 mM,
as was the Src peptide. PEP was added at 150 mM, 20 units/mL PK, 29 units/mL LDH, 0.5
mg/mL NADH, 0.3 mg/mL BSA, pH 8, temp 25C, 5 mM ATP, 20 mM Mg, 50 mM Tris1 mM
TCEP and 500 mM NaCl. In all tables, uP will stand for unphosphorylated protein, while P will
indicate that the protein has been fully phosphorylated – via one of the techniques described in
the methods section. a. Kinetic assays done with Src phosphorylated at Y416 in the activation
15
loop. b. Kinetic assays done with Src phosphorylated at Y527 in the activation loop. c. Table
with a summary of rates. Src shows a 225 fold increase in activation from its inactive state
(pY527) to its most active state (pY416+SH2+SH3).
The lowest rate of activity is seen when Y527 is phosphorylated; this is a rate of 0.2 ±
0.01 s-1. Src has the highest rate of activity when Y416 in the activation loop is phosphorylated,
and the SH2 and SH3 domains are displaced by binding peptides – a rate of 45 ± 3 s-1. From the
fully inactive to active state of Src, there is 225 fold increase in activation, which is quite
substantial.
Figure 8: Effects of regulatory elements on Src activity
Figure 8: Src has four possible states of activation: 1. Unphosphorylated Y527 and
unphosphorylated Y416 (intermediate), 2. Phosphorylated Y527 and unphosphorylated 416
(least active), 3. Unphosphorylated Y527 and phosphorylated Y416 (fully active) and 4.
Phosphorylated Y527 and phosphorylated Y416 (intermediate).
The fully inactive state of Src is what is seen in vivo, with Y527 phosphorylated in the
tail (Boggon 2004). Here, we used Csk to phosphorylate Y527. The phosphorylation of the tail
16
prompts the SH2 domain to dock onto the kinase domain, locking Src into inactive state, where
the rate of activity is only 0.2 ± 0.01 s-1. Also important for the inactive confirmation is the
location of SH2 and SH3 domains. Because Src is held in the autoinhibited state by the docking
of the SH3 and SH2 domains, we used peptides that mimicked substrates to remove the SH2 and
SH3 domains from the kinase domain, in an attempt to open up Src into the active confirmation,
even when Y527 was phosphorylated. When the SH2 binding peptide is added, it should bind to
the active site of the SH2 domain, breaking the interaction between the SH2 domain and pY527,
partially opening up Src into a more active confirmation. The rate of activity when the SH2
binding peptide is added is only 0.5 ± 0.1 s-1, only a 2.5 fold increase compared to the fully
inactive form of Src (figure 8). Similarly, we used a proline rich motif to break the interaction
between the SH3 domain and the linker docking it to the kinase domain. This results in a 5.5 fold
increase in activity, where Src has a rate of 1.1 ± 0.02 s-1 (figure 8). This same rate of activity is
shown when both binding peptides are added. With Y527 phosphorylated and the SH2 and SH3
binding peptides added, Src is still not fully active.
Phosphorylation of the activation loop and desphosphorylation of Y527 results in a 160
fold increase in activation, with a rate of activity of 32 ± 3 s-1. The phosphorylation of Y416 in
combination with the displacement of the SH2 and SH3 domains and the desphosphorylation of
Y527 brings Src to its open and active state, where Src shows the fastest rate of activity - 45 ± 3
s-1. As previously mentioned, this is a 225 fold increase in activation as compared to the inactive
form, where Y527 is phosphorylated. The steric block on the binding site is released when the
activation loop tyrosine is phosphorylated, opening up the binding site where ATP can bind and
effectively phosphorylate substrate peptides. The displacement of the SH2 and SH3 domains
further opens up the structure, activating it even more.
17
The doubly phosphorylated state of Src has a rate of activity of 1 ± 0.1 s-1 (figure 8). This
is analogous to the rate of activity seen when Y527 is phosphorylated and the SH2 and SH3
binding peptides are added. There are two possibilities to explain the mechanism by which this
happens, and further work needs to be done to fully elucidate it. One possibility is that the
phosphorylation of Y416 displaces the SH2 and SH3 domains, even when Y527 is
phosphorylated. The other potential mechanism is that the phosphorylated activation loop
increases the activity of the kinase domain, but the SH2 and SH3 domains remain in the inactive
state. Again, it is not clear which mechanism occurs, and further work is needed to better
understand what happens.
Finally, the completely dephosphorylated Src shows a rate of activity of 6 ± 2 s-1, which
is a 30 fold increase compared to the inactive form. The desphosphorylation of the tail allows for
the SH2 domain to be removed from the kinase domain, which allows for partial activation of the
kinase. However, the dephosphorylated activation loop still occludes the binding site, which is
why there is still a 7.5 fold increase in activity seen when Y527 is phosphorylated (figure 8).
Regulation of Abl
After determining quantitative methods to assess the differential regulation of Src, we
used these same methods on Abl to look at how it is regulated. We first autophosphorylated Abl
at the residue Y244 in the SH2 linker, and at Y412 in the activation loop. We had to use much
higher concentrations of enzyme, 50 µM Abl, because it autophosphorylates much more slowly
than does Src.
18
Figure 9: Autophosphorylation of full length wild type Abl at Y244 and Y412
c.
a.
d.
b.
Figure 9. Time points written underneath are in minutes. Std indicates the standard that was
used. Autophosphorylation of full length Abl, conditions were: 1 mM TCEP, 50 µM Abl, 150
mM PEP, 9.4 units/mL PK, 13.5 units/mL LDH, 20 mM Mg, 50 mM Tris5 mM ATP, and 500
mM NaCl at pH 8 and 25°C. a. Phosphorylated protein was detected by a primary antibody that
recognized pY244 and a fluorescent secondary antibody for detection b. Quantification of blot a.
c. Phosphorylated protein was monitored by a primary antibody that recognized pY412 and
detected by the same fluorescent secondary antibody. d. Quantification of blot c. Abl
autophosphorylates at Y412 and Y244.Y244 is completely phosphorylated by 60 minutes and
Y412 is completely phosphorylated by 120 minutes.
Abl can autophosphorylate at Y244 in the SH2 linker and at Y412 in the activation loop
(figure 10). Activation of Abl requires the phosphorylation of both of these residues. It appears
that Y244 autophosphorylates somewhat more rapidly than does Y412 in the activation loop
(figure 9). The phosphorylation of Y412 stabilizes the active conformation of the kinase domain,
increasing Abl activity (Hantschel 2004). The particular mechanism by which Y244
phosphorylation leads to activation is not yet fully elucidated. Because this is not yet known, we
engineered mutations at these tyrosine residues to examine the effect of the phosphorylation of
one residue at a time. We wanted to see if the phosphorylation of one residue was dependent on
the phosphorylation of the other residue, or if phosphorylation was independent. In order to test
19
this, we created Y244F and Y412F mutants, and then repeated the autophosphorylation
experiments.
Figure 10: Autophosphorylation of Y244 and Y412 independent of each other
a.
c.
b.
d.
Figure 10: Autophosphorylation of Abl mutants. Time points are noted underneath in minutes.
Std indicates the standard that used. Conditions were: 50 µM Abl, 150 mM PEP, 9.4 units/mL
PK, 13.5 units/mL LDH, 20 mM Mg, 50 mM Tris5 mM ATP, and 500 mM NaCl at pH 8 and
25°C. a. Phosphorylated protein was detected by a primary antibody that recognized pY244 and
a fluorescent secondary antibody was used for detection. b. Quantification of blot a. c.
Phosphorylated protein was detected by a primary antibody that recognized pY412 with a
fluorescent secondary antibody used for detection. d. Quantification of blot c. Abl
autophosphorylates at each residue independently of the phosphorylation of the other residue.
When a mutation is engineered at Y412 so that this residue cannot be phosphorylated,
there is still significant phosphorylation seen at Y244. It is the same when a mutation is
engineered at Y244, Y412 can still be phosphorylated. This is important because it implies that
the phosphorylation of each residue can occur independently of the phosphorylation of the other.
The rates of autophosphorylation are about the same in wild type and mutant Abl. It takes 45
minutes for the Y412F mutant to become fully phosphorylated at Y244, while the wild type takes
20
60 minutes. The Y244F mutant takes 120 minutes to become fully phosphorylated at Y412,
which is the same as it takes wild type Abl.
Again, after developing methods to selectively phosphorylate specific residues in Abl, we
used this methodology to selectively modify the kinase. We then ran coupled assays, as
described in the methods section, to quantitatively assess the effect of various regulatory
elements on Abl.
Figure 11: Kinetic assays on full length Abl show insight into regulation
a.
b.
uP Abl kinetic assays
pY244+pY412 Abl
kinetic assays
c.
Figure 11: uP Abl indicates unphosphorylated Abl, and pAbl indicates Abl phosphorylated at
Y412 and Y244. The assays were done under the following conditions: each of the binding
peptides were added at 2 mM (SH2, SH3, Src peptide). PEP was added at 150 mM, 20 units/mL
PK, 29 units/mL LDH, 0.5 mg/mL NADH, 0.3 mg/mL of BSA, pH 8, temp 25C, 5 mM ATP, 20
mM Mg, 50 mM Tris1mM TCEP and 500 mM Nacl. For enzyme concentration: pAbl at 28.2
nM, except for the assay with myristoyl, where pAbl was at 37.6 nM. The assays with upAbl
were done under the same conditions, with Abl added at 40 nM for the assays with SH2 binding
peptide, SH2 and SH3 binding peptides, and SH2/SH3 binding peptides plus myristoyl. Abl was
21
added at 200 nM for the assay with only myristoyl added, and at 30 nM for the assay with only
upAbl. a. Kinetic assays done on uP Abl. b. Kinetic assays done on pAbl. c. Summary of rates of
Abl. Abl shows a 13 fold increase in activation from its inactive state (upAbl + myristoyl) to its
most active state (pAbl + SH2).
In contrast to Src, Abl contains no phosphorylated tyrosine residues in its inactive state –
there is no negative regulation by phosphorylation. In this inhibited conformation, the active site
is occluded, and ATP and peptide substrates cannot gain access as easily, resulting in a slower
rate of activity, at only 3.9 ± 0.6 s-1 (figure 11). Fewer substrates access the active site, and thus
the rate of phosphoryl transfer is lower. While there is no negative regulation by
phosphorylation, there is negative regulation by a myristoyl group. When present, the myristoyl
group attaches to a binding pocket in the kinase domain, stabilizing the docking of the SH2
domain to the kinase domain (Nagar 2006). When Abl is incubated with a myristoyl group, it is
further inactivated and there is a 6.5 fold decrease in activity – the rate is only 0.6 ± 0.1 s-1
(figure 11). The highest rate of activity is seen when both Y244 and Y412 are phosphorylated,
and the SH2 binding peptide is added. At 7.8 ± 0.4 s-1; this is a 13 fold increase in activation
compared to the inactive form (figure 11).
22
Figure 12: Effects of regulatory elements on Abl activity
Figure 12: This is a proposed scheme of the different regulatory elements of Abl. The myristoyl
group is a negative regulatory element; when present Abl shows the lowest rate of activity. The
phosphorylation of Y412 and Y244 in combination with the displacement of the SH2 domain
results in the highest rate of activity.
Fully inactive Abl has a rate of 0.6 ± 0.1 s-1, which occurs when neither Y412 nor Y244
are phosphorylated, and the myristoyl group is buried into the binding pocket of the kinase
domain. There is an approximate 13 fold increase in activation when Y412 and Y244 are
phosphorylated, and the SH3 and SH2 domains are displaced from the kinase domain, opening
up the active site. In the open confirmation, a phosphate from ATP can be transferred to a
substrate peptide at the active site. However, these assays imply that there is not simply an active
and inactive form of Abl, but rather can exist in multiple stages of an equilibrium.
Increases in catalytic activity in Abl are seen when the SH2 and SH3 domains are
displaced from the kinase domain, which can happen through the binding of peptides, or through
the phosphorylation of Y412 and Y244. When both SH3 and SH2 binding peptides are added to
23
the unphosphorylated protein, the rate of activity increases to 7.2 ±1.0 s-1 (figure 12). This is
comparable to the rate when Abl is phosphorylated at Y412 and Y244, which is 7.6 ± 1.9 s-1
(figure 10). The addition of a myristoyl group to fully phosphorylated Abl is enough to decrease
the activity to 3.4 ± 1.5 s-1, nearly the same rate as unphosphorylated Abl (figure 12). When
binding peptides are added to displace the SH2 and SH3 domains, the rate increases to 5.5 ± 0.2
s-1, but this does not fully restore the activity (figure 12). The myristoyl group is very important
in the regulation and inhibition of Abl, and can effectively negate the effects of the
phosphorylation of Y412 and Y244, as well as the displacement of the SH2 and SH3 domains
(figure 12).
When neither Y244 nor Y412 is phosphorylated, the displacement of only the SH3
domain is sufficient to cause a 7 fold increase in activation, and the displacement of the SH2
domain causes an 11.5 increase in activation compared to the fully inactive state of Abl – where
neither residue is phosphorylated and there is myristoylation. The addition of the myristoyl group
to the phosphorylated kinase reverses this activation, docking the SH2 domain back onto the
kinase domain, and causing the rate of activity to decrease to 1.5 ± 0.5 s-1 (figure 12). The 2 fold
increase seen in comparison to fully inactive Abl is likely due to the continued displacement of
the SH3 domain, but the addition of the myristoyl group causes the SH2 domain to dock onto the
kinase domain. The rate of activity is a roughly 5 fold decrease as compared to the
unphosphorylated Abl with the SH2 and SH3 domains displaced.
The phosphorylation of Y412 and Y244 is sufficient to displace the SH2 and SH3
domains, so the addition of binding peptides that outcompete their affinity for the kinase domain
does not have a significant effect. The rate of activity stays roughly the same when the binding
peptides are added, a rate comparable to that of the unphosphorylated kinase with the addition of
24
the SH2 and SH3 binding peptides. Displacing the SH2 and SH3 domains with phosphorylation
or with binding peptides has the same effect. The addition of the myristoyl group does have an
inhibitory effect – about a 2 fold decrease in comparison to the activity of the phosphorylated
kinase.
Summary – Src and Abl
Src and Abl are both capable of autophosphorylation, and can phosphorylate target
substrate peptides. Abl is slower to autophosphorylate than is Src, and also shows slower rates of
activity than does Src in the comparable states. We set out to find methods with which to
quantitatively measure the effects of different regulatory elements on these kinases, and we were
successful. Autophosphorylation and phosphorylation with other kinases, followed by analysis
with Western Blot, allowed us to look at the phosphorylation of specific tyrosine residues and
characterize the phosphorylation that was seen. We were able to detect specifically which
residues are autophosphorylated, and which require another kinase be phosphorylated.
Additionally, the kinetic assays allowed us to quantitatively measure the rates of activity in
different conformations of the kinase. We monitored the effects of different regulatory elements.
This included positive elements such as phosphorylation of specific tyrosine residues and the
displacement of the SH2 and SH3 regulatory domains. It also included negative regulatory
elements – myristoyl binding group for Abl, and the C-terminal tail in Src. Once these methods
were developed, we used the same ones on the ancestors of Src and Abl, Anc 76, Anc 86, and
Anc 103, in order to better understand the evolution of kinase regulation.
25
Regulation of Ancestors
In order to examine the evolution of these different regulatory elements, we reconstructed
an evolutionary tree of Src, Abl, Tec, Fer and their ancestors. Ancestor 76 is the oldest
evolutionarily, and is the common ancestor of the Fer and Tec families. Ancestor 86 is the next
oldest, and the common ancestor of the Tec and Src families, Anc 103 is of particular interest as
it is the common ancestor of the Src and Abl families. We repeated the same experiments with
the ancestors – we first tested their abilities to autophosphorylate, then we inserted key mutations
and added regulatory elements to examine their mechanisms of activation.
26
Autophosphorylation and activation loop phosphorylation
Our data show that the ancestors are all able to autophosphorylate, and do so at about the
same rates. This is important because it shows that they do not need to be phosphorylated by
another kinase, and can do so themselves.
Figure 13: Autophosphorylation of Ancestor 76, 86, and 103
a.
Std 0
c.
1
2
3
5
10 20 30 45
0 1
60 120 180 300
b.
2
3
5
10
20
30
45 60
120 180 300
d.
e.
Std 0
1
2
3
5
10
20
30
45 60 120 180 300
f.
Figure 13: Std indicated the standard ladder that was run with protein sizes, and time points
written below are in minutes. The conditions were: 1 µM enzyme (Anc 76, Anc 86) or 5 µM
enzyme (Anc 103), 20 mM Mg, 50 mM Tris, 5 mM ATP, 1mM TCEP, and 500 mM NaCl at pH
27
8 and 25°C. For Anc 86, and Anc 103 we used a primary antibody P-TYR-1000, and an antirabbit secondary antibody. We developed these blots with an NBT/BCIP solution. For Anc 76,
we used the same primary antibody, but used a fluorescent secondary antibody: Alexa 546. We
quantified protein based on fluorescence. 14b, d, f. Anc 76, 86, 103 phosphorylate within 180
minutes. P-TYR-1000 was used because it is not known at which residues these ancestors
autophosphorylate. We had to use an antibody that would bind to every phosphorylated tyrosine
residue. a. Western blot showing autophosphorylation of tyrosine residues in Anc 76. b.
Quantification of blot a. c. Western blot showing autophosphorylation of tyrosine residues in
Anc 86. d. Quantification of blot c. e. Western blot showing autophosphorylation of tyrosine
residues in Anc 103. f. Quantification of blot e. All of the ancestors are able to
autophosphorylate and do so at similar rates.
It was previously known that the Src, Abl, Tec, and Fer families were capable of
autophosphorylation, so it was expected that these ancestors would be able to phosphorylate as
well. However, the residues at which these ancestors autophosphorylate was not completely
known. We then inserted a Y to F mutation at the tyrosine residue in the activation loop of each
ancestor, to see how much of the phosphorylation could be attributed to this residue, and to see if
there were many other sites at which these kinases could autophosphorylate. We wanted to see
the effect the phosphorylation of this residue had on the activity of these kinases, and so we ran
the same activity assays as we did before.
28
Figure 14: Activation loop is major autophosphorylation site in Ancestor 76
a.
b.
b. Quantification of blot a
Figure 14: Autophosphorylation of ancestor 76 wild type and the Y328F mutant. The same
conditions were used for both: 5 µM enzyme, 20 mM Mg, 50 mM Tris, 5 mM ATP, 1 mM
TCEP, and 500 mM NaCl at pH 8 and 25°C. a. A P-Tyr-1000 primary antibody was used to
detect phosphorylated tyrosine residues, and a fluorescent secondary antibody was used. We
scanned the blot based on this fluorescence. b. Quantification of blot a. The activation loop
tyrosine is a major phosphorylation site in Ancestor 76.
Ancestor 76 does autophosphorylate at the tyrosine residue in the activation loop, and this
phosphorylation accounts for a significant amount of the total autophosphorylation. When the
tyrosine is changed to a phenylalanine, there is less phosphorylation seen (figure 14). In order to
determine the effect this had on activity, we ran the same activity assays as before on the mutant
and wild type ancestor 76.
29
Figure 15: Ancestor 76 not regulated by phosphorylation
a.
b.
-1
rate (s )
c
Ratio of
activity
up76 wt p76 wt up76Y328F p76Y328F
8.6 ± 2.3 7.8 ± 0.6 7.9 ± 1.0 8.3 ± 2.3
pY328F/p
wt
up wt/p wt
up Y328F/p
Y328F
1.1
1.1
0.9
Figure 15: Conditions were as follows: 150 mM PEP, 2 mM Src peptide, 20 units/mL PK, 29
units/mL LDH, 0.3 mg/mL of BSA, 0.5 mg/mL NADH, pH 8, temp 25C, 5 mM ATP, 20 mM
Mg, 50 mM Tris1 mM TCEP, 500 mM NaCl, and enzyme at 30 nM, except for the assay with
p76Y328F, which was added at 24 nM. a. Kinetic assays done with Anc 76 wild type and Anc
76 Y328F. b. A summary of rates from the assays. c. The ratios of activity of the mutant and the
wild type kinase. The phosphorylated mutant has nearly the same activity as does the
phosphorylated wild type, indicating phosphorylation of the activation loop tyrosine does not
play a role in the regulation of Anc 76.
Anc 76 is the oldest kinase, and a common ancestor of the Fer and Tec families. It is also
the least regulated by phosphorylation, as indicated by a ratio of activity of unphosphorylated to
phosphorylated wild type kinase of 1.1. The phosphorylated Y328F mutant has nearly the same
30
rate of activity as does the phosphorylated wild type, with a ratio of activity of 1.1. From the
previous experiment, we know that activation loop phosphorylation accounts for a significant
amount of the autophosphorylation seen. If the activation loop phosphorylation had a serious
effect on activity, we would expect to see a decreased rate of activity in the phosphorylated
Y328F mutant as compared to the phosphorylated wild type kinase. The mutated residue would
not be phosphorylated in the activation loop, which would decrease activity were this a positive
regulatory element. However, in the Y328F mutant, we see nearly the same rate of activity as in
the wild type protein. This implies that the phosphorylation of this residue is not critical for the
catalytic activity of Ancestor 76.
Figure 16: Activation loop is autophosphorylation site in Ancestor 86
a.
b.
Figure 16: Autophosphorylation of Ancestor 86 wild type and Y324F mutants. The same
conditions were used for both: 5 µM enzyme, 20 mM Mg, 5 mM ATP, 1mM TCEP, 50 mM Tris
and 500 mM NaCl at pH 8 and 25°C. a. A P-Tyr-1000 primary antibody was used to detect
phosphorylated tyrosine residues, and a fluorescent secondary antibody was used. We scanned
the blot based on its fluorescence. b. Quantification of blot a. The activation loop tyrosine is a
major autophosphorylation site in Ancestor 86.
31
Ancestor 86 does autophosphorylate at the tyrosine residue in the activation loop, and this
phosphorylation accounts for a significant amount of the total phosphorylation seen. When the
tyrosine is changed to a phenylalanine, there is less phosphorylation seen (figure 16). In order to
determine the effect this had on activity, we ran the same activity assays as before on the mutant
and wild type ancestor 86.
Figure 17: Phosphorylation has increasing effect on activity of Ancestor 86
a.
b.
-1
rate (s )
c
Ratio of
activity
up86 wt p86 wt up86Y324F p86Y324F
2.5 ± 1.1 5.5 ± 0.3
2.6 ± 0.9
2.2 ± 0.3
pY324F/p
wt
up wt/p wt
up Y324F/p Y
324F
0.4
0.5
1.2
Figure 17: Conditions were as follows: 150 mM PEP, 20 units/mL PK, 29 units LDH/mL, 0.5
mg/mL NADH, 0.3 mg/mL BSA, pH 8, temp 25C, 5 mM ATP, 20 mM Mg. Wild-type Anc 86
32
was at a concentration of 30 nM, and Anc 86 YtoF was at 24 nM. a. Kinetic assays done on wild
type and Y324F mutant Ancestor 86. b. Rate table with a summary of rates found from the
assays. c. The ratio of activity between the wild type and mutant kinases. Ancestor 86 is
regulated by the phosphorylation of the activation loop tyrosine as indicated by a decreased rate
of activity in the phosphorylated Y324F mutant as compared to the phosphorylated wild type.
Ancestor 86 is the common ancestor of the Tec and Abl families, both of which are
regulated by phosphorylation. As previously mentioned, phosphorylation of the activation loop
tyrosine is key for the activation of Tec. It is this interaction that helps to drive the
conformational change of the kinase and stabilize the active state (Joseph 2011). We saw that
unphosphorylated Abl had a rate of activity of roughly half the rate of activity of doubly
phosphorylated Abl. This is the same difference in activities seen between unphosphorylated and
phosphorylated Ancestor 86. Phosphorylated wild-type Anc 86 has a rate of activity of roughly
double that of unphosphorylated wild-type ancestor 86. This shows us that phosphorylation does
have an effect on activity of Anc 86, but it does not tell us specifically which residue can be
attributed to this. In order to characterize the phosphorylation, we had to look at the activity of
the Y324F mutation in the activation loop. The phosphorylated mutant had roughly the same rate
of activity as the unphosphorylated wild-type. This implies that the phosphorylation of the
activation loop tyrosine is in fact what helps lead to the catalytic activation of Ancestor 86. If this
weren’t the case, and another tyrosine residue was critical for the regulation of Ancestor 86, we
would expect to see similar rates of activity in the mutant and the wild-type. But, we see a
decrease in activity in the phosphorylated mutant, suggesting that phosphorylation of the
activation loop tyrosine is a critical step in the activation of Ancestor 86.
33
Figure 18: Activation loop is major autophosphorylation site in Ancestor 103
a.
b.
Figure 18:
Autophosphorylation of ancestor 103 wild type and Y328F mutant. The same conditions were
used for both: 5 µM enzyme, 20 mM Mg, 50 mM Tris, 5 mM ATP, 1mM TCEP and 500 mM
NaCl at pH 8 and 25°C. a. A P-Tyr-1000 primary antibody was used to detect all phosphorylated
tyrosine residues, and a fluorescent secondary antibody was used. We scanned the blot based on
this fluorescence. b. Quantification of blot a. The activation loop tyrosine is a major
autophosphorylation site in Ancestor 103.
Ancestor 103 does autophosphorylate at the tyrosine residue in the activation loop, and
this phosphorylation accounts for a significant amount of the total phosphorylation. When the
tyrosine is changed to a phenylalanine, there is less phosphorylation (figure 18). In order to
determine the effect this had on activity, we ran the same activity assays as before on the mutant
and wild type Ancestor 103.
34
Figure 19: Phosphorylation also effects Ancestor 103 activity
a.
up103
p103
rate (s-1) 3.8 ± 0.6 5.2 ± 0.3
Ratio of
activity
up103
Y328F
2.1 ± 1.0
p103
Y328F
2.0 ± 0.6
pY328F/p
wt
up wt/p wt
up Y328F/
pY328F
0.38
0.72
1.0
Figure 19: Conditions were as follows: 150 mM PEP, 20 units/mL PK, 29 units/mL LDH, 0.5
mg/mL NADH, 0.3 mg/mL of BSA, pH 8, temp 25C, 5 mM ATP, 20 mM Mg, 50 mM Tris and
500 mM NaCl. Wild-type Anc 103 was at a concentration of 30 nM, and Anc 103 YtoF was at
24 nM. a. Kinetic assays run on Ancestor 103 wild type and Y328F activation loop mutant. b.
Summary of rates from the assays. Activation loop phosphorylation does play a role in the
regulation of Anc 103, as indicated by a decreased rate of activity in the phosphorylated Y328F
mutant as compared to the phosphorylated wild type.
Ancestor 103 is the common ancestor of Src and Abl, which are both significantly
affected by phosphorylation. Phosphorylation of the activation loop tyrosine in Src leads to a 5
fold increase in activity and phosphorylation of the activation loop tyrosine and tyrosine in the
35
linker in Abl leads to a 2.5 fold increase in activity (figure 19). Unphosphorylated Ancestor 103
has a rate of 3.8 ± 0.6 s-1, while phosphorylated Ancestor 103 has a rate of 5.2 ± 0.3 s-1. This is
roughly a 1.4 increase in activity upon phosphorylation, which is a smaller increase in activity
than is seen in both Src and Abl. This suggests that while phosphorylation may play a role in the
regulation of Anc 103, the effect of phosphorylation is not as strong. The unphosphorylated
mutant has a rate of 2.1 ± 1.0 s-1, which is about half the rate of the unphosphorylated wild type
Ancestor 103. When it is changed to a phenylalanine, its rate decreases.
In order to characterize the phosphorylation, we had to look at the activity of the YtoF
mutation in the activation loop. The rate the phosphorylated mutant Anc 103 is 2.0 ± 0.6 s-1,
which is nearly the same as the unphosphorylated mutant (figure 19). If this were not the case,
and another tyrosine residue was critical for the regulation of Ancestor 103, we would expect to
see similar rates of activity in the phosphorylated mutant and the phosphorylated wild-type. So,
this implies that the increase in activity seen in the phosphorylation of Anc 103 wild type is in
fact due to the phosphorylation of the activation loop tyrosine, and not other tyrosine residues.
36
Effect of C-terminal tail on Ancestors 86 and 103
As previously noted, Src contains a regulatory tail in the c-terminal. Y527 is in the tail,
and when phosphorylated, it binds to the SH2 domain, inactivating the kinase. While the
ancestors have the regulatory tail, they are lacking the key tyrosine residue that is important in
the negative regulation of the Src kinase family. Using SDM-PCR, we added this tyrosine
residue to the regulatory tail of ancestors 86 and 103, to see the effect this would have on
activity. We wanted to see if the SH2 domain had evolved yet to play a regulatory role and
interact with the phosphorylated c-terminal tail.
Figure 20: C-terminal tail negatively affects ancestor activity
b.
a.
c.
rate (s-1)
p86 + tail
0.64 ± 0.12
up86 + up/p
tail
86
2.7 ± 1.0 4.2
p103 + tail
up103 + tail
up/p 103
1.2 ± 0.2
6.9 ± 1.8
5.8
Figure 20: Conditions were as follows: 150 mM PEP, 20 units/mL PK, 29 units/mL LDH, 0.5
mg/mL NADH, 0.3 mg/mL BSA, pH 8, temp 25C, 5 mM ATP, 20 mM Mg, 50 mM Tris and 500
mM NaCl at pH 8 and 25°C. Both assays done with Anc 86 were done at 15 nM.
Unphosphorylated Anc 103 was at 15 nM, and phosphorylated Anc 103 was at 30 nM. a. Kinetic
assays done on Anc 86 with the added C-terminal tail. b. Kinetic assays done on Anc 103 with
the added C-terminal tail. c. Rate table with a summary of the rates. The tail has an inhibitory
37
effect on both Anc 86 and Anc 103, as indicated by the decreased rates of activity in the
phosphorylated proteins.
The phosphorylation of the C-terminal tail, by Csk, had an inhibitory effect on Ancestor
86 and Ancestor 103. For Src, the phosphorylation of Y527 in the tail leads to a 30 fold decrease
in activity as compared to the fully unphosphorylated wild type form. Unphosphorylated
Ancestor 86 had a rate of 2.5 ± 1.1 s-1, and unphosphorylated Ancestor 86 with the tail had a rate
of 2.7 ± 1.0, which is very similar. This suggests that the mutation did not affect the activity of
the unphosphorylated protein. Only upon phosphorylation did the tail interact with the SH2
domain and cause inhibition. When the tail is phosphorylated, there is a 4 fold decrease in
activity, which means that the SH2 domain would be regulated similar in Anc 86 were a cterminal tail present. In unphosphorylated Anc 103, when the C-terminal tail is added, the rate of
activity is 6.9 ± 1.8 s-1, compared to unphosphorylated wild-type Anc 103 which has a rate of
only 3.8 + 0.6 s-1. The tail increases the rate of this ancestor, when unphosphorylated. When the
tyrosine residue in the tail is phosphorylated, there is a 6 fold decrease in activity. This suggests
that the phosphorylated residue interacts with the SH2 domain, and docks it into a closed and
inactive confirmation.
38
CONCLUSIONS
Overall, what we see is that these kinases are not regulated by a simple on and off switch
between the active and inactive states. We propose an equilibrium in which the kinases can exist
in many different states along this equilibrium. The relative level of activity of the kinase,
measured by the kcat, depends on the population of the kinase that exists in each state of
equilibrium.
Figure 21: Src shows an equilibrium among states
Figure 21: Activity depends on what population exists in each state. There is an equilibrium
between the open and closed form of the kinase, and also another equilibrium that exists between
the open form and the form where the kinase domain is active but the SH2/SH3 domains are
inactive. Abl shows a similar equilibrium as well.
39
As kinases evolved, many different regulatory elements also evolved to help control kinases
at the molecular level. All of the ancestors that were studied, Anc 76, Anc 86, and Anc 103, were
active with catalytic rates comparable to those of modern enzymes. They can be
autophosphorylated –catalyzed by their own active site – and they can phosphorylate target
peptides. Autophosphorylation occurs at the activation loop tyrosine in all of the ancestors, as
well as in Src and Abl. The older ancestors appear to be not regulated by activation loop
phosphorylation, as indicated by the rates of product formation in the unphosphorylated and
phosphorylated enzymes. Ancestor 76 shows the same rates in the unphosphorylated and
phosphorylated state, while Src, a modern kinase, has a 5 fold increase in activity when the
activation loop tyrosine is phosphorylated. Anc 86, Anc 103, and Abl show increases in activity
of 2 fold, 1.4 fold, and 2 fold respectively. The increase in activity seen after phosphorylation in
Anc 86 and Anc 103 can be attributed to the phosphorylation of the activation loop tyrosine
specifically. This was seen as the phosphorylated Y to F mutants had similar levels of activity as
the unphosphorylated wild type kinases.
Ancestor 76, the oldest ancestor, has the highest activity in the unphosphorylated state, which
suggests that the older kinases may have been constitutively active. Anc 86 and Anc 103 have
progressively slower rates of activity in the unphosphorylated states, indicating that downregulation may have resulted from evolutionary pressures. The more modern enzymes, Src and
Abl, have even more complex regulation mechanisms, with many intermediate states of
phosphorylation and regulatory conformations. Src is regulated via negative and positive tyrosine
phosphorylation, as well as by the displacement of the regulatory SH2 and SH3 domains. Abl is
negatively regulated by the binding of the myristoyl group in the kinase domain, and positively
regulated by both the phosphorylation of two tyrosine residues and the displacement of the SH2
40
and SH3 domains. The same effect can be achieved by displacing the SH2 and SH3 domains
with binding peptides that out compete their affinity for the kinase domain.
As previously mentioned, Src is the only kinase discussed that can be negatively
regulated by phosphorylation – the phosphorylation of Y527 in the tail leads to a decrease in
kinase activity and a closed conformation. This regulatory tail is not seen in the ancestors, nor is
it seen in Abl. However, when the tail is added to the ancestors and the residue in the tail is
phosphorylated with Csk, it leads to inactivation of the kinase. This suggests that the regulatory
SH2 domains in Anc 86 and Anc 103 were already evolved to serve similar roles as they do in
Src. Abl is negatively regulated by the myristoyl group, which is a regulatory element that is not
seen in Src or any of the ancestors, again suggesting that this element evolved more recently.
In summary, we found that the modern enzymes have many levels of activation that are
controlled not only by phosphorylation but also by other regulatory elements. These complex
mechanisms have evolved over time – all the way from Ancestor 76, which is not regulated by
phosphorylation, to Abl, which is regulated by the phosphorylation of two tyrosine residues, as
well as two regulatory domains and another regulatory myristoyl group. We wanted to determine
methods by which to quantitatively measure the effects of different regulatory elements on these
kinases, and we were successful. We used autophosphorylation and analysis with Western Blot
allowed us to look at the phosphorylation of specific tyrosine residues, and characterize the
phosphorylation that was seen. The kinetic assays allowed us to quantitatively measure the rates
of activity in different states of the kinase with different regulatory elements.
41
FUTURE DIRECTIONS
Moving forward, we are going to use fluorescence resonance energy transfer (FRET) to
look at the conformational changes in the active and inactive states of the various kinases. We
will first look at Src, and then begin to examine Abl and the ancestors. Before using FRET we
first had to attach fluorescent tags in two regions of the protein. We used PCR to insert a loop
into the kinase domain of Src, which was recognized by transglutaminase. We labeled this loop
enzymatically, attaching a specific fluorescent label to that loop. We then removed the
endogenous cysteine residues the SH2/SH3 domains, and added one cysteine at the N terminal.
This was mixed with a maleimide-conjugated fluorescent dye Cy3B, to covalently bind the
fluorophore. The kinase domain and SH2/SH3 domains were then ligated using enzyme Sortase
A. From here, we are going to use FRET to examine the conformational ensemble in solution
under different conditions.
FRET relies on the absorption of a fluorophore at one wavelength, and the consequential
emission of fluorescence at a longer wavelength. The mechanism is such that a donor
fluorophore, in an excited state, can transfer energy to a nearby acceptor chromophore through
dipole-dipole interactions. In the inactive state, the two fluorophores will be close enough so that
an intramolecular energy transfer can occur. However, when the protein is induced to the active
state, the two fluorophores will be separated by a distance too far to participate in these
interactions. Energy transfer measurements can be used to estimate distances between various
sites on the kinase, and help us develop a better understanding of the conformational ensemble.
42
MATERIALS AND METHODS
ATP, NADH, PK/LDH, PEP, and IPTG were acquired from Sigma-Aldrich. Tris, MgCl,
NaCl, imidazole, and TCEP were acquired from Fisher. Buffers were made by dissolving the
crystal form to the desired concentration. Buffers were then filtered to ensure purity.
Protein Purification
Wild type Src, Abl, the ancestors and ancestral mutants were overexpressed and purified
as described (Agafonov 2014). Proteins were coexpressed in E. Coli with YopH phosphatase.
The cells were grown in the presence of 100 μg/mL kanamycin and 50 μg/mL streptomycin. We
first used a Talon affinity column for the histidine tagged proteins. The proteins were expressed
with a maltose binding protein (MBP) as well to increase solubility when expressed in E. Coli.
This fusion proteins binds to the amylose column and all other impurities flow through. The
protein comes off when the column is eluted with maltose. TEV protease is used to cleave both
the histidine tag and the MBP overnight. A HisTrap nickel column is used to separate the target
protein from the histidine tag and the MBP. The fragment with the histidine tag and MBP bind to
the nickel column, and the target protein is eluted with imidazole. Finally, an S100 size exclusion
column is used to ensure purity of sample. The buffers used during the purification were at pH 8.
Once purified and concentrated, the proteins were stored at -80°C with 1 mM TCEP.
Site-Directed Mutagenesis
The wild type ancestor plasmids were obtained and used as templates to generate mutants
with the Y to F mutation in the activation loop and kinase-SH2 domain in Abl, and to add a
43
regulatory Src tail. The primers were ordered from IDT and were then used to engineer
mutations via polymerase chain reaction. Cells were transformed into the DH5α strain of E. coli.
DNA was extracted using the Qiagen QIAprep Spin Miniprep Kit, and sequences were
confirmed at Genewiz.
Figure 22: Primers used in the polymerase chain reaction for each mutant
Mutant
Anc 76
Y328F
Anc 86
Y324F
Anc103
Y328F
Anc 86
+ Src
tail
Tm (°C)
Anc
103 +
Src tail
Abl
Y244F
Abl
Y412F
Primers
62.3
Forward: GCCTGCTGGATTTCCTGCGCAATAAG
Reverse: CTTATTGCGCAGGAAATCCAGCAGGC
60.9
Forward: GTCTGCTGGATTTTCTGCGCAATGG
Reverse: CCATTGCGCAGAAAATCCAGCAGAC
60.9
71.0
70.6
67.2
65.9
Forward: GTCTGCTGGATTTTCTGCGCAATGG
Reverse: CCATTGCGCAGAAAATCCAGCAGAC
Forward:CGAAGAAATTCATTCGAAACTGGAAAGCCTGTTCAAATCCACGGAA
CCGCAGTATCAACCGGGTGAAGAACTGTAAGGTACC
Reverse:GGTACCTTACAGTTCTTCACCCGGTTGATACTGCGGTTCCGTGGATT
TGAACAGGCTTTCCAGTTTCGAATGAATTTCTTCG
Forward:GCAAACTGGAAAGTATGTTTGCGTCAACGGAACCGCAGTATCAACC
GGGTGAAGAACTGTAAGGTACC
Reverse:GGTACCTTACAGTTCTTCACCCGGTTGATACTGCGGTTCCGTTGACG
CAAACATACTTTCCAGTTTGC
Forward: CGTAACAAACCGACCGTCTTTGGCGTGTCTCCG
Reverse: CGGAGACACGCCAAAGACGGTCGGTTTGTTACG
Forward: CGGGTGACACCTTTACGGCACACGC
Reverse: GCGTGTGCCGTAAAGGTGTCACCCG
Western Blots
We first autophosphorylated each protein, using the following conditions: buffer
contained 50mM Tris, 20 mM MgCl2, 500mM NaCl, 1mM TCEP and 5 mM ATP. For the
assays with Src and Abl, we also added 150 mM PEP, 9.4 units/mL PK and 13.5 units/mL LDH.
Src and Abl have unproductive hydrolysis of ATP, so these recycling enzymes were needed to
ensure that there was sufficient ATP. Enzyme concentration varied and is specified in the figure
legend of each blot. All reactions were carried out at 25°C. We quenched the reaction at each
time point by adding 10uL of denaturing buffer to 10uL of the reaction. We loaded 5uL of each
sample into a NuPAGE 4-12% 17 well Bis-Tris gel, and ran the gel at 200 V/200 mA for 35
44
minutes. We used eBlot to transfer the proteins from the gel onto a nitrocellulose membrane. For
Src and Abl we used a site-specific primary antibody and for the ancestors we used a general PTYR-1000 primary antibody, as phosphorylation had not yet been characterized. We developed
these blots with an NBT/BCIP solution and scanned and quantified the bands. For the rest of the
blots, we used a fluorescent secondary antibody (Alexa 546). We scanned and quantified these
based on their fluorescence.
Coupled Assay
As previously mentioned, PEP, PK/LDH, NADH and NADH were purchased from
Sigma-Aldrich. The reaction buffer contained 20 mM Mg, 50 mM Tris, 150 mM PEP, 20
units/mL PK, 29 units/mL LDH, 0.5 mg/mL NADH, 0.3 mg/mL BSA, 500 mM NaCl and 1mM
TCEP. The reaction was carried out at 25°C and pH 8. Enzyme concentration varied and is
specified in the figure legend of each assay. In this assay, pyruvate is converted to lactate by
LDH at the expense of NADH, and this use of NADH is monitored by its absorbance at 340 nm.
The absorbance at 340 nm represents the decrease of NADH, and indirectly shows ATP
hydrolysis (Kiianitsa 2003). From here we could calculate the kcat. The sequences for the binding
peptides and myristoyl group are below. Binding peptides and myristoyl group with an attached
binding peptide were added at saturating concentrations of 2 mM. The myristoyl group itself is
hydrophobic and insoluble, so the below binding peptide was attached.
a.
Peptide
Src peptide
SH2
SH3
Myristoylpeptide
b.
Sequence
EIYGEFKK
LVEF(pY)EEIKK
PPPPPPLPPR
MyristoylGQQPGKVLGDQR
Figure 23: a. Sequences of binding peptides used in the assay. b. Structure of myristoyl group.
45
High Pressure Liquid Chromatography
As a control for the rates we saw with the coupled assay, we also measured kinase
activities using High Pressure Liquid Chromatography (HPLC). We used a standard tyrosine
kinase peptide, with the same reaction conditions: 20mM Tris, 20 mM MgCl2, 5 mM ATP, 500
mM NaCl, 1mM TCEP and 0.05 µM protein, pH 8, 25C. At predetermined time points, 10 uL
aliquots were quenched with 10 uL of 6% TCA. Phosphorylated and unphosphorylated peptides
were separated through HPLC using a linear gradient of acetonitrile from 0 to 30% for 25 min.
The mobile phase contained 0.1% TFA. We quantified the amount of phosphorylated peptide
through peak integration.
Protein Phosphorylation for use in Kinetic Assays
After proteins had been autophosphorylated and we knew how long they took to become
fully phosphorylated, we could prepare them for use in the kinetic assays. We used the same
conditions used in the autophosphorylation experiments: buffer contained 20mM Tris, 20 mM
MgCl2, and 5 mM ATP, 1mM TCEP. For the assays with Src and Abl, we also added 150 mM
PEP, and 1.6 units PK, and 2.3 units LDH. Enzyme concentration was again varied. Proteins
were allowed to fully phosphorylate, and then nucleotides were removed using size exclusion
Zeba spin columns obtained from Fisher.
To phosphorylate Src at Y527, and Anc 86/Anc 103 + Src tail, we had to phosphorylate
with Csk. The conditions used were: 1 µM enzyme, 10 µM Csk, 150 mM PEP, 1.6 units PK, 2.3
units LDH, 20 mM Mg, 50 mM Tris5 mM ATP at pH 8 and 25°C. After phosphorylation was
complete, we allowed the protein to bind to a talon column, and then used filtration to remove
Csk. We again used Zeba spin columns to remove nucleotides.
46
REFERENCES
Agafonov RV, Wilson C, Otten R, Buosi V, Kern D. Energetic dissection of Gleevec’s
selectivity towards human tyrosine kinases. Nature structural & molecular biology.
2014;21(10):848-853.
Boggon TJ, Eck MJ. Structure and regulation of Src family kinases. Oncogene. 2004; 23, 7918–
7927.
Craig AW, Zirngibl R, Greer P. Disruption of coiled-coil domains in Fer protein-tyrosine kinase
abolishes trimerization but not kinase activation. J Biol Chem. 1999 Jul 9;274(28):19934-42
Dengjel J, Kratchmarova I, Blagoev B. Receptor tyrosine kinase signaling: a view from
quantitative proteomics. Molecular Biosystems. 2009 Oct;5(10):1112-21
Gan W, Roux B. Binding Specificity of SH2 Domains: Insight from Free Energy
Simulations. Proteins. 2009;74(4):996-1007.
Greer P. Closing in on the biological functions of fps/fes and fer. Nature Reviews Molecular Cell
Biology 3. 2002. 278-289
Groveman BR, Xue S, Marin V, et al. Roles of the SH2 and SH3 domains in the regulation of
neuronal Src kinase functions. The FEBS journal. 2011;278(4):643-653.
Hantschel O, Superti-Furga G. Mechanisms of Activation of Abl Family Kinases. In: Madame
Curie Bioscience Database [Internet]. Austin (TX): Landes Bioscience; 2000.
Hantschel O, Superti-Furga G. Mechanisms of Activation of Abl Family Kinases. In: Madame
Curie Bioscience Database [Internet]. Austin (TX): Landes Bioscience; 2000-2013.
Hantschel O, Superti-Furga G. Regulation of the c-Abl and Bcr–Abl tyrosine kinases. Nature
Reviews Molecular Cell Biology. January 2004; 5, 33-44.
Hantschel O. Structure, Regulation, Signaling, and Targeting of Abl Kinases in Cancer. Genes &
Cancer. May/June 2012 (3):5-6, 436-446
Heath RJW, Insall RH. F-BAR domains: multifunctional regulators of membrane curvature.
Journal of Cell Science. 2008. 121: 1951-1954.
Howell BW, Cooper JA. Csk suppression of Src involves movement of Csk to sites of Src
activity. Molecular and Cellular Biology. 1994;14(8):5402-5411.
Joseph RE, Andreotti AH. Controlling the activity of the Tec kinase Itk by mutation of the
phenylalanine gatekeeper residue. Biochemistry. 2011;50(2):221-229.
Joseph RE, Fulton DB, Andreotti AH. Mechanism and functional significance of Itk
autophosphorylation. Journal of molecular biology. 2007;373(5):1281-1292.
47
Kiianitsa K, Solinger JA, Heyer WD. NADH-coupled microplate photometric assay for kinetic
studies of ATP-hydrolyzing enzymes with low and high specific activities. Anal Biochem. 2003
Oct 15;321(2):266-71.
McPherson VA, Everingham S, Karisch R, et al. Contributions of F-BAR and SH2 Domains of
Fes Protein Tyrosine Kinase for Coupling to the FcɛRI Pathway in Mast Cells. Molecular and
Cellular Biology. 2009;29(2):389-401.
Nagar B, Hantschel O, Seeliger M, Davies JM, Weis WI, Superti-Furga G, Kuriyan J.
Organization of the SH3-SH2 unit in active and inactive forms of the c-Abltyrosine kinase. Mol
Cell. 2006 Mar 17;21(6):787-98.
Okada M. Regulation of the Src Family Kinases by Csk. Int J Biol Sci 2012; 8(10):1385-1397.
Okoh MP, Vihinen M. Pleckstrin homology domains of tec family protein kinases. Biochem
Biophys Res Commun. 1999 Nov;265(1):151-7.
Osusky M, Taylor SJ, Shalloway D. Autophosphorylation of purified c-Src at
its primary negative regulation site. J Biol Chem. 1995 Oct 27;270(43):25729-32
Panjarian S, Iacob RE, Chen S, Engen JR, Smithgall TE. Structure and Dynamic Regulation of
Abl Kinases. The Journal of Biological Chemistry. 2013;288(8):5443-5450.
Roskoski R. Src kinase regulation by phosphorylation and desphosphorylation. Biochem Biophys
Res Commun. 2005 May 27;331(1):1-14.
Rososki R. Src protein-tyrosine kinase structure, mechanism, and small molecule inhibitors.
Pharmacological Research. Apr 2015. 94: 9-25. Review.
Rososki R. Src protein–tyrosine kinase structure and regulation. Biochemical and Biophysical
Research Communications. 2004 Nov 26;4(26): 115-1164.
Shukla D, Meng Y, Roux B, Pande VS. Activation pathway of Src kinase reveals intermediate
states as targets for drug design. Nature Communications. 2014: 5(3397).
Srinivasan D, Kaetzel DM, Plattner R. Reciprocal Regulation of Abl and Receptor Tyrosine
Kinases. Cellular Signalling. 2009;21(7):1143-1150.
Tanis KQ, Veach D, Duewel HS, Bornmann WG, Koleske AJ. Two Distinct Phosphorylation
Pathways Have Additive Effects on Abl Family Kinase Activation. Molecular and Cellular
Biology. 2003;23(11):3884-3896.
Xu W, Doshi A, Lei M, Eck MJ, Harrison SC. Crystal Structures of c-Src Reveal Features of Its
Autoinhibitory Mechanism. Molecular Cell. May 1999; 3(5), 629-638.
48