From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
HEMATOPOIESIS
Dynamic reorganization of chromatin structure and selective DNA demethylation
prior to stable enhancer complex formation during differentiation of primary
hematopoietic cells in vitro
Hiromi Tagoh, Svitlana Melnik, Pascal Lefevre, Suyinn Chong, Arthur D. Riggs, and Constanze Bonifer
In order to gain insights in the true molecular mechanisms involved in cell fate
decisions, it is important to study the
molecular details of gene activation where
such decisions occur, which is at the
level of the chromatin structure of individual genes. In the study presented here
we addressed this issue and examined
the dynamic development of an active
chromatin structure at the chicken lysozyme locus during the differentiation of
primary myeloid cells from transgenic
mouse bone marrow. Using in vivo footprinting we found that stable enhancer
complex assembly and high-level gene
expression are late events in cell differentiation. However, even before the onset of
gene expression and stable transcription
factor binding, specific chromatin alterations are observed. This includes
changes in DNA topology and the selective demethylation of CpG dinucleotides
located in the cores of critical transcription factor binding sites, but not in flanking DNA. These results firmly support the
idea that epigenetic programs guiding
blood cell differentiation are engraved
into the chromatin of lineage-specific
genes and that such chromatin changes
are implemented before cell lineage specification. (Blood. 2004;103:2950-2955)
© 2004 by The American Society of Hematology
Introduction
Hematopoietic cells arise from pluripotent hematopoietic stem
cells (HSCs) in the bone marrow and develop via different types
of precursor cells, which become progressively committed to
the different branches of the blood cell system. Such specialization is based on cell fate decisions ultimately leading to the
coordinated and regulated expression of cell-type– and cellstage–specific genetic programs. However, a number of experiments have indicated that the presence of specific mRNA
molecules is only the end point of a cascade of differentiation
decisions. A vast body of evidence from genetic studies
demonstrates that genes encoding for chromatin components or
chromatin modification factors play essential roles in all phases
of the development of multicellular organisms. At individual
genes these epigenetic regulatory proteins are recruited by
sequence-specific transcription factors and influence the transcriptional status and the accessibility to the transcription
machinery by altering chromatin structure and the spectrum of
biochemical tags attached to individual chromatin components.1,2 To address these processes at the molecular level and to
identify the order of events taking place during the developmentally controlled activation of genes, we are studying the
regulation of chromatin structure of genes expressed in the
myeloid lineage of the hematopoietic system. One of them is the
chicken lysozyme locus (clys). clys expression in myeloid cells
is controlled by at least 5 cis-regulatory elements. Three
enhancers situated 6.1 kb, 3.9 kb, and 2.7 kb upstream of the
transcription start site, a silencer element at ⫺2.4 kb, and a
complex promoter have been identified.3 All active cisregulatory elements colocalize with DNaseI hypersensitive sites
(DHSs) in chromatin4-6 (Figure 1). Experiments in transgenic
mice have shown that transcription of the lysozyme gene is
already active in granulocyte-macrophage precursors (CFUGMs).7 Lysozyme expression is strongly responsive to inflammatory stimuli such as bacterial lipopolysaccharide (LPS) which
up-regulates lysozyme mRNA expression up to 20-fold from a
low basal level.8
Using retrovirally transformed chicken cell lines representing
defined stages of macrophage differentiation,9 we have recently
presented evidence that chromatin reorganization of clys starts
early in development prior to the onset of gene expression. Using
UV-photofootprinting, which identifies changes in DNA topology
caused by the interaction with proteins,10 we detected the formation
of a chromatin fine structure characteristic for lysozyme-expressing
macrophages in multipotent myeloid precursor cell lines. This was
independent of the stable binding of end-stage transcription factors
and actual gene expression,11 indicating that already early in
hematopoietic development, lineage-specific chromatin remodelling events take place. Later chromatin immunoprecipitation
experiments indeed showed that in the same multipotent precursor
cell lines lysozyme chromatin is partially accessible, as we found
evidence for a transient interaction of transcription factors with
lysozyme chromatin.12
From the Molecular Medicine Unit, University of Leeds, St James’s University
Hospital, United Kingdom, and the Department of Biology, Beckman Institute of
City of Hope, Duarte, CA.
H.T. and S.M. contributed equally to this study.
Submitted October 7, 2003; accepted November 30, 2003. Prepublished online
as Blood First Edition Paper, December 18, 2003; DOI 10.1182/blood-2003-093323.
Supported by grants from the Wellcome Trust, the Biochemical
Biotechnological Sciences Research Council (BBSRC), the Leukaemia
Research Fund, and the City of Hope Medical Center.
2950
Reprints: Constanze Bonifer, Molecular Medicine Unit, Clinical Sciences
Building, St James’s University Hospital, Leeds LS9 7TF, United Kingdom; email: [email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2004 by The American Society of Hematology
BLOOD, 15 APRIL 2004 䡠 VOLUME 103, NUMBER 8
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 15 APRIL 2004 䡠 VOLUME 103, NUMBER 8
DEVELOPMENT OF ACTIVE CHROMATIN STRUCTURE
2951
Materials and methods
Precursor cell purification and cell culture
Myeloid precursor cells from the bone marrow of chicken lysozyme
transgenic mice were purified by cell sorting and cultured exactly as
previously described.14 Embryonic stem (ES) cells carrying the chicken
lysozyme knock-in construct inserted into the mouse HPRT locus were
grown on Sto-feeder cells as described.15 B cells were sorted from the
spleen of chicken lysozyme transgenic mice after myeloid lineage depletion
and staining with an antibody against CD19. Freshly isolated embryonic
fibroblasts from transgenic mice were prepared as described.16
Real-time PCR
Figure 1. Experimental outline. (A) Map of the chicken lysozyme locus (⫹10 kb
to ⫺10 kb relative to the transcription start) and its position in the mouse
X-chromosome. The clys and the gas41 gene in the transgene are indicated as
white boxes. The direction of transcription is depicted as a horizontal arrow.
DNaseI hypersensitive sites (DHS) observed in macrophages are indicated as
vertical arrows, with black arrows indicating the position of cis-regulatory
elements. Cis-elements are depicted as gray boxes, with E standing for enhancer.
(B) Schematic outline of macrophage differentiation. (C) Experimental strategy.
However, all studies with precursor cell lines representing
fixed differentiation stages have significant limitations. In
addition to their transformed state such cells may have accumulated epigenetic alterations in culture. Furthermore, they do
not permit the examination of dynamic alterations at the
chromatin of specific genes during the process of their transcriptional activation in development. To be able to study these
events in primary cells we used gene targeting to generate mice
carrying a single copy of the chicken lysozyme locus inserted
into the hypoxanthine-phosphoribosyl-transferase (HPRT)–
locus13 and established an in vitro differentiation system for
macrophage maturation based on purified multipotent precursor
cells from transgenic mouse bone marrow.14 In the study
presented here we used these models to assay the dynamics of
DNA demethylation, chromatin fine structure alterations, and
transcription factor occupancy at clys cis-regulatory elements.
Our results show that a high level of gene expression and
complete enhancer complex assembly are only found at late
differentiation stages. However, this is preceded by chromatin
alterations that are complete before the activation of gene
expression. In addition, specific methylated CpG dinucleotides
at cis-regulatory elements are demethylated with different
kinetics. These results firmly support the idea that a lineagespecific chromatin structure is already in place prior to the onset
of gene expression and before cell lineage specification.
Total RNA was prepared using Trizol (Invitrogen, Hasley, United Kingdom)
according to the manufacturer’s instructions, and genomic DNA was removed by
DNaseI treatment. First-strand cDNA synthesis from RNA samples was carried
out using oligo (dT)15 primer and Moloney murine leukemia virus reverse
transcriptase (Invitrogen) in a reaction volume of 20 ␮L. cDNA was amplified
with real-time quantitative polymerase chain reaction (PCR; ABI Prism 7700
sequence detection system; Perkin Elmer, Shelton, CT) with SYBR Green using
a real-time PCR kit (Applied Biosystems, Weiterstadt, Germany). Glyceraldehyde3-phosphate dehydrogenase (GAPDH)–specific primers were used for internal
control PCR and all gene-specific signals were normalized to this value. Primer
sequences were as follows: mouse GAPDH (GAPDH): forward 5⬘-ACCTGCCAAGTATGATGACATCA and reverse 5⬘-GGTCCTCAGTGTAGCCCAAGAT; chicken lysozyme (c-lys): forward 5⬘-CGACTACGGAATCCTACAGATCAA and reverse 5⬘-CTTAAGCACGGGATGTTGCA; mouse c-fms: forward
5⬘-CCAGATCTCCTGCGTTGATTTC and reverse 5⬘-CCACAGACACCTCCTGCAAGA.
In vivo footprinting analysis
In vivo dimethyl sulphate (DMS) and UV footprinting with the different
cell types and during in vitro differentiation were performed exactly as
described.14 Alterations in G(N7) DMS reactivity were visualized by
ligation mediated (LM)–PCR, and alterations in UV dimer formation were
examined by terminal transferase-dependent (TD)–PCR. In both cases the
following primers were used: promoter (upper strand): P1: 5⬘-GACCTCATGTTGCCAGTGTCG; P2: 5⬘-CAGTGTCGTACACACAGCGGG; P3: 5⬘ACACACAGCGGGACTGCAAGC; ⫺3.9 enhancer (upper strand): D376:
5⬘-GAGCTACACAACCCTTCAGC; D376A: 5⬘-CAGCTGTCTCTCCCTTGATGG; D376B: 5⬘-GATGGCAGCCTGCCCCACAAG; ⫺6.1 enhancer
(lower strand): U6.1E1: 5⬘-TACCGAGGAACAAAGGAAGGCT; U6.1E2:
5⬘-TTTAGAGAACTGGCAAGCTGT; U6.1E3: 5⬘-GAACTGGCAAGCTGTCAAAAAC.
LM-PCR–generated bands from radioactive sequencing gels were
quantified on a Molecular Imager FX (Bio-Rad, Hercules, CA). TD-PCR
samples were run on a LI-COR sequencer (Li-Cor, Lincoln, NE), and
quantification of band intensity on digitized data was done as described.11
DNA modification with bisulfite and PCR amplification
Bisulfite treatment for DNA methylation analysis was performed exactly as
published previously.17 Primers were designed to be complementary to the
upper and lower strands after modification. Primer sequences are available
on request. PCR products were sequenced and signals corresponding to T
and unmodified C were analyzed and quantified using a CEQ 8000
sequencer (Beckman Coulter, Hialeah, FL).
Results
The clys locus harbors 2 differentially expressed gene loci: clys and
cgas41, both of which reside in the same domain of general DNaseI
sensitivity.18,19 Figure 1A depicts the position of the transgenic
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2952
TAGOH et al
BLOOD, 15 APRIL 2004 䡠 VOLUME 103, NUMBER 8
Figure 2. Expression of the chicken lysozyme transgene and the endogenous c-fms gene during macrophage differentiation. Total RNA was prepared from
cells at the indicated days of differentiation and relative
mRNA levels were measured by real-time PCR with
primers specific for GAPDH as an internal control and
clys- and c-fms–specific primers. Transgenic mouse ES
cells and embryonic fibroblasts served as a negative
control. (A) Chicken lysozyme transgene. (B) Endogenous c-fms gene. The values represent the means and
standard deviations of 5 independent experiments.
lysozyme locus within the X-linked mouse HPRT locus.13 Macrophages generated from the bone marrow of male and female
transgenic mice faithfully expressed the gene in a myeloid-specific
and lipopolysaccharide (LPS)–inducible fashion and in male mice
displayed the same pattern of transcription factor site occupancy as
the endogenous gene in chicken cells.11-13
We previously demonstrated clys expression in mouse CFU-GM
cells,7 but had no information about earlier myeloid developmental
stages. To address this issue we studied dynamic changes of clys
chromatin structure during myeloid precursor maturation in vitro.14
The experimental strategy is outlined in Figure 1B-C. Following
purification of common myeloid progenitor cells (CMPs)20 from
the bone marrow of male transgenic mice, cells were cultured in
differentiation medium for up to 9 days, followed by an overnight
stimulation with LPS. Cells cultured this way progressed through
the different macrophage differentiation stages outlined in Figure
1B as a homogenous population displaying distinct and dynamic
alterations of morphology, surface marker, and marker gene
expression.14 Purified cells at day 0 were small blast cells,
expressed a high level of c-kit, did not express detectable macrophage–colony-stimulating factor (M-CSF) receptor on their surface
and expressed a high level of the CD31 (PECAM-1) surface
marker, which is recognized by the ER-MP12 antibody.21 In
differentiation medium, these cells immediately started to proliferate and at day 2 of differentiation, developed into nonadherent
CFU-GMs that started to express a high level of M-CSF receptor.
At day 4, cells differentiated into monocytic cells, had lost the
expression of CD31, and started to down-regulate M-CSF receptor
expression. From day 7 onward, cells displayed macrophage
morphology and had lost the expression of monocytic markers.
Aliquots of differentiating cells were taken at regular intervals to
measure mRNA expression, transcription factor occupancy, DNA
topology, and DNA methylation.
Figure 2A depicts the analysis of clys mRNA expression during in
vitro differentiation as measured by real-time PCR. Mouse ES cells
carrying the clys knock-in construct and transgenic embryonic fibroblasts served as lysozyme nonexpressing negative control cells. As an
additional control, we measured expression of the endogenous c-fms
Figure 3. Stable transcription factor complex formation and high-level clys gene expression are late events in macrophage differentiation. (A) In vivo DMS
footprinting experiment analyzing transcription factor occupancy during in vitro differentiation (day 0 to day 9 and after LPS stimulation of day-9 cells) at clys cis-regulatory
elements and the c-fms promoter as indicated. G indicates DMS-treated naked genomic DNA; ES, DNA prepared from lysozyme nonexpressing transgenic mouse ES cells.
The nature and the position of transcription factor binding sites are indicated. Protection from methylation at G(N7) is indicated as a white circle, enhancement of DMS reactivity
is indicated as a black circle, and weak enhancement is indicated as a gray circle. (B) Quantification of signals from selected bands (indicated by asterisks) of the gels depicted
in panel A. The numbers represent the mean values and standard deviations of quantifications from 2 independent experiments and 2 separate gels, respectively.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 15 APRIL 2004 䡠 VOLUME 103, NUMBER 8
gene, which encodes the M-CSF receptor. We have previously shown
that this gene is already active in CMPs and its promoter is already
occupied by transcription factors.14 This expression pattern was reproduced with the precursor cells purified from chicken lysozyme transgenic mice (Figure 2B). The pattern of clys mRNA expression followed
an entirely different time course (Figure 2A). No or little clys mRNA
could be detected in CMPs. Significant expression was first detected at
day 2 of differentiation at the CFU-GM stage. The same result was
obtained with the endogenous mouse lysozyme gene7,14 (data not
shown). Between day 2 and day 3 of differentiation cells still proliferated as nonadherent blast cells; thereafter they became adherent, but clys
mRNA levels did not change. A high level of clys mRNA expression
could only be detected after LPS stimulation at day 9 of differentiation.
In order to determine at which stage of in vitro differentiation stable
transcription factor complexes were formed at lysozyme cis-elements,
we measured transcription factor occupancy at the ⫺6.1 kb enhancer,
the ⫺3.9 kb enhancer, and the promoter by in vivo DMS footprinting
(Figure 3A) and quantified alterations in DMS reactivity at G(N7)
residues (Figure 3B). The identity of transcription factors binding to
these elements had been previously confirmed by chromatin immunoprecipitation assays12 and we have shown that the 3 cis-elements are
necessary and sufficient to activate clys expression at the correct
developmental stage in transgenic mice.7 For comparison, we also
measured transcription factor occupancy at the c-fms promoter. DMStreated naked DNA and mouse ES cells carrying the clys knock-in
construct served as controls.
No alterations of DMS reactivity as compared with naked DNA
were observed with ES cells (Figure 3A) and transgenic embryonic
fibroblasts (data not shown). At the c-fms promoter (Figure 3A,
right panel) the central PU.1 site was fully occupied even when
c-fms expression levels were low (Figure 3A-B) as measured by a
DMS hyperreactivity of G ⫺130 bp and a protection of the
downstream guanine residue from DMS modification. Again, clys
behaved differently (Figure 3A-B). Quantification of relevant
bands showed that complete transcription factor complex assembly
as indicated by full protection of relevant G(N7) contacts from
methylation was only observed at day 9 of in vitro differentiation
(see, for example, the G residues at ⫺5996 bp [the quantification of
this band is depicted in Figure 3B]). For the examination of
transcription factor occupancy at early time-points of in vitro
differentiation, the quantification of signals from strongly hyperreactive G(N7) residues at the central nuclear factor 1 (NF1) site at
the ⫺6.1 kb enhancer (⫺5988 bp) and the ⫺105 bp CAATenhancer binding protein beta (1C/EBP␤) site at the promoter
proved to be more conclusive (Figure 3B). In both cases, we saw a
slight but reproducible increase in DMS hyperreactivity as early as
day 0 (Figure 3A, enlarged picture), which further increased
parallel to the onset of gene expression at day 2. However, signals
seen between day 2 and day 4 differentiation stayed low. Very little
difference in transcription factor occupancy was seen between
nonstimulated and LPS-stimulated cells, although mRNA expression levels varied dramatically. In the mouse, the only exception
was the C/EBP␤ site at ⫺105 bp, where DMS reactivity was
somewhat increased after LPS treatment and a downstream Sp1
site, which was only occupied in LPS-treated cells.
To further examine this developmental model, we examined
chromatin structure at clys cis-regulatory elements at different
differentiation stages by UV photofootprinting and TD-PCR.10 UV
footprinting predominately detects UV dimers at pyrimidine sites
and UV-dimer formation is modulated by chromatin-mediated
alterations of DNA topology.. Here we used UV-treated naked
DNA and freshly isolated embryonic fibroblasts (EFs) from the
DEVELOPMENT OF ACTIVE CHROMATIN STRUCTURE
2953
transgenic mice as a control. Figure 4A-B depicts 2 experiments
examining the frequency of UV-dimer formation at the clys
promoter and the ⫺6.1 kb enhancer, respectively. It is apparent just
by visual inspection that there is little change between day-0 and
day-9 samples, indicating little change in chromatin fine structure
as in vitro differentiation proceeds. The only clear difference is
between naked DNA and control cells (compare lanes N and EF
with lane 0, respectively) whereby all control cells (including ES
cells, data not shown) generated patterns very similar to naked
DNA. This was substantiated by quantification of individual bands
from the gel depicted in Figure 4B and plotting for each nucleotide
position the ratio between band intensity observed with the
different cell types and naked DNA (Figure 4C). The main
difference clearly is between embryonic fibroblasts (lane M) and
the D0 to D9 stages. In summary, a specific DNA reactivity pattern,
Figure 4. Chromatin fine structure at the chicken lysozyme locus is reorganized
prior to the onset of gene expression and the formation of stable transcription
factor complexes. (A) UV photofootprinting experiment examining alterations in
UV-dimer formation frequency with the clys promoter. The gels shown are representative of 2 independent experiments and 2 separate gels, respectively. G indicates
DMS-treated naked genomic DNA; N, UV-treated naked genomic DNA; and EF,
freshly prepared embryonic fibroblasts from transgenic mice. (B) UV photofootprinting of the ⫺6.1 kb enhancer. The gels shown are representative of 2 independent
experiments and 2 separate amplifications, respectively. (C) Quantification of bands
from the gel depicted in panel B. The band intensity at each nucleotide position was
divided by the band intensity of naked DNA and the ratio plotted as described
previously.11 The nature and the position of transcription factor binding sites are
indicated. The asterisk marks the position of extensive alterations in UV-dimer
formation in differentiating cells as compared to naked DNA and EFs.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2954
TAGOH et al
which is indicative of a distinct chromatin structure, is already
established in precursor cells.
Methylation of CpGs is vital for the maintenance of silent chromatin
states via the recruitment of repressive chromatin modification complexes to methylated DNA.22 Although demethylation alone is not
sufficient to activate gene expression,23 many transcription factors are
unable to bind to their recognition sequences if these contain methylated
CpGs. Consequently, the activation of a gene in development requires
the removal of such methyl groups. In order to obtain information about
the time-course of this process we measured the extent of CpG
methylation by quantitative bisulphite sequencing of DNA isolated from
in vitro–differentiated cells within the 3 different CpGs present at the
⫺3.9 kb enhancer (Figure 5). CpG1 is located upstream of any known
transcription factor binding site in the ⫺3.9 kb enhancer, CpG2 is
directly upstream of a functional in vivo C/EBP␤ site, and CpG3 is part
of a functional in vivo binding site for the ets-transcription factor Fli-1
(Figure 5A).12 Transgenic ES cells served as control. However, as these
ES cells had been in culture for some time and could have accumulated
aberrant methylation patterns, we also assayed purified B cells and
freshly isolated embryonic fibroblasts from transgenic mice.
Figure 5B shows that the 3 CpG sites were demethylated with
significantly different kinetics. CpG1 was as highly methylated as
in control cells up to day 4, and was only fully demethylated at day
9 of in vitro differentiation. CpG2 was already partially demethylated at day 0 and became demethylated from day 4 onward. In
contrast to the control cells, the CpG at the Fli-1 binding site
(CpG3) was not methylated at all in any of the myeloid cell types
tested. A similar result was observed with a CpG located within the
distal Sp1 binding site in the promoter (data not shown). Control
experiments examining CpG methylation at the alpha-fetoprotein
gene, which is only active in fetal liver cells, showed that this gene
was fully methylated in these cells at day 9 (data not shown). Taken
together, our experiments show that although there is no stable
enhancer and promoter complex formation in CMPs and no or little
mRNA is expressed, chromatin is already fully reorganized and
specific CpGs are already completely demethylated.
Discussion
Although c-fms and clys are both expressed in macrophages, they
belong to 2 different categories of hematopoietic genes. A low level
of c-fms mRNA expression is detected already in HSCs,24 which is
BLOOD, 15 APRIL 2004 䡠 VOLUME 103, NUMBER 8
selectively up-regulated in macrophage cells14 and expression is
switched off in nonmacrophage cells. In contrast, clys mRNA
expression was not detected before the CFU-GM stage. In addition,
although already detectable in CFU-GMs, clys mRNA expression
remained low and was only maximal in LPS-stimulated macrophage cells. The same was observed at the level of transcription
factor occupancy. Few or no transcription factor complexes were
formed at clys between day 2 and day 4 of in vitro differentiation.
These results could be interpreted in 2 ways. It could be possible
that only a few mature cells within the differentiating population
have stable transcription factors assembled on cis-regulatory
elements or, alternatively, that transcription factor complex formation and the assembly of the transcription machinery are dynamic
and are only stabilized in all cells in mature, adherent macrophages.
We favor the latter explanation, as cells synchronously differentiate
and proliferate as a homogenous population displaying coordinated
changes in surface marker expression and significant numbers of
adherent cells are only seen after day 4 of differentiation.14 This
notion is also supported by our observation that full demethylation
of CpGs was only observed at late differentiation stages. In
addition, the c-fms intronic enhancer, in contrast to the clys
cis-elements, displays a dynamic assembly and disassembly of
transcription factor complexes during in vivo differentiation, with
assembly being maximal around day 4 of macrophage maturation14
(and data not shown).
Based on the finding that the central CpG within the core of
important transcription factor binding sites (Fli-1 and Sp1) were
demethylated very early in development while methyl groups at
surrounding CpGs disappeared with much slower kinetics, we infer
that the transcription factors binding to these sites could be
involved in this process. At first sight this was puzzling, as we did
not see stable binding of transcription factors in our in vivo
footprinting experiments. However, chromatin immunoprecipitation experiments with precursor cell lines showed transient binding
of transcription factors to clys chromatin.12 Experiments performed
by others have observed that the interaction of high-affinity DNA
binding proteins with DNA can lead to the progressive demethylation of CpG sequences,25 possibly by interfering with de novo
methylation during replication. Although binding of Sp1 is not
inhibited by cytosine methylation,26 it has been noted that the
presence of functional binding sites for this transcription factor is
required for the prevention of CpG island methylation.27 A
Figure 5. CpGs at the ⴚ3.9 kb enhancer are demethylated with different kinetics during in vitro differentiation. Genomic DNA prepared from ES cells, freshly
prepared mouse embryonic fibroblasts (EFs), and purified B cells from transgenic mice as well as from cells
undergoing differentiation, was subjected to quantitative
bisulfite sequencing as outlined in “Materials and methods.” (A) Sequence of the ⫺3.9 kb enhancer and position
of CpGs. (B) CpG methylation level in the different cells
as indicated.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
BLOOD, 15 APRIL 2004 䡠 VOLUME 103, NUMBER 8
DEVELOPMENT OF ACTIVE CHROMATIN STRUCTURE
possible important role of DNA demethylation for clys activation is suggested by our previous experiments. These demonstrated that the Fli-1 binding site is essential for the activity of
the ⫺3.9 kb enhancer,28 that it interacts with the ⫺3.9 kb
enhancer element in vivo,12 and most important, that binding of
Fli-1 is completely inhibited when the central CpG is methylated12 (and data not shown).
The studies described here put a mechanistic foundation under a
number of observations demonstrating that pluripotent tissuespecific precursor cells show lineage-promiscuous low-level gene
expression24,29-31 and add to this notion that epigenetic programs
are engraved into the chromatin of lineage-specific genes before
cell lineage specification and the onset of detectable gene expression. Our results presented here and published previously11,12 point
to a potential mechanism for how this could occur and point to clear
experimental avenues to follow. We hypothesize that gradual
changes in the expression of sequence-specific transcription factors
lead to a transient association of such transcription factors with
their recognition sequence, possibly after DNA synthesis. The fact
that the balance and the level of transcription factors can influence
cell fate decisions in precursor cells prior to the onset of
expression of many lineage-specific genes agrees with this idea
(for a comprehensive review of such experiments see Zhu and
Emerson32 and references therein). These factors could recruit
2955
chromatin modification complexes and prevent maintenance
CpG methylation or induce active demethylation, and generate a
chromatin structure, which sets the stage for the formation of
stable enhancer complexes that drive transcription. The nature
of the differentiation-specific events that trigger the formation
of such complexes in the lysozyme locus is not yet clear. With
transformed cell lines we observed distinct locus-wide histone
modification events and recruitment of chromatin modification
activities, but only after stable transcription factor complex
formation in mature macrophages.12 However, stable recruitment of transcription factors to most clys cis-regulatory elements is not by itself sufficient to support high-level transcription; this is only seen in LPS-treated cells.
In summary, gene locus activation in development is a process
that begins at the level of chromatin many cell generations before
lineage specification. The developmental stage at which mRNA
synthesis occurs may be regulated by external signals and can be
different for every gene.
Acknowledgments
The authors thank E. Straszinsky for help with cell sorting and
Peter Cockerill for critical comments on the manuscript.
References
1. Georgopoulos K. Haematopoietic cell-fate decisions, chromatin regulation and Ikaros. Nat Rev
Immunol. 2002;2:162-174.
2. Fisher AG. Cellular identity and lineage choice.
Nat Rev Immunol. 2002;2:977-982.
regulated gene locus: reorganization of chromatin
structure before trans-activator binding and activation of gene expression. Genes & Dev. 2000;
14:2106-2122.
22.
3. Bonifer C, Jägle U, Huber MC. The chicken lysozyme locus as a paradigm for the complex
regulation of eucaryotic gene loci. J Biol Chem.
1997;272:26075-26078.
12. Lefevre P, Melnik S, Wilson N, Riggs AD, Bonifer
C. Developmentally regulated recruitment of transcription factors and chromatin remodelling activities to chicken lysozyme cis-regulatory elements
in vivo. Mol Cell Biol. 2003;23:4386-4400.
4. Fritton HP, Igo-Kemenes T, Nowock J, StrechJurk U, Theisen M, Sippel AE. Alternative sets of
DNase I-hypersensitive sites characterize the
various functional states of the chicken lysozyme
gene. Nature. 1984;311:163-165.
13. Chong S, Kontaraki J, Bonifer C, Riggs AD. Silencing of genes in the 21.3 kb chicken lysozyme
domain on the inactive X chromosome correlates
with methylation of a CpG island. Mol Cell Biol.
2002b;22:4667-4676.
5. Fritton HP, Igo-Kemenes T, Nowock J, StrechJurk U, Theisen M, Sippel AE. DNase I-hypersensitive sites in the chromatin structure of the lysozyme gene in steroid hormone target and nontarget cells. Biol Chem. 1987;368:111-119.
14. Tagoh H, Himes R, Clarke D, et al. Transcription
factor complex formation and chromatin fine
structure alterations at the murine c-fms (CSF-1
receptor) locus early myeloid precursor maturation. Genes & Dev. 2002;16:1721-1737.
6. Huber M, Graf T, Sippel AE, Bonifer C. Dynamic
changes in the chromatin of the chicken lysozyme gene domain during differentiation of
multipotent progenitors to macrophages. DNA
and Cell Biol. 1995;5:397-402.
15. Faust N, Bonifer C, Wiles M, Sippel AE. An in
vitro differentiation system for the examination of
transgene activation in mouse macrophages.
DNA and Cell Biol. 1994;13:901-907.
26.
16. Huber M, Bosch FX, Sippel AE, Bonifer C. Chromosomal position effects in chicken lysozyme
transgenic mice correlate with suppression of active chromatin formation. Nucl Acids Res. 1994;
22:4195-4201.
27.
7. Jägle U, Müller AM, Kohler H, Bonifer C. Role of
positive and negative cis-regulatory elements regions in the regulation of transcriptional activation
of the lysozyme locus in developing macrophages of transgenic mice. J Biol Chem. 1997;
272:5871-5879.
8. Goethe R, Phi van L. The far upstream chicken
lysozyme enhancer at ⫺6.1 kilobase, by interacting with NF-M, mediates lipopolysaccharide-induced expression of the chicken lysozyme gene
in chicken myelomonocytic cells. J Biol Chem.
1994;269:31302-31309.
9. Graf T, McNagny K, Brady G, Frampton J. Chicken
“erythroid” cells transformed by the Gag-Myb-Etsencoding E26 leukemia virus are multipotent. Cell.
1992;70:201-213.
10. Komura J, Riggs AD. Terminal transferase-dependent PCR: a versatile and sensitive method
for in vivo footprinting and detection of DNA adducts. Nucleic Acids Res. 1997;26:1807-1811.
11. Kontaraki J, Chen HH, Riggs A, Bonifer C. Chromatin fine structure profiles for a developmentally
17. Thomassin H, Oakeley EJ, Grange T. Identification of 5-methylcytosine in complex genomes.
Methods. 1999;19:465-475.
18. Jantzen K, Fritton HP, Igo-Kemenes T. The
DNase I sensitive domain of the chicken lysozyme gene spans 24 kb. Nucleic Acids Res.
1986;14:6085-6099.
23.
24.
25.
28.
29.
19. Chong S, Riggs AD, Bonifer C. The chicken lysozyme chromatin domain contains a second,
widely expressed gene. Nucleic Acids Res.
2002a;30:463-467.
30.
20. Akashi K, Traver D, Miyamoto T, Weissman IL. A
clonogenic common myeloid progenitor that gives
rise to all myeloid lineages. Nature. 2000;404:
193-197.
31.
21. Ling V, Luxenberg D, Wang J, et al. Structural
identification of the hematopoietic progenitor antigen ER-MP12 as the vascular endothelial adhe-
32.
sion molecule PECAM-1 (CD31). Eur J Immunol.
1997;27:509-514.
Jaenisch R, Bird A. Epigenetic regulation of gene
expression: how the genome integrates intrinsic
and environmental signals. Nat Genet. 2003;33:
245-254.
Weih F, Nitsch D, Reik A, Schütz G, Becker PB.
Analysis of CpG methylation and genomic footprinting at the tyrosine aminotransferase gene:
DNA methylation alone is not sufficient to prevent
protein binding in vivo. EMBO J. 1991;10:25592567.
Miyamoto T, Iwasaki H, Reizis B, et al. Myeloid or
lymphoid promiscuity as a critical step in hematopoietic lineage commitment. Dev Cell. 2002;3:
137-147.
Lin IG, Hsieh CL. Chromosomal DNA demethylation specified by protein binding. EMBO Rep.
2001;2:108-112.
Harrington MA, Jones PA, Imagawa M, Karin M.
Cytosine methylation does not affect binding of
transcription factor Sp1. Proc Natl Acad Sci U S A.
1988;85:2066-2070.
Macleod D, Charlton J, Mullins J, Bird AP. Sp1
sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island.
Genes & Dev. 1994;8:2282-2292.
Lefevre P, Kontaraki J, Bonifer C. Identification of
factors mediating the developmental regulation of
the ⫺3.9 kb chicken lysozyme enhancer. Nucleic
Acids Res. 2001;29:4551-4560.
Akashi K, He X, Chen J, et al. Transcriptional accessibility for genes of multiple tissues and hematopoietic lineages is hierarchically controlled during early hematopoiesis. Blood. 2003;101:383389.
Nutt SL, Heavey B, Rolink A, Busslinger M. Commitment to the B-lymphoid lineage depends on
the transcription factor Pax5. Nature. 1999;410:
556-562.
Hu M, Krause D, Greaves M, et al. Multilineage
gene expression precedes commitment in the
hemopoietic system. Genes & Dev. 1997;11:774785.
Zhu J, Emerson SG. Hematopoietic cytokines,
transcription factors and lineage commitment.
Oncogene. 2002;21:3295-3313.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2004 103: 2950-2955
doi:10.1182/blood-2003-09-3323 originally published online
December 18, 2003
Dynamic reorganization of chromatin structure and selective DNA
demethylation prior to stable enhancer complex formation during
differentiation of primary hematopoietic cells in vitro
Hiromi Tagoh, Svitlana Melnik, Pascal Lefevre, Suyinn Chong, Arthur D. Riggs and Constanze
Bonifer
Updated information and services can be found at:
http://www.bloodjournal.org/content/103/8/2950.full.html
Articles on similar topics can be found in the following Blood collections
Gene Expression (1086 articles)
Hematopoiesis and Stem Cells (3432 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.