Ethylene Regulates differential growth via BIG ARF

Plant Cell Advance Publication. Published on April 24, 2017, doi:10.1105/tpc.16.00743
RESEARCH ARTICLE
Ethylene Regulates differential growth via BIG ARF-GEF-dependent postGolgi secretory trafficking in Arabidopsis
Kristoffer Jonsson1, Yohann Boutté2, Rajesh Kumar Singh1,, Delphine Gendre1,, Rishikesh P. Bhalerao1,*,.
1
Umeå Plant Science Centre, Department of Forest Genetics and Plant Physiology, Swedish University
for Agricultural Sciences, SE-901 83, Umeå, Sweden.
2
CNRS-University of Bordeaux, UMR 5200 Membrane Biogenesis Laboratory, INRA Bordeaux
Aquitaine, 33140 Villenave d’Ornon, France.
*
All correspondence should be sent to: [email protected] Phone +46 (0)90 786 8608
Short-title: Ethylene-mediated differential growth by ARF-GEFs
One-sentence summary: Protein trafficking machinery mediates transport of an auxin influx carrier to the
plasma membrane to modulate differential growth in seedlings in response to ethylene.
The author responsible for distribution of materials integral to the findings presented in this article in
accordance with the policy described in the Instructions for Authors (www.plantcell.org) is Rishi Bhalerao
([email protected])
ABSTRACT
During early seedling development, the shoot apical meristem is protected from damage as the seedling
emerges from soil by the formation of apical hook. Hook formation requires differential growth across the
epidermis below the meristem in the hypocotyl. The plant hormones ethylene and auxin play key roles
during apical hook development by controlling differential growth. We provide genetic and cell biological
evidence for the role of ADP-ribosylation factor 1 (ARF1)-GTPase and its effector ARF-guanine-exchange
factors (GEF)s of the BFA-inhibited GEF (BIG) family and GNOM in ethylene- and auxin-mediated control
of hook development. We show that ARF-GEF GNOM acts early, whereas BIG ARF-GEFs act at a later
stage of apical hook development. We show that the localization of ARF1 and BIG4 at the trans-Golgi
network (TGN) depends on ECHIDNA (ECH), a plant homolog of yeast Triacylglycerol
lipase(TLG2/SYP4) interacting protein Tgl2-Vesicle Protein 23 (TVP23). BIGs together with ECH and
ARF1 mediate the secretion of AUX1 influx carrier to the plasma membrane from the TGN during hook
development and defects in BIG or ARF1 result in insensitivity to ethylene. Thus, our data indicate a
division of labor within the ARF-GEF family in mediating differential growth with GNOM acting during
the formation phase whereas BIGs act during the hook maintenance phase downstream of plant hormone
ethylene.
1
©2017 American Society of Plant Biologists. All Rights Reserved
INTRODUCTION
The apical hook develops immediately after seed germination, protecting the apical meristem as
the etiolated seedling penetrates through soil. The curvature of the apical hook results from
asymmetric cell elongation rates at opposite sides of the bending hypocotyl (Silk and Erickson,
1978; Raz and Koornneef, 2001), which are coordinated by the plant hormones ethylene and
indole-acetic acid (IAA/auxin) (Li et al., 2004; Gallego-Bartolome et al., 2011). Ethylene promotes
hook curvature largely by modulating auxin biosynthesis and distribution (Harper et al., 2000;
Zadnikova et al., 2010). Bending during hook development requires asymmetric distribution of
auxin across the hypocotyl. The asymmetric auxin distribution with auxin response maxima
localized on the concave side of the hook can be visualized using synthetic auxin response reporters
such as DR5 (Vandenbussche et al., 2010; Zadnikova et al., 2010). An increased auxin response
on the concave side causes a reduced cell elongation rate relative to the convex side, resulting in
hook formation. The establishment of auxin response maxima on the concave side of the apical
hook relies on active, carrier-mediated polar auxin transport (PAT) (Vandenbussche et al., 2010;
Zadnikova et al., 2010). Members of both the AUX/LIKE-AUX1(LAX) influx carrier and PINFORMED (PIN) efflux carrier families play key roles in PAT-mediated hook development,
underlined by the hook defects observed in aux/lax and pin mutants, or by exposing seedlings to
the carrier inhibitors N-(1-naphtyl)phtalamic acid (NPA) or 1-naphtoxyacetic acid (1-NOA) that
disrupt PAT (Vandenbussche et al., 2010; Zadnikova et al., 2010). The abundance and localization
of PAT-mediating carriers is modulated by membrane trafficking processes. Whereas studies of
the PIN family of auxin carriers have provided insights into how endocytosis facilitates their
localization and abundance at the plasma membrane (PM) (Geldner et al., 2003; Dhonukshe et al.,
2007), much less is known about the machinery involved in AUX/LAX protein trafficking, which
also play an important role during hook development as suggested by the mutant phenotypes
(Vandenbussche et al., 2010).
We have identified a key role for the evolutionarily conserved protein ECHIDNA (ECH), a plant
homolog of the yeast Triacylglycerol lipase (TLG2/SYP4) interacting protein Tgl2-Vesicle Protein
23 (TVP23), in secretory trafficking at the post-Golgi compartment trans-Golgi Network (TGN)
of AUX1 in the apical hook (Gendre et al., 2011; Boutte et al., 2013). The ech mutant displays
severe attenuation of the secretory trafficking of AUX1 to the PM, altered auxin distribution,
2
insensitivity to the ethylene precursor aminocyclopropane-1-carboxylate (ACC) and hook
developmental defects. Nevertheless, how ECH mediates secretory trafficking of AUX1 remains
poorly understood. BIG proteins, which act as a guanine-exchange factor (GEF) for ADPribosylation factor (ARF) GTPases, are required for de novo PIN1 delivery to the PM (Richter et
al., 2014). BIGs, like ECH, localize to the TGN, a post-Golgi compartment that serves as a hub for
secretory and endocytic traffic. ARF-GEFs primarily catalyze nucleotide exchange for ARF
GTPases, which mediate vesicle formation (Peyroche et al., 1996). Interestingly, the number of
secretory vesicles at the TGN has been shown to be reduced in the ech mutant, implicating ECH in
a hitherto unknown aspect of vesicle development (Boutte et al., 2013). The localization of ECH
and BIGs at the TGN and the secretory defects observed for ech and big mutants prompted us to
investigate whether BIGs like ECH were involved in hook development and whether they are
involved in AUX1 trafficking in concert with ECH. Intriguingly, previous studies have hinted at a
role for an ARF-GEF that is resistant to the action of the fungal toxin Brefeldin A (BFA) in AUX1
trafficking (Kleine-Vehn et al., 2006). BIG3, a member of the BIG family is resistant to BFA
further supporting the investigation into the role of BIGs in AUX1 trafficking via TGN. Therefore,
we initiated the characterization of BIGs and their target ARF1 in AUX1 trafficking.
Our data demonstrate that BIG4 co-localizes with ECH and ARF1 at the TGN and like ECH, BIG
function is essential for ARF1 localization at the TGN. Disruption of ARF1 or BIG function
phenocopies the AUX1 trafficking and hook developmental defects observed in ech. Moreover,
big mutants, like ech, exhibit resistance to exaggeration of the apical hook by ethylene precursor
ACC. Taken together, this work provides insight into the mechanism of ARF-GEF-mediated, ECHdependent secretory trafficking at the TGN in hormonal control of differential growth.
RESULTS
The ARF-GEFs GNOM and BIG1-4 act at distinct stages of apical hook development
Following germination, wild-type (WT) seedlings progressively bend their hypocotyls to form an
apical hook in the dark; a process that is complete 24–36 h post-germination (designated as the
formation phase). The apical hook is maintained for approximately 48 h (maintenance phase),
followed by a gradual opening over 72–96 h post-germination (opening phase), after which the
3
hypocotyl becomes completely straight. We employed a genetic and pharmacological approach to
investigate the role of ARF-GEFs in apical hook development, using the fungal toxin Brefeldin A
(BFA), which inhibits the activity of ARF-GEFs (Peyroche et al., 1999). When WT seeds were
germinated on media supplemented with 5 µM BFA, apical hook development was completely
abolished (Figure 1A), indicating a role for ARF-GEFs in this process. The Arabidopsis genome
harbors 8 ARF-GEFs, divided into two subclasses, one comprising GNOM and GNL1–2 and the
other BIG1–5, with BIG1–4 regulating processes distinct from BIG5 (Richter et al., 2014). Next
we took a genetic approach to obtain a better understanding of the contribution of distinct ARFGEFs to hook development. We used Arabidopsis thaliana seedlings expressing a BFA-resistant
variant of GNOM (GNOMR) (Geldner et al., 2003) and analyzed the effect of BFA on hook
development in these seedlings (Figure 1A). In contrast to the WT, the introduction GNOMR into
the WT background completely restored hook formation, even in the presence of 5 µM BFA
(Figure 1A). However, GNOMR seedlings were unable to maintain the apical hook in the
presence of 5 µM BFA compared to seedlings grown without BFA (Figure 1A). We observed
that GFP-tagged GNOM driven by its native promoter was expressed uniformly at equal levels
during both hook formation and maintenance (Supplemental Figure 1). Thus, although expressed
ubiquitously during distinct stages of hook development, GNOM acts primarily during the hook
formation phase, whereas other ARF-GEFs may be essential during the subsequent stages of
hook development.
ARF-GEFs BIG1–4 were recently shown to act redundantly and independently of GNOM during
lateral root initiation (Richter et al., 2014). Therefore, we analyzed whether BIGs play a role in
hook development. While big1-big4 single mutants, as well as various double and triple mutant
combinations, displayed no discernible hook defects (Supplemental Figure 2A-B), big1 big2 big3
and big1/+ big2 big3 big4 mutants exhibited an apical hook development with a markedly
shortened maintenance phase (Figure 1B). This indicates that BIG ARF-GEFs are not essential
during the formation phase but act redundantly during the maintenance phase. A quadruple big
mutant is not viable and could therefore not be analyzed (Richter et al., 2014). Of the BIG ARFGEFs, only BIG3 is resistant to BFA (Richter et al., 2014). Thus treating the big3 mutant with
BFA allows simultaneous inhibition of BIG1–4 function as well as GNOM. While hook
formation of WT plants remained unaffected in the presence of 0.5 µM BFA, big3 mutant treated
with 0.5 µM BFA displayed severely perturbed apical hook development, with hook angle
4
peaking at approximately 150° instead of 180° as in the WT, and with a completely abolished
maintenance phase (Figure 1C). The hook defect in the BFA-treated big3 plants could be rescued
with the introduction of an engineered, BFA-resistant variant of BIG4-YFP (ProUBQ10:BIG4RYFP) into the big3 background, but not with the introduction of a BFA-sensitive BIG4-YFP
(ProUBQ10:BIG4-YFP) (Supplemental Figure 2C). These results further illustrate the functional
redundancy among BIG1-4 family members during hook development. It has been previously
shown that GNOM can take over the function of the BFA-resistant GNL1 in the absence of
GNL1 (Richter et al., 2007). Therefore, we tested whether GNOM can similarly take over the
function of BIGs in hook development. However, the introduction of GNOMR into big3 did not
reverse the severe hook defect of BFA-treated big3 (unlike BFA-resistant BIG4) (Supplemental
figure 2D), indicating that GNOM cannot substitute for BIG1-4. Taken together our results show
that ARF-GEFs BIGs and GNOM are required at distinct stages of hook development.
BIGs act redundantly in ethylene-mediated hook development
Previous studies have demonstrated that the apical hook maintenance phase is regulated by
ethylene (Raz and Koornneef, 2001), and exogenously added ethylene or ethylene precursor
aminocyclopropane-1-carboxylate (ACC) induces exaggeration of the apical hook (Kang et al.,
1967; Bleecker et al., 1988). Therefore, we investigated whether BIGs are involved in ethylenemediated control of hook development. Hence, we examined whether the hook maintenance
defect of BFA-treated big3 could be suppressed by ACC. While WT seedlings exhibited an
exaggerated hook curvature in response to treatment with 10 µM ACC both in the presence and
absence of 0.5 µM BFA (Figure 2A), reaching an average angle of 270°, the big3 mutants did not
exaggerate their hook curvature in response to 10 µM ACC treatment when grown in the
presence of 0.5 µM BFA (Figure 2B). This indicates that the BIG ARF-GEFs are required, and
act independently of GNOM, during ethylene-mediated apical hook maintenance.
BIGs interact genetically with ECHIDNA in hook development
The hook defects in big mutants, e.g., attenuated maintenance and insensitivity of hook
development to ethylene, are similar to those described in echidna (ech) mutant (Boutte et al.,
2013). Furthermore, like ECH, BIG3 localizes to the TGN (Richter et al., 2014). Therefore, we
examined whether BIG ARF-GEFs and ECH might act in a common pathway during hook
5
development. We observed that hook development of the ech mutant displayed a strong
hypersensitivity to BFA treatment, implying that ARF-GEF function may be compromised in the
ech mutant (Figure 3A). Furthermore, an ech big2 big3 triple mutant exhibited enhanced defects
in hook development when compared to ech and big2 big3 double mutants alone (Figure 3B),
suggesting that ECH and BIG1-4 act synergistically in hook development.
AUX1 trafficking to the plasma membrane requires BIG1- BIG4 function
We have previously demonstrated that the level of AUX1 at the PM is strongly reduced in the ech
mutant (Boutte et al., 2013). Furthermore, the aux1 mutant displays insensitivity to ethylene
during hook development (Vandenbussche et al., 2010), as do the ech and big mutants. This led
us to investigate if AUX1 delivery to the PM requires BIG1-4 function. In contrast to mocktreated WT and big3, or WT seedlings grown in the presence of 0.5 µM BFA, AUX1-YFP levels
at the PM decreased to 43% of mock levels during the formation phase and 11% of mock levels
during the maintenance phase in big3 mutant grown on medium supplemented with 0.5 µM BFA
(Figure 4). Compared to the strong reduction of AUX1-YFP plasma membrane levels during the
maintenance phase in big3 seedlings grown on 0.5 µM BFA, the transcript levels of AUX1-YFP
were only mildly reduced in big3 grown on 0.5 µM BFA during the maintenance phase
(Supplemental Figure 3), indicating that the observed attenuation of PM localization of AUX1 in
BFA-treated big3 is primarily post-transcriptional.
It has been suggested that AUX1 trafficking may rely on a BFA-resistant ARF-GEF (KleineVehn et al., 2006). In agreement with this observation, no intracellular agglomerations of AUX1YFP were observed in WT epidermal cells in the hook that were mock-treated, subjected to a 3-h
treatment with 50 µM BFA or alternatively pretreated with 50 µM cycloheximide (CHX) for 1 h
prior to a 3-h treatment with 50 µM CHX together with 50 µM BFA (Figure 5A-C). While
AUX1-YFP localization was unaffected in mock-treated big3 mutant (Figure 5D) like the WT,
big3 mutants treated with 50 µM BFA for 3 h displayed strong intracellular agglomerations of
AUX1-YFP (Figure 5E). Importantly, this formation of AUX1-YFP agglomerations in big3 upon
BFA treatment was blocked when the big3 seedlings were pretreated with CHX at 50 µM for 1 h
prior to a 3-h treatment with 50 µM CHX + 50 µM BFA (Figure 5F). Additionally, the
intracellular AUX1-YFP agglomerations in BFA-treated big3 seedlings strongly overlapped with
the TGN-localized VHA-a1-RFP (Dettmer et al., 2006) (Pearson’s coefficient, 0.429 ±0.083)
6
(Figure 5G-L, Supplemental Figure 4A). By contrast, pre-treatment with 50 µM CHX for 1 h
followed by a 3-h treatment with 50 µM CHX + 50 µM BFA strongly agglomerated VHA-a1RFP but not AUX1-YFP (Pearson’s coefficient 0.007 ±0.055) (Supplemental Figure 4A-B).
Importantly, the AUX1-YFP agglomeration in BFA-treated big3 was suppressed by expression of
a BFA-resistant BIG4-RFP but not a BFA-sensitive BIG4-RFP (Supplemental Figure 5A-D) or
expression of GNOMR (Supplemental Figure 5E-F). Thus, these results suggest that GNOM does
not play a role in the trafficking of AUX1-YFP to the PM, in contrast to its role in PIN1
trafficking. Taken together, these results indicate that, like ECH, BIG1–4 mediate de novo AUX1
trafficking to the plasma membrane, via the TGN, independently of GNOM function.
BIG4 and ECHIDNA co-localize at the TGN and their localization is interdependent
BIG1–4 were recently shown to localize to the TGN in Arabidopsis roots (Richter et al., 2014).
At least two domains have been identified in the TGN, one of which is labelled by VHA-a1,
SYP61 and ECH, whereas the other of which only partially overlaps with VHA-a1 but is marked
with RABA2a (Chow et al., 2008; Gendre et al., 2011; Uemura et al., 2014). Since ech and big1–
4 mutants display very similar phenotypes, we investigated whether BIGs co-localize with ECH
at the TGN. We observed a strong co-localization between ECH-YFP and BIG4-RFP (61%) as
well as between ECH-YFP and the TGN-localized VHA-a1-RFP (64%) and BIG4-RFP and
VHA-a1-GFP (65%) (Figure 6A-D), using a quantitative morphology-based method for assessing
co-localization percentage (Boutte et al., 2006). This observation along with the phenotypes of
the ECH and BIG ARF-GEF mutants strongly suggests that ECH and BIG ARF-GEFs operate at
the same TGN domain. Therefore, we tested whether ECH is required for BIG ARF-GEF
localization at the TGN. While BIG4R-YFP exhibited an almost exclusively punctate labeling in
WT seedlings (Figure 7A), BIG4R-YFP was strongly mislocalized in ech mutants, exhibiting a
diffuse rather than punctate pattern (Figure 7B). Similarly, we tested whether ECH localization
required BIG ARF-GEF function to assess the localization interdependence of ECH and BIG
ARF-GEFs. While ECH-YFP localized to punctate structures in mock-treated WT and big3,
ECH-YFP agglomerated in the WT after 1 h of 50 µM BFA treatment (Figure 7C-E). By
contrast, 1 h of 50 µM BFA treatment of big3 led to ECH-YFP exhibiting a diffuse pattern
(Figure 7F) different from that observed in BFA-treated WT seedlings, indicating that ECH
7
localization requires BIG ARF-GEF function, and hence that the localization of ECH and BIG
ARF-GEFs at the TGN is interdependent.
ECH has been shown to be important for the localization of VHA-a1 as well as other proteins
such as YIPs and SYP61 at the TGN (Gendre et al., 2011; Gendre et al., 2013). Disruption of the
V-type proton ATPase function by Concanamycin A (ConcA) results in the mislocalization of
several TGN proteins, such as SYP61, that are also mislocalized in the ech mutant. This result
prompted us to suggest that the mislocalization of TGN proteins in the ech mutant may be caused
by the disruption of VHA-a1 function. Therefore, we tested whether the mislocalization of BIG
ARF-GEFs in ech was due to disruption of VHA-a1 function by targeting VHA-a1 activity using
ConcA. Our results show that a 2-h 5 µM ConcA treatment did not affect the localization of
BIG3-YFP or BIG4R-YFP (Figure 7G-J). By contrast, the primary target of ConcA, VHA-a1GFP, strongly agglomerated into large ConcA-induced bodies, indicating the effectiveness of the
ConcA treatment (Figure 7K-L). Thus, ECH is required for the proper localization of BIG ARFGEFs at the TGN independently of VHA-a1.
BIG ARF-GEFs and ECHIDNA are required for ARF1 localization at the TGN
BIG3 has been previously shown to act as an ARF-GEF for the ARF1 GTPase in vitro (Nielsen et
al., 2006). Since BIG4 co-localizes with ECH at the TGN, we investigated whether ARF1 also
co-localizes with BIG ARF-GEFs at the TGN. We observed that ARF1-labeled structures colocalized with both BIG4 and VHA-a1 (40% and 47%, respectively) (Figure 8A-C), indicating
that ARF1 and BIG4 localize to the same TGN domain. The mislocalization of BIG ARF-GEFs
in the ech mutant led us to investigate whether the TGN localization of ARF1, the potential in
vivo target of BIG3, could be compromised in the ech mutant. Whereas ARF1-GFP labeling in
the WT was largely restricted to punctate structures (Figure 9A), ARF1-GFP in the ech mutant
exhibited a diffuse pattern with few punctate structures, indicating the mislocalization of ARF1 in
the ech mutant (Figure 9F). To examine the role of BIGs in ARF1 localization, we visualized
ARF1-GFP in the big3 mutant upon BFA treatment. While ARF1-GFP exhibited punctate
labeling under mock conditions in both the WT and the big3 mutant (Figure 9B and G), the
punctate labeling of ARF1-GFP was lost after a 15-minute treatment with 50 µM BFA in big3
(Figure 9H), before any discernable effect on its localization was observed in BFA-treated WT
(Figure 9C). By contrast, VHA-a1-GFP labeling was unaffected after a 15-min BFA treatment in
8
both WT and big3 (Figure 9D, E, I and J). The rapid mislocalization of ARF1 in big3 upon BFA
treatment suggests that ARF1 localization may depend on TGN-localized BIG1–4 function.
Introduction of a BFA-resistant BIG4-RFP but not a BFA-sensitive BIG4-RFP reversed the
ARF1-GFP mislocalization in big3 upon a 30-min 50 µM BFA treatment, indicating that BIG
ARF-GEF function like ECH is required for proper ARF1 localization at the TGN (Supplemental
Figure 6A-D).
ARF1 members are essential for ethylene-mediated apical hook development and AUX1
trafficking
ARF1 localization at the TGN relies on BIGs and ECH. Therefore, we investigated whether
ARF1 also plays a role in hook development, like BIG ARF-GEFs and ECH. However, the high
redundancy among ARF1 subclass members (Xu and Scheres, 2005) makes it difficult to address
the ARF1 function. Therefore, we generated transgenic plants expressing a dominant-negative
GDP-locked mutant of the ARF1 member ARFA1c with low GTP affinity fused to CFP
(ARFA1cT31N-CFP) (Dascher and Balch, 1994; Xu and Scheres, 2005), under control of a βEstradiol-inducible UBQ10 promoter to interfere with ARF1 function. In contrast to plants that
expressed a WT variant of ARFA1c (ARFA1cWT-GFP) or untransformed WT controls (Figure
10A-B), induction of ARFA1cT31N-CFP mutant expression led to severely perturbed hook
development. Upon induction of ARFA1cT31N-CFP, the hook formation peaked at 145° (Figure
10C) and the hook maintenance phase was completely abolished, closely resembling the ech and
big mutant phenotypes. Furthermore, ACC treatment of the WT or ARFA1cWT-GFP seedlings
resulted in an exaggerated hook angle of approximately 270° (Figure 10A-B), while seedlings
expressing ARFA1cT31N-CFP did not exaggerate hook curvature upon ACC treatment (Figure
10C). The transcript level of ARFA1cT31N-CFP upon β-Estradiol induction was similar to that of
ARFA1cWT-GFP (Supplemental Figure 7), indicating that the observed effect of ARFA1cT31NCFP on hook development was not due to a higher expression of ARFA1cT31N-CFP relative to
that of ARFA1cWT-GFP.
ARF1 co-localizes with BIGs at the TGN, and the disruption of ARF1 function, as in the ech or
big mutants, results in failure to respond to ACC. Therefore we examined whether ARF1
function is also required, like ECH and BIG1–4, for AUX1-YFP trafficking to the PM. AUX1YFP fluorescence levels at the PM decreased to approximately 25% of WT levels following
9
ARFA1cT31N-CFP induction, whereas AUX1-YFP levels at the PM were unaffected by
ARFA1cWT-GFP induction (Figure 11A-F, Supplemental Figure 8). In the WT, as well as in
seedlings expressing ARFA1cWT-GFP, AUX1-YFP was exclusively localized to the plasma
membrane (Figure 11A, B, D and E), with no intracellular signal detected. By contrast, a strong
intracellular AUX1-YFP signal was observed in seedlings expressing ARFA1cT31N-CFP (Figure
11F). Thus, AUX1 delivery to the PM requires the function of the ARF1 subclass. These
observations strongly suggest that ECH, BIG1–4, and ARF1 operate in a common pathway
during hook development and AUX1 trafficking to the PM.
DISCUSSION
Plants exhibit remarkable plasticity during development and are able to modify their pattern of
growth to adapt to the environment. They often rely on differential cell elongation to change their
growth pattern, as exemplified in the apical hook development that follows seed germination.
Here we demonstrate that the GTPase ARF1 and its effectors ARF-GEFs of the BIG family play
a role in apical hook development by mediating the secretory trafficking of the auxin influx
carrier AUX1 from the TGN to the PM in concert with the previously described TGN-localized
protein ECH.
Stage-specific role of ARF-GEFs in apical hook development
The specific defects in secretory vesicle (SV) morphology and number previously observed in
ech hinted at ECH being essential for proper secretory vesicle genesis at the TGN (Boutte et al.,
2013). Other known players in vesicle formation are ARF-GTPases (D'Souza-Schorey and
Chavrier, 2006) that cycle between GTP- and GDP-bound states and ARF-GEFs that play a key
role in ARF GTPase function by facilitating the GDP-to-GTP exchange on ARF GTPases
(Anders and Jurgens, 2008). Our results showed that hook development in the ech mutant is
hypersensitive to treatment with the ARF-GEF-inhibitor BFA, suggesting that ARF-GEF
function may be compromised in the ech mutant (Figure 3A). Our dissection of ARF-GEF
involvement during hook development revealed that both the BFA-sensitive ARF-GEF GNOM
and ARF-GEFs of the BIG family, BIG1-4, play a role in hook development. While the BFAsensitive ARF-GEF GNOM is essential mainly during the formation phase of apical hook
10
development (Figure 1A), the maintenance phase relies on the BIG ARF-GEF subclass members
BIG1-4 (Figure 1B-C). It has previously been shown that ARF-GEFs can functionally replace
each other. For example, GNOM can substitute for GNOM-LIKE1, and GNOM-LIKE2 can
substitute for GNOM (Richter et al., 2007; Richter et al., 2012). However, this does not appear to
be the case for GNOM and BIG1-4 in hook development, as the distinct ARF-GEFs have stagespecific roles, with BIG1-4 operating redundantly and independently of GNOM to mediate apical
hook maintenance (Figure 1B-C, Supplemental Figure 2A-D). Moreover, since GNOM is
expressed at all stages of hook development (Supplemental Figure 1), the stage-specific roles of
GNOM and BIGs are not due to their differential stage-specific expression. Thus, the results
presented here suggest that ARF-GEF regulation of hook development is separated temporally,
with distinct pathways operating at different developmental phases. It remains to be seen whether
the apical hook defects observed following the disruption of GNOM and BIG function are related
to their distinct roles in trafficking, with GNOM participating in recycling (Geldner et al., 2003)
and BIG1-4 involved in secretion rather than recycling (Richter et al., 2014).
BIG1-4 and ECHIDNA act in concert during ethylene-mediated hook development
The plant hormone ethylene is involved in hook maintenance and ethylene-insensitive mutants,
such as ein2 have severe defects in the maintenance phase (Guzman and Ecker, 1990;
Vandenbussche et al., 2010). Our data showed that BIG1-4 are required for ethylene-mediated
hook maintenance (Figure 2A and B). In this respect, disruption of BIG1-4 function phenocopies
the ech mutant, which is also ethylene-insensitive (Boutte et al., 2013). These observations
suggested that ECH and BIG1-4 could operate in a common pathway in hook development where
ethylene is an upstream regulator. In accordance with this hypothesis, we observed that an ech
big2 big3 triple mutant displayed a strongly enhanced apical hook defect compared with the ech
or big2 big3 double mutant (Figure 3B). Thus, BIG2 and BIG3 act together with ECH in a
pathway that controls hook development downstream of ethylene.
BIG1-4 mediate AUX1 trafficking to the PM at an ECHIDNA-positive TGN domain
Previous studies have revealed that AUX1 is required for ethylene-induced exaggeration of hook
curvature, and that in response to ethylene, AUX1 PM turnover increases preferentially on the
concave side of the hook (Roman et al., 1995; Vandenbussche et al., 2010; Boutte et al., 2013).
11
Delivery of de novo-synthesized AUX1 to the PM is strongly attenuated in the ech mutant, and
hook development in the ech mutant is insensitive to ethylene (Boutte et al., 2013). In agreement
with the genetic interaction between ECH and BIGs and the overall similarity of the big and ech
mutant phenotypes, our data now revealed that BIG1-4 are essential for the delivery of newly
synthesized AUX1 to the PM, independently of GNOM (Figure 4, Figure 5A-F, Supplemental
figure 5A-F). Furthermore, our co-localization study indicates that BIG3 and ECH reside on a
similar TGN subdomain (Figure 6A-D). Thus, genetic and cell biological data suggest that both
BIG1-4 and ECH are required at the TGN for AUX1 trafficking to the PM during hook
development, highlighting the role of secretory trafficking in regulation of differential growth of
the apical hook.
ECHIDNA and BIG1-4 act in concert independently of VHA-a1 in AUX1 trafficking from
the TGN
TGN has a key role in secretion to the PM (Gendre et al., 2015)). In recent years, the
characterization of ECH and VHA-a1, a component of the TGN-localized vacuolar H+ ATPase,
and other TGN-resident proteins have revealed certain details about the mechanisms underlying
TGN function and protein secretion from the TGN to the PM. (Dettmer et al., 2006; Gendre et al.,
2011; Uemura et al., 2012; Asaoka et al., 2013). Disruption of VHA-a1 or ECH results in the
mislocalization of TGN-resident proteins and alters TGN morphology (Dettmer et al., 2006;
Viotti et al., 2010; Boutte et al., 2013). Disruption of TGN-localized vacuolar H+ ATPase alters
TGN pH levels, resulting in defective trafficking from the TGN (Luo et al., 2015). VHA-a1 has
previously been connected to the secretion of BRI1 (Dettmer et al., 2006). However, despite the
co-localization between ECH and VHA-a1 at the TGN as well as the mislocalization of VHA-a1
in the ech mutant, ECH-dependent AUX1 secretory trafficking in the apical hook and ECHdependent pectin secretion in seed coat cells occur independently of VHA-a1 (Boutte et al., 2013;
Gendre et al., 2013; McFarlane et al., 2013). Like ECH, BIGs (BIG3/4) localize to the TGN and
co-localize with VHA-a1 (Richter et al., 2014) (Figure 6C-D) and ECH (Figure 6A and D). Thus
a crucial question to address was whether BIGs act together with VHA-a1 or independently of it
in hook development. We observed that BIG localization was severely affected in the ech mutant,
as BIG4R-YFP exhibited a cytosol-like instead of a punctate pattern (Figure 7A-B). Similarly,
12
ECH localization was perturbed by the disruption of BIG ARF-GEF function (Figure 7C-F),
indicating the mutual dependence for TGN localization of ECH and BIGs. In contrast, when
VHA-a1 function was inhibited with ConcA, BIG ARF-GEF localization was unaffected (Figure
7G-L), indicating that the TGN localization of BIG ARF-GEFs analyzed here does not rely on
VHA-a1 function despite the strong co-localization between them (Richter et al., 2014). Thus,
while the secretion of AUX1 requires TGN function, it is mediated by BIG1-4 and ECH in a
VHA-a1-independent manner during hook development. These observations reveal the
complexity of TGN structure and function and indicate that even within a subdomain of the TGN,
multiple distinct secretory pathways operate in a highly regulated manner.
ARF1 GTPases mediate ethylene-regulated hook development and require ECHIDNA and
BIG1-4 for their proper localization
ARF-GEFs regulate vesicle formation by activating GTPases of the ARF/Sar family (Peyroche et
al., 1996; Anders and Jurgens, 2008). The ARF-GEF BIG3 was previously shown to catalyze
GDP/GTP exchange specifically for members of the ARF1 subclass, localized mainly to the TGN
and Golgi (Nielsen et al., 2006; Robinson et al., 2011). We observed that the disruption of ARF1
function by expressing a dominant negative variant of ARFA1c (ARF1T31N) exhibited severely
perturbed hook development (Figure 10A-C), with complete abolishment of the maintenance
phase, phenocopying ech and big1/+ big2 big3 big4 or BFA-treated big3 mutant. Moreover,
defects in hook development caused by the expression of the dominant negative ARFA1c could
not be suppressed by ethylene treatment as shown earlier for ech or big3 upon BFA treatment
(Figure 10C). ARF1T31N, which has a low affinity for GTP, is thought to sequester endogenous
ARF-GEFs by mimicking GDP-bound inactive ARF1, hampering the activation of endogenous
ARF1, thereby mimicking the loss of ARF1 and ARF-GEF function (Dascher and Balch, 1994).
Perturbing ARF1 function also greatly affected the delivery of AUX1 to the PM, as AUX1 was
strongly retained in intracellular structures and highly reduced at the PM (Figure 11A-F,
Supplemental figure 8). This places the ARF1 into the same genetic pathway as ECH and BIG1-4
in hook development. Our data also showed that ARF1 co-localized strongly with BIG4 at the
TGN (Figure 8A-C), and ARF1 labeling dramatically shifted from strictly punctate to highly
diffuse when either BIG1-4 or ECH function was perturbed, suggesting that ARF1 is
mislocalized and probably no longer associated with a membrane compartment in the absence of
13
ECH or BIG ARF-GEFs (Figure 9A-C and F-H). These results suggest that ARF1 activation via
ARF-GEF-mediated GDP/GTP exchange may have been compromised in the absence of ECH
and BIG ARF-GEFs.
ARF1 has been associated with COPI-mediated pathways at the Golgi (Goldberg, 1999; Pimpl et
al., 2003). ARF1 also localizes to the TGN in plants (Robinson et al., 2011) and has been
demonstrated to have the capacity to mediate COPI-independent vesicle formation at the TGN in
a cell-free system derived from PC12 cells (pheochromocytoma of the rat adrenal medulla) (Barr
and Huttner, 1996). Interestingly, inhibiting BIG1-4 function does not affect COPI localization
(Richter et al., 2014). Thus, BIG1-4 may regulate ARF1 function at the TGN in Arabidopsis.
Similarly, defects in ech are most prominent at the TGN, and importantly BIGs are mislocalized
from the TGN in ech (Figure 7A-B). Thus, ECH may also mediate ARF1-dependent processes
preferentially at the TGN, potentially via a BIG ARF-GEF-dependent pathway.
We previously showed that the number of SVs at the TGN is reduced in the ech mutant, while the
number of clathrin-coated vesicles (CCVs) remained unaffected (Boutte et al., 2013). Unlike
CCVs, SVs may bear a thin coat or even lack a coat (Donohoe et al., 2007), forming via
compositional modifications in membrane lipids that induce curvature of the membrane (Bard
and Malhotra, 2006; Gendre et al., 2015)). Notably, in vitro studies in rat pituitary GH3 cells
demonstrated that Phospholipidase D (PLD) stimulates SV budding at the TGN (Chen et al.,
1997). PLD mediates the conversion of the cylindrical phospholipid phosphatidylcholine to the
more conical phosphatidic acid (Pappan et al., 1998), causing the membrane to arch. PLD activity
is stimulated by ARF1, which provides a potential mechanistic framework for SV formation at
the TGN (Chen et al., 1997). Analogous mechanisms for the formation of SVs from TGN have
not been demonstrated as yet in plants. Nevertheless, our data showing reduced SVs in ech and
commonalities in cell biological and developmental phenotypes of ech and big mutants warrant
the investigation of the role of ECH/BIGs/ARF1 and lipids in SV formation at the TGN in the
future.
The TGN is a key hub for secretory and endocytic pathways. At the least two distinct domains,
defined by ECH/VHAa1/SYP61 and by RabA2a, appear to be involved in the trafficking of
distinct TGN-PM and endocytic pathways (Dettmer et al., 2006; Chow et al., 2008; Gendre et al.,
2011; Gendre et al., 2013). Nevertheless, our knowledge of protein sorting and separation of
14
diverse pathways from the TGN remains incomplete. We previously showed that ECH and VHAa1, despite localizing to the same TGN domain, could have distinct functions, and ECH but not
VHA-a1 is required for the trafficking of AUX1, a key component required for ethylenemediated hook development (Boutte et al., 2013). Furthermore, ethylene application has been
shown to increase the turnover of AUX1 on the concave side of the hook. Our results presented
here reveal additional components of the AUX1 trafficking pathway essential to ethylenemediated hook development (Figure 12). This pathway composed of BIG ARF-GEFs and their
target ARF1 acts in AUX1 trafficking independently of VHA-a1 as described earlier for ECH
(Boutte et al., 2013). As summarized in the model (Figure 12), when ECH is not present at the
TGN, BIG localization at the TGN is affected and vice-versa, which in turn results in the loss of
ARF1 from the TGN and severe reduction of AUX1 levels at the PM and attenuation of the
ethylene response in the hook (Figure 12). Both ARF1 and BIG ARF-GEFs have broad roles in
trafficking relative to those uncovered so far for ECH. For example, ARF1 regulates additional
processes independent of ECH, such as COPI-mediated retrograde trafficking from the Golgi
(Stefano et al., 2006). Similarly, BIG1-4 operate in pathways distinct from ECH function, such as
trafficking of cargo to the vacuole (Richter et al., 2014). Therefore, it is tempting to speculate that
ECH might function as a component of the machinery that while requiring ARF1 and BIGs,
could facilitate compartment- and/or pathway specificity for trafficking via TGN. Unravelling the
mechanisms behind trafficking pathway specificity may thus provide insight into the intricate
complexity of endomembrane trafficking and how the multifaceted network of pathways controls
myriad developmental processes spanning from embryogenesis to senescence.
METHODS
Plant material
The Arabidopsis thaliana ecotype Columbia-0 (Col-0) and the following mutants were used in
this study: ech (Gendre et al., 2011), big1, big2, big3, big4, big1 big3, big1 big4, big2 big3, big3
big4, big1 big2 big3, big1 big2 big4, big1 big3 big4, big2 big3 big4, big1/+ big2 big3 big4
(Richter et al., 2014). The following transgenic lines were used: GNOMM696L-myc (GNOMR)
(Geldner et al., 2003), ProAUX1:AUX1-YFP (Swarup et al., 2004), ProVHA-a1:VHA-a1-GFP,
15
ProVHA-a1:VHA-a1-RFP (Dettmer et al., 2006), ProECH:ECH-YFP (Gendre et al., 2011),
ProBIG3:BIG3-YFP, ProUBQ10:BIG4-YFP, ProUBQ10:BIG4R-YFP, ProBIG3:BIG4-RFP,
ProBIG3:BIG4R-RFP (Richter et al., 2014), ARF1-GFP (Xu and Scheres, 2005).
Growth conditions
Plants were grown on plates supplied with ½ MS (2.2 g/l Murashige & Skoog nutrient mix
(Duchefa, Haarlem, The Netherlands)), 0,8% (w/v) plant agar (Duchefa, Haarlem, The
Netherlands), 0.5% (w/v) sucrose, 2.5 mM 2-Morpholinoethanesulfonic acid (MES) (SigmaAldrich, St. Louis, MO, USA) buffered at pH 5.8 with KOH. For confocal microscopy analysis,
seeds were stratified for 2 d at 4°C, given a 6-h white light treatment and subsequently grown in
darkness on vertically oriented agar plates at 21°C for the appropriate time (indicated for each
experiment in the results section and/or figure legends). For time-lapse analysis of apical hook
development, seedlings were grown vertically on plates in a dark room at 21°C illuminated only
with an infrared LED light source (850 nm). Seedlings were photographed at 4 h intervals using a
Canon D50 camera without an infrared filter.
Inhibitor treatments and chemical induction
For time-lapse analysis of apical hook development, seedlings were grown on agar plates
supplied with the respective inhibitor/induction agent or equivalent amounts of solvent for mock
treatments. For inhibitor pretreatments of dark-grown seedlings, seedlings were incubated in
liquid medium (½ MS supplied with 0.5% (w/v) sucrose, 2.5 mM MES, pH adjusted to 5.8 with
KOH) supplied with the indicated inhibitor or an equivalent amount of solvent during the time
indicated. Stock solutions were 50 mM Brefeldin A, 5 mM Concanamycin A, 100 mM
Aminocyclopropane-1-carboxylate (ACC) and 50 mM Cycloheximide (Sigma-Aldrich, St. Louis,
MO, USA), dissolved in DMSO. For induction of ARFA1cWT-GFP and ARFA1cT31N-CFP
expression, seeds were germinated and grown on plates supplied with 5 nM β-Estradiol (SigmaAldrich, St. Louis, MO, USA) or the equivalent amount of solvent from a 5 µM stock solution.
Genotyping of big T-DNA mutant lines
Genotyping was performed using a Phire Plant Direct PCR Kit (Thermo Fisher Scientific), with
the following primers:
16
Primers used for big1 (GK-452B06) T-DNA mutant analysis:
WT allele: 5’CTAATCCGTGGCGATTGTTT 3’ and 5’GACCTGGCGTTCAATTTTGT 3’
T-DNA allele: 5’CTAATCCGTGGCGATTGTTT 3 and 5’ATATTGACCATCATACTCATTGC
3’
Primers used for big2 (SALK_033446) T-DNA mutant analysis:
WT allele: 5’ GAAGGGTCCTGGGAAAAGTC 3’ and 5’ TCATCCACTTCACCACCAGA 3’
T-DNA allele: 5’ TCATCCACTTCACCACCAGA 3’ and 5’ ATTTTGCCGATTTCGGAAC 3’
Primers used for big3 (SALK_044617) T-DNA mutant analysis:
WT allele: 5’ TAAAACTGGCGGAGGAAGAA 3’ and 5’ TCTGCTCTTGGGTCGAAACT 3’
T-DNA allele: 5’ TAAAACTGGCGGAGGAAGAA 3’ and 5’ ATTTTGCCGATTTCGGAAC 3’
Primers used for big4 (SALK_069870) T-DNA mutant analysis:
WT allele: 5’ TCCGTGGTGATTGCTTGTTA 3’ and 5’ TTTGTAAGCCCTTCGTTGCT 3’
T-DNA allele: 5’ TTTGTAAGCCCTTCGTTGCT 3’ and 5’ ATTTTGCCGATTTCGGAAC 3’
For big1 heterozygosity analysis of the big1/+ big2 big3 big4 mutant, individual seedlings were
genotyped after completion of the time-lapse imaging experiment.
Confocal laser-scanning microscopy and quantitative analyses of fluorescence intensity and
co-localization
All fluorescence detection by confocal laser-scanning microscopy (CLSM) was performed using
a Carl Zeiss LSM780 equipped with a 40x lens (Zeiss C-Apochromat 40x/1.2 W Corr M27). For
examination of AUX1-YFP fluorescence intensities at the plasma membrane, the plasma
membrane was acquired by manually outlining a 0.5 µM segmented line along the plasma
membrane using ImageJ software. For each experiment, five epidermal cells from each of ≥10
seedlings were measured (n ≥ 50). For GNOM-GFP fluorescence intensity examination, the
interior of individual cells was demarcated manually using polygonal selection tool in ImageJ,
17
and fluorescence intensity was measured. For each time-point, five epidermal cells from each of
10 seedlings were measured (n=50). Co-localization of endomembrane compartments was
performed using the simultaneous line-scanning mode, with a 4-line average. Individual channels
were segmented, subcellular objects were demarcated and geometrical centers (centroids) of
objects were calculated using the 3D objects counter plugin in ImageJ. Co-localization of two
objects was accepted when the distance between them was below the XY resolution (R) limit
according to R = 0.61λ/NA. For each comparison, five epidermal cells from each of 10 seedlings
were measured (n=50). For AUX1-YFP and VHA-a1-RFP intracellular overlap analysis, the cell
interior signal was separated from the plasma membrane signal by manual demarcation using the
polygonal selection tool in ImageJ and selected as the region of interest (ROI). The ImageJ
Colocalization plugin was used to obtain Pearson’s correlation coefficient for ROIs of individual
cells. For each experiment, five epidermal cells from each of 10 seedlings were analyzed (n =
50). For all quantitative analyses of fluorescence intensity, confocal images were acquired using
identical acquisition parameters (laser power, photomultiplier, offset, zoom factor and resolution)
between the examined genotypes. All experiments were performed in the apical hook of darkgrown seedlings.
Generation of transgenic plants
ARF1WT-GFP and ARF1T31N-CFP sequences were amplified from extracted gDNA from plants
carrying these constructs (Xu and Scheres, 2005) using the following primers:
CACCATGGGGTTGTCATTCGGAAAGTTG, TTACTTGTACAGCTCGTCCATGCCG.
Fragments were introduced into the pENTR/D-TOPO (Invitrogen, Waltham MA, USA) cloning
vector and sequences were verified by DNA sequencing. Afterwards, LR reaction was performed
to introduce ARF1WT-GFP and ARF1T31N-CFP into the pMDC7.b vector. All constructs were
transformed into Col-0 WT plants. Plants were selected on agar plates supplied with hygromycin
(25 µg/mL) (Duchefa, Haarlem, The Netherlands). Three independent lines were analyzed.
RNA Isolation and Quantitative Real-Time PCR Analysis
Total RNA was extracted from 3-day-old dark-grown seedlings using a Spectrum Plant Total
RNA Isolation Kit (Sigma) according to manufacturer’s protocol. RNA (5 µg) was treated with
RNase-free TURBO DNase (Life Technologies, Ambion), and 1 µg was then utilized for cDNA
18
synthesis using an iScript cDNA Synthesis Kit (BioRad). ELFα was used as the reference gene
for all experiments after screening and validation of a set of 4 different reference genes (UBQ,
TIP, ELFα and Actin) using GeNorm Software. CFP/GFP/YFP primers were designed from
conserved sequences and the same primers were used for all experiments. Quantitative real-time
PCR analyses were carried out with a Roche LightCycler 480 II instrument, and relative
expression values were calculated using the delta-ct-method (Δct) to calculate relative expression
values of genes of interest. Real-time PCR primers were as follows:
CFP/GFP/YFP-Fwd: 5’GCACGACTTCTTCAAGAGCGCCATGCC 3’; CFP/GFP/YFP-Rev:
5’CCGTCCTCCTTGAAATCGATTCCCTT 3’; ELFα Fwd: 5’TGGTGACGCTGGTATGGTTA
3’; and ELFα Rev: 5’TCCTTCTTGTCCACGCTCTT 3’.
Statistical analyses:
For statistical analyses, Microsoft Excel 2010 was used. For generation of boxplot graphs,
Minitab 16 was used. To evaluate statistical differences in plasma membrane intensities,
Student’s t-test was used. For all tests, *P<0.05, ***P < 0.0001.
Accession Numbers
Sequence data from this article can be found in the EMBL/GenBank data libraries under
accession numbers: ECH (At1g09330), BIG1 (At4g38200), BIG2 (At3g60860), BIG3
(At1g01960), BIG4 (At4g35380), GNOM (At1g13980), and ARFA1c (At2g47170).
Supplemental Data
Supplemental Figure 1. GNOM is expressed ubiquitously throughout apical hook development.
Supplemental Figure 2. BIG1-BIG4 act redundantly and independently of GNOM during apical hook
development.
Supplemental Figure 3. qRT-PCR analysis of AUX1-YFP expression.
Supplemental Figure 4. AUX1-YFP overlaps with TGN-marker VHA-a1-RFP in big3 upon BFA
treatment.
Supplemental Figure 5. BFA-resistant BIG4 but not BFA-resistant GNOM reverses BFA-induced
AUX1-YFP agglomerations in big3.
19
Supplemental Figure 6. BFA-resistant BIG4 reverses BFA-induced ARF1 mislocalization in big3.
Supplemental Figure 7. qRT-PCR analysis of inducible ARF1 expression.
Supplemental Figure 8. Quantification of AUX1-YFP PM fluorescence.
ACKNOWLEDGEMENTS
We thank Gerd Jürgens for sharing materials and helpful discussions on the manuscript. We also
thank Karin Schumacher, Malcolm J. Bennett and Ben Scheres for sharing published materials.
AUTHOR CONTRIBUTIONS
KJ, Conception and design, acquisition of data, analysis and interpretation of data, drafting and
revising the article. RPB, YB, conception and design, analysis and interpretation of data, drafting
and revising the article. DG, analysis and interpretation of data, drafting the article. RKS,
acquisition of data, analysis and interpretation of data.
FUNDING
This work was supported by grants from the Knut and Alice Wallenberg Foundation,
Vetenskapsrådet, Vinnova and Berzelii. The funders had no role in the study design, data
collection and interpretation, or the decision to submit the work for publication.
REFERENCES
Anders, N., and Jurgens, G. (2008). Large ARF guanine nucleotide exchange factors in
membrane trafficking. Cellular and molecular life sciences : CMLS 65, 3433-3445.
Asaoka, R., Uemura, T., Ito, J., Fujimoto, M., Ito, E., Ueda, T., and Nakano, A. (2013).
Arabidopsis RABA1 GTPases are involved in transport between the trans-Golgi network
and the plasma membrane, and are required for salinity stress tolerance. The Plant journal
: for cell and molecular biology 73, 240-249.
20
Bard, F., and Malhotra, V. (2006). The formation of TGN-to-plasma-membrane transport
carriers. Annual review of cell and developmental biology 22, 439-455.
Barr, F.A., and Huttner, W.B. (1996). A role for ADP-ribosylation factor 1, but not COP I, in
secretory vesicle biogenesis from the trans-Golgi network. FEBS letters 384, 65-70.
Bleecker, A.B., Estelle, M.A., Somerville, C., and Kende, H. (1988). Insensitivity to Ethylene
Conferred by a Dominant Mutation in Arabidopsis thaliana. Science 241, 1086-1089.
Boutte, Y., Crosnier, M.T., Carraro, N., Traas, J., and Satiat-Jeunemaitre, B. (2006). The
plasma membrane recycling pathway and cell polarity in plants: studies on PIN proteins.
Journal of cell science 119, 1255-1265.
Boutte, Y., Jonsson, K., McFarlane, H.E., Johnson, E., Gendre, D., Swarup, R., Friml, J.,
Samuels, L., Robert, S., and Bhalerao, R.P. (2013). ECHIDNA-mediated post-Golgi
trafficking of auxin carriers for differential cell elongation. Proceedings of the National
Academy of Sciences of the United States of America 110, 16259-16264.
Chen, Y.G., Siddhanta, A., Austin, C.D., Hammond, S.M., Sung, T.C., Frohman, M.A.,
Morris, A.J., and Shields, D. (1997). Phospholipase D stimulates release of nascent
secretory vesicles from the trans-Golgi network. The Journal of cell biology 138, 495504.
Chow, C.M., Neto, H., Foucart, C., and Moore, I. (2008). Rab-A2 and Rab-A3 GTPases define
a trans-golgi endosomal membrane domain in Arabidopsis that contributes substantially
to the cell plate. The Plant cell 20, 101-123.
D'Souza-Schorey, C., and Chavrier, P. (2006). ARF proteins: roles in membrane traffic and
beyond. Nature reviews. Molecular cell biology 7, 347-358.
Dascher, C., and Balch, W.E. (1994). Dominant inhibitory mutants of ARF1 block endoplasmic
reticulum to Golgi transport and trigger disassembly of the Golgi apparatus. The Journal
of biological chemistry 269, 1437-1448.
Dettmer, J., Hong-Hermesdorf, A., Stierhof, Y.D., and Schumacher, K. (2006). Vacuolar H+ATPase activity is required for endocytic and secretory trafficking in Arabidopsis. The
Plant cell 18, 715-730.
Dhonukshe, P., Aniento, F., Hwang, I., Robinson, D.G., Mravec, J., Stierhof, Y.D., and
Friml, J. (2007). Clathrin-mediated constitutive endocytosis of PIN auxin efflux carriers
in Arabidopsis. Current biology : CB 17, 520-527.
21
Donohoe, B.S., Kang, B.H., and Staehelin, L.A. (2007). Identification and characterization of
COPIa- and COPIb-type vesicle classes associated with plant and algal Golgi.
Proceedings of the National Academy of Sciences of the United States of America 104,
163-168.
Gallego-Bartolome, J., Arana, M.V., Vandenbussche, F., Zadnikova, P., Minguet, E.G.,
Guardiola, V., Van Der Straeten, D., Benkova, E., Alabadi, D., and Blazquez, M.A.
(2011). Hierarchy of hormone action controlling apical hook development in Arabidopsis.
The Plant journal : for cell and molecular biology 67, 622-634.
Geldner, N., Anders, N., Wolters, H., Keicher, J., Kornberger, W., Muller, P., Delbarre, A.,
Ueda, T., Nakano, A., and Jurgens, G. (2003). The Arabidopsis GNOM ARF-GEF
mediates endosomal recycling, auxin transport, and auxin-dependent plant growth. Cell
112, 219-230.
Gendre, D., Jonsson, K., Boutte, Y., and Bhalerao, R.P. (2015). Journey to the cell surface-the central role of the trans-Golgi network in plants. Protoplasma 252, 385-398.
Gendre, D., McFarlane, H.E., Johnson, E., Mouille, G., Sjodin, A., Oh, J., LevesqueTremblay, G., Watanabe, Y., Samuels, L., and Bhalerao, R.P. (2013). Trans-Golgi
network localized ECHIDNA/Ypt interacting protein complex is required for the
secretion of cell wall polysaccharides in Arabidopsis. The Plant cell 25, 2633-2646.
Gendre, D., Oh, J., Boutte, Y., Best, J.G., Samuels, L., Nilsson, R., Uemura, T., Marchant,
A., Bennett, M.J., Grebe, M., and Bhalerao, R.P. (2011). Conserved Arabidopsis
ECHIDNA protein mediates trans-Golgi-network trafficking and cell elongation.
Proceedings of the National Academy of Sciences of the United States of America 108,
8048-8053.
Goldberg, J. (1999). Structural and functional analysis of the ARF1-ARFGAP complex reveals a
role for coatomer in GTP hydrolysis. Cell 96, 893-902.
Guzman, P., and Ecker, J.R. (1990). Exploiting the triple response of Arabidopsis to identify
ethylene-related mutants. The Plant cell 2, 513-523.
Harper, R.M., Stowe-Evans, E.L., Luesse, D.R., Muto, H., Tatematsu, K., Watahiki, M.K.,
Yamamoto, K., and Liscum, E. (2000). The NPH4 locus encodes the auxin response
factor ARF7, a conditional regulator of differential growth in aerial Arabidopsis tissue.
The Plant cell 12, 757-770.
22
Kang, B.G., Yocum, C.S., Burg, S.P., and Ray, P.M. (1967). Ethylene and carbon dioxide:
mediation of hypocotyl hook-opening response. Science 156, 958-959.
Kleine-Vehn, J., Dhonukshe, P., Swarup, R., Bennett, M., and Friml, J. (2006). Subcellular
trafficking of the Arabidopsis auxin influx carrier AUX1 uses a novel pathway distinct
from PIN1. The Plant cell 18, 3171-3181.
Li, H., Johnson, P., Stepanova, A., Alonso, J.M., and Ecker, J.R. (2004). Convergence of
signaling pathways in the control of differential cell growth in Arabidopsis.
Developmental cell 7, 193-204.
Luo, Y., Scholl, S., Doering, A., Zhang, Y., Irani, N.G., Di Rubbo, S., Neumetzler, L.,
Krishnamoorthy, P., Van Houtte, I., Mylle, E., Bischoff, V., Vernhettes, S., Winne,
J., Friml, J., Stierhof, Y.D., Schumacher, K., Persson, S., and Russinova, E. (2015).
V-ATPase activity in the TGN/EE is required for exocytosis and recycling in Arabidopsis.
Nat Plants 1.
McFarlane, H.E., Watanabe, Y., Gendre, D., Carruthers, K., Levesque-Tremblay, G.,
Haughn, G.W., Bhalerao, R.P., and Samuels, L. (2013). Cell wall polysaccharides are
mislocalized to the Vacuole in echidna mutants. Plant & cell physiology 54, 1867-1880.
Nielsen, M., Albrethsen, J., Larsen, F.H., and Skriver, K. (2006). The Arabidopsis ADPribosylation factor (ARF) and ARF-like (ARL) system and its regulation by BIG2, a large
ARF-GEF. Plant Sci 171, 707-717.
Pappan, K., Austin-Brown, S., Chapman, K.D., and Wang, X. (1998). Substrate selectivities
and lipid modulation of plant phospholipase D alpha, -beta, and -gamma. Archives of
biochemistry and biophysics 353, 131-140.
Peyroche, A., Paris, S., and Jackson, C.L. (1996). Nucleotide exchange on ARF mediated by
yeast Gea1 protein. Nature 384, 479-481.
Peyroche, A., Antonny, B., Robineau, S., Acker, J., Cherfils, J., and Jackson, C.L. (1999).
Brefeldin A acts to stabilize an abortive ARF-GDP-Sec7 domain protein complex:
involvement of specific residues of the Sec7 domain. Molecular cell 3, 275-285.
Pimpl, P., Hanton, S.L., Taylor, J.P., Pinto-daSilva, L.L., and Denecke, J. (2003). The
GTPase ARF1p controls the sequence-specific vacuolar sorting route to the lytic vacuole.
The Plant cell 15, 1242-1256.
23
Raz, V., and Koornneef, M. (2001). Cell division activity during apical hook development.
Plant Physiol 125, 219-226.
Richter, S., Geldner, N., Schrader, J., Wolters, H., Stierhof, Y.D., Rios, G., Koncz, C.,
Robinson, D.G., and Jurgens, G. (2007). Functional diversification of closely related
ARF-GEFs in protein secretion and recycling. Nature 448, 488-492.
Richter, S., Muller, L.M., Stierhof, Y.D., Mayer, U., Takada, N., Kost, B., Vieten, A.,
Geldner, N., Koncz, C., and Jurgens, G. (2012). Polarized cell growth in Arabidopsis
requires endosomal recycling mediated by GBF1-related ARF exchange factors. Nature
cell biology 14, 80-86.
Richter, S., Kientz, M., Brumm, S., Nielsen, M.E., Park, M., Gavidia, R., Krause, C., Voss,
U., Beckmann, H., Mayer, U., Stierhof, Y.D., and Jurgens, G. (2014). Delivery of
endocytosed proteins to the cell-division plane requires change of pathway from recycling
to secretion. eLife 3, e02131.
Robinson, D.G., Scheuring, D., Naramoto, S., and Friml, J. (2011). ARF1 localizes to the
golgi and the trans-golgi network. The Plant cell 23, 846-849; author reply 849-850.
Roman, G., Lubarsky, B., Kieber, J.J., Rothenberg, M., and Ecker, J.R. (1995). Genetic
analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci
integrated into a stress response pathway. Genetics 139, 1393-1409.
Silk, W.K., and Erickson, R.O. (1978). Kinematics of Hypocotyl Curvature. Am J Bot 65, 310319.
Stefano, G., Renna, L., Chatre, L., Hanton, S.L., Moreau, P., Hawes, C., and Brandizzi, F.
(2006). In tobacco leaf epidermal cells, the integrity of protein export from the
endoplasmic reticulum and of ER export sites depends on active COPI machinery. The
Plant journal : for cell and molecular biology 46, 95-110.
Swarup, R., Kargul, J., Marchant, A., Zadik, D., Rahman, A., Mills, R., Yemm, A., May, S.,
Williams, L., Millner, P., Tsurumi, S., Moore, I., Napier, R., Kerr, I.D., and Bennett,
M.J. (2004). Structure-function analysis of the presumptive Arabidopsis auxin permease
AUX1. The Plant cell 16, 3069-3083.
Uemura, T., Suda, Y., Ueda, T., and Nakano, A. (2014). Dynamic behavior of the trans-golgi
network in root tissues of Arabidopsis revealed by super-resolution live imaging. Plant &
cell physiology 55, 694-703.
24
Uemura, T., Kim, H., Saito, C., Ebine, K., Ueda, T., Schulze-Lefert, P., and Nakano, A.
(2012). Qa-SNAREs localized to the trans-Golgi network regulate multiple transport
pathways and extracellular disease resistance in plants. Proceedings of the National
Academy of Sciences of the United States of America 109, 1784-1789.
Vandenbussche, F., Petrasek, J., Zadnikova, P., Hoyerova, K., Pesek, B., Raz, V., Swarup,
R., Bennett, M., Zazimalova, E., Benkova, E., and Van Der Straeten, D. (2010). The
auxin influx carriers AUX1 and LAX3 are involved in auxin-ethylene interactions during
apical hook development in Arabidopsis thaliana seedlings. Development 137, 597-606.
Viotti, C., Bubeck, J., Stierhof, Y.D., Krebs, M., Langhans, M., van den Berg, W., van
Dongen, W., Richter, S., Geldner, N., Takano, J., Jurgens, G., de Vries, S.C.,
Robinson, D.G., and Schumacher, K. (2010). Endocytic and secretory traffic in
Arabidopsis merge in the trans-Golgi network/early endosome, an independent and highly
dynamic organelle. The Plant cell 22, 1344-1357.
Xu, J., and Scheres, B. (2005). Dissection of Arabidopsis ADP-RIBOSYLATION FACTOR 1
function in epidermal cell polarity. The Plant cell 17, 525-536.
Zadnikova, P., Petrasek, J., Marhavy, P., Raz, V., Vandenbussche, F., Ding, Z.,
Schwarzerova, K., Morita, M.T., Tasaka, M., Hejatko, J., Van Der Straeten, D.,
Friml, J., and Benkova, E. (2010). Role of PIN-mediated auxin efflux in apical hook
development of Arabidopsis thaliana. Development 137, 607-617.
25
Figure 1. BIG1-BIG4 and GNOM operate during distinct phases of apical hook
development, BIG1-BIG4 are required for hook maintenance. (A) Upon 5 μM BFA, hook
formation is disrupted in WT while introduction of GNOMR in WT background restores
formation but not maintenance. (B) big1 big2 big3 and big1/+ big2 big3 big4 exhibit reduced
apical hook maintenance phase compared to WT. (C) While under mock conditions big3
displays hook development indiscernible from WT, 0.5 μM BFA treatment disrupts apical
hook development of the big3 mutant but not WT. For each genotype n ≥16. Error bars
represent standard error of the mean.
Figure 2. BIG1-BIG4 are required for ethylene-mediated hook maintenance. (A) WT
seedlings respond to 10 µM ACC treatment by exaggerating their hook curvature both in
presence or absence of 0.5 μM BFA. (B) big3 mutant seedlings are unable to exaggerate in
response to 10 µM ACC in presence of 0.5 μM BFA. For each genotype n ≥ 16. Error bars
represent standard error of the mean.
2
Figure 3. Loss of ECH causes BFA hypersensitivity, and ECH interacts genetically
with BIG2 and BIG3. (A) Hook development in ech is perturbed when exposed to 0.5 μM
BFA, while WT seedlings remain unaffected. (B) ech big2 big3 triple mutant exhibits a more
severe apical hook development compared to ech and big2 big3 mutants. For each
genotype n ≥16. Error bars represent standard error of the mean.
3
Figure 4. AUX1-YFP fluorescence at the plasma membrane is reduced in big3 upon
BFA. While under mock conditions AUX1-YFP levels are equal in WT and big3 during apical
hook formation (24 h post-germination) and maintenance (48 h post-germination), when
grown on medium supplied with 0.5 μM BFA, AUX1-YFP levels are unaffected in WT but
strongly reduced in big3 during both formation and maintenance phases. All experiments
were performed in epidermal cells of the apical hook. For each treatment five cells from each
of 10 seedlings were analyzed. *** = students t-test p-value < 0.0001.
4
Figure 5. BIG1-4 are required for de novo delivery of AUX1-YFP at the TGN. (A-F)
AUX1-YFP agglomerates in big3 upon BFA treatment. While under mock conditions AUX1YFP remains exclusively at the PM in both WT (A) and big3 (D), upon 3 h of 50 μM BFA,
AUX1-YFP agglomerates intracellularly in big3 (E) (white arrowhead) but not WT (B).
Agglomerations are blocked in big3 when seedlings are pretreated with 50 μM CHX for 1 h
followed by 3 h of 50 μM CHX + 50 μM BFA treatment (F) while AUX1-YFP remains
unaffected in WT (C). (G-L) AUX1-YFP agglomerations in big3 overlap with VHA-a1-GFP. In
big3 under mock conditions AUX1-YFP resides at the PM (G) while VHA-a1-GFP exhibits a
punctate labeling (H), overlay (I). Upon 3 h of 50 μM BFA treatment in big3 AUX1-YFP
agglomerations (white-border arrowhead) (J) overlap with VHA-a1-GFP (K), overlay (L). All
experiments performed in epidermal cells of the apical hook at 48 h post-germination. Scale
bars 20 μm.
5
Figure 6. BIG4 co-localizes with ECH at the TGN. Co-localization experiment shows that
BIG4-RFP overlaps with ECH-YFP and the TGN-marker VHA-a1-GFP at 61% and 65%
respectively (A, C and D) while ECH-YFP overlaps with VHA-a1-RFP at 64% (B and D).
Five epidermal cells in each of ≥10 apical hooks at 48 h post-germination were analyzed for
each treatment. Scale bar 5 μM. Error bar represents standard deviation of the mean. Scale
bars 10 µm.
6
Figure 7. BIG ARF-GEF and ECHIDNA localization is interdependent, but BIG
localization is unaffected by Concanamycin A treatment. While BIG4R-YFP exhibits
punctate labeling in WT (A), in ech, BIG4R-YFP labeling is diffuse (B). Under mock
conditions, ECH-YFP exhibits punctate labeling in both WT and big3 (C and E). Upon 1 h of
50 µM BFA treatment, ECH-YFP agglomerates into large intracellular bodies in WT (D) while
in big3 ECH-YFP exhibits a diffuse labeling upon 1 h of 50 µM BFA treatment (F). Under
mock conditions, BIG3-YFP, BIG4R-YFP and VHA-a1-GFP exhibit punctate labeling (G, I
and K). Upon 2 h of 5 μM Concanamycin A treatment, BIG3-YFP and BIG4R-YFP remain
punctate (H and J) while VHA-a1-GFP agglomerates (L). All experiments were performed in
epidermal cells of the apical hook at 48 h post-germination. Scale bars 20 μm.
7
Figure 8. ARF1 structures overlap with BIG4 at the TGN. ARF1-GFP-labeled structures
overlap with BIG4-RFP and VHA-a1-RFP at 40% and 47% respectively (A-C). Five
epidermal cells in each of ≥10 apical hooks at 48 h post-germination were analyzed for each
treatment. Error bars represent standard deviation of the mean. Scale bars 10 μm.
8
Figure 9. ECHIDNA and BIGs are required for proper ARF1-GFP localization. ARF1GFP localization is punctate in WT (A) while strongly disrupted in ech (F). While 15 min of 50
μM BFA has no effect on ARF1-GFP localization in WT (C) compared to mock (B), punctate
ARF1-GFP in big3 under mock conditions (G) becomes strongly mislocalized in big3 upon
15 min of 50 μM BFA treatment (H). In contrast, VHA-a1-GFP localization under mock
conditions in either WT (D) or big3 (I) remains unaffected upon 15 min of 50 μM BFA in both
WT (E) and big3 (J). All experiments were performed in epidermal cells of the apical hook at
48 h post-germination. Scale bars 20 μm.
9
Figure 10. ARF1 is required for ethylene-mediated hook development. Kinematic
analyses of apical hook development reveals that WT and plants expressing ARFA1cWTGFP respond to 10 μM ACC treatment by exaggerating their hook curvature (A and B).
Compared to WT, plants expressing ARFA1cT31N-CFP exhibit shortened maintenance phase
and insensitivity to 10 μM ACC treatment (C). For each genotype and treatment n ≥16. Error
bars represent standard error of the mean.
10
Figure 11. ARF1 is required for proper AUX1-YFP localization. AUX1-YFP PM levels are
equal in WT (A), ARFA1cWT-GFP (B) and ARFA1cT31N-CFP (C) under mock conditions.
Upon 5 nM β-estradiol induction of expression, AUX1-YFP PM fluorescence remains
unchanged in WT (D) and ARFA1cWT-GFP (E), while AUX1-YFP is strongly reduced at the
PM and retained intracellularly in ARFA1cT31N-CFP (white arrowhead) (F). All experiments
were performed in epidermal cells of the apical hook at 48 h post-germination. Scale bars 20
μm.
11
Figure 12. Model of AUX1 secretory trafficking at the TGN. (A) In WT, ECH and BIG
ARF-GEFs localize to the TGN allowing ARF1 GTPases to be recruited, facilitating vesicle
formation required for AUX1 delivery to the PM, a prerequisite for ethylene response during
hook development. (B) In the absence of ECH, both BIG ARF-GEFs and ARF1 are lost from
the TGN, leading to defects in AUX1 delivery to the PM and insensitivity to ethylene during
hook development. (C) When BIG ARF-GEF function is perturbed, ECH and ARF1 are
mislocalized which results in AUX1 delivery to the PM being hampered and insensitivity to
ethylene during hook development.
12
Ethylene Regulates differential growth via BIG ARF-GEF-dependent post-Golgi secretory
trafficking in Arabidopsis
Kristoffer Jonsson, Yohann Boutté, Rajesh Kumar Singh, Delphine Gendre and Rishikesh Bhalerao
Plant Cell; originally published online April 24, 2017;
DOI 10.1105/tpc.16.00743
This information is current as of June 16, 2017
Supplemental Data
/content/suppl/2017/04/24/tpc.16.00743.DC1.html
/content/suppl/2017/05/17/tpc.16.00743.DC2.html
Permissions
https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X
eTOCs
Sign up for eTOCs at:
http://www.plantcell.org/cgi/alerts/ctmain
CiteTrack Alerts
Sign up for CiteTrack Alerts at:
http://www.plantcell.org/cgi/alerts/ctmain
Subscription Information
Subscription Information for The Plant Cell and Plant Physiology is available at:
http://www.aspb.org/publications/subscriptions.cfm
© American Society of Plant Biologists
ADVANCING THE SCIENCE OF PLANT BIOLOGY