Available online at www.sciencedirect.com
Molecular Immunology 45 (2008) 2352–2358
Bacterial DNA indicated as an important inducer of fish cathelicidins
Valerie Helene Maier a,∗ , Clemens Nikolaus Zeno Schmitt a ,
Sigridur Gudmundsdottir b , Gudmundur Hrafn Gudmundsson a
b
a Institute of Biology, University of Iceland, Sturlagata 7, 101 Reykjavik, Iceland
Institute for Experimental Pathology, University of Iceland, Keldur v. Vesturlandsveg, 112 Reykjavik, Iceland
Received 12 November 2007; accepted 16 November 2007
Available online 27 December 2007
Abstract
Cathelicidins are antimicrobial peptides indicated as important in the control of the natural microflora as well as in the fight against bacterial
invasion in mammals. Little is known about cathelicidins in fish and here the Chinook salmon (Oncorhynchus tshawytscha) embryo cell line
(CHSE-214) was used as a model system to study the expression of cathelicidins due to fish pathogenic bacteria. The cDNA of cathelicidin from
CHSE-214 cells (csCath) was cloned and shown to be closely related to gene 2 of both rainbow trout and Atlantic salmon. The deducted amino
acid sequence showed highest sequence identity to rtCath2 with 95% and 72% for the cathelin and the antibacterial part, respectively. Cathelicidin
gene expression was studied and various Gram positive and Gram negative bacteria caused the upregulation of the gene (csCath). Bacterial DNA
and protein were shown important for the induction of cathelicidin expression in these cells. LPS (Escherichia coli) also causes the upregulation of
cathelicidins, but digestion of the LPS with DNase I before incubation of the cells, totally abolished the upregulation of cathelicidin and suggests
DNA contamination in the LPS to be the trigger for this effect. These results could explain the limited responsiveness of fish cells towards pure
LPS and confirm previous suggestions that fish cells are less sensitive to LPS than mammalian cells.
© 2007 Elsevier Ltd. All rights reserved.
Keywords: Innate immunity; Cathelicidin; DNA; CHSE-214; Pathogen; Gene expression; LPS
1. Introduction
Antimicrobial peptides are important effectors of eukaryotic innate immunity. These peptides are usually cationic, often
amphipatic and kill bacteria by disrupting their cell membrane.
Several different classes of antibacterial peptides have been
described and one class are the cathelicidins. Cathelicidins have
been studied extensively in mammals, they are produced as prepro-peptides with a conserved cathelin pro-part and a varied
C-terminal peptide region which is cleaved off upon activation
(Zanetti et al., 2002). Mammalian cathelicidins are likely multifunctional, playing not only a role in antibacterial defenses,
but also in angiogenesis (Koczulla et al., 2003) and chemotaxis (Agerberth et al., 2000); stimulating growth of arteries
and recruiting cells of the adaptive immunity to the site of
Abbreviations: LPS, lipopolysaccharide; TLR, Toll-like receptors; Cath,
cathelicidin.
∗ Corresponding author. Tel.: +354 525 5230; fax: +354 525 4069.
E-mail address: [email protected] (V.H. Maier).
0161-5890/$ – see front matter © 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.molimm.2007.11.008
infection, respectively. Recently cathelicidins have been identified in birds (Lynn et al., 2004) and fish (Chang et al., 2005),
where less is known about their function. So far two cathelicidin genes (Cath1 and 2) have been found in both rainbow trout
(Oncorhynchus mykiss) (Chang et al., 2005; Goetz et al., 2004)
and Atlantic salmon (Salmo salar) (Chang et al., 2006). Infection
of rainbow trout with the fish pathogenic bacterium Aeromonas
salmonicida caused upregulation of Cath1 mRNA in various
tissues such as gills, spleen and head kidney, but expression of
Cath2 was constitutive (Chang et al., 2006). This expression pattern of cathelicidins in trout suggests an important role for the
cathelicidins and the derived peptides in innate immunity of fish.
A similar pattern of expression has been described in mammals for example in humans for the antimicrobial peptides
␤-defensins. Human ␤-defensin 1 (HBD-1) is known to be constitutively expressed, while expression of human ␤-defensin 2
(HBD-2) is induced by bacteria in the epithelium (Ganz, 2003).
Studies show that antibody production for salmonids takes
at least 4–6 weeks due to the adaptive immune response being
slow and temperature dependent (Ellis, 2001). This underlines
the importance of the innate immune system, as it is fast acting,
V.H. Maier et al. / Molecular Immunology 45 (2008) 2352–2358
and relatively temperature independent (Magnadottir, 2006). It
is therefore important to define the effector molecules and study
their induction and regulation in fish innate immunity.
In this study we demonstrated that cathelicidin can be
induced at the transcriptional level after infection of the Chinook
salmon (Oncorhynchus tshawytscha) embryo cell line (CHSE214) with different fish bacteria or commercial Escherichia coli
lipopolysaccharide (LPS). The induced expression indicates that
this cell line can be used as a model system to dissect signal
pathways important in innate immunity. We found that bacterial
DNA can stimulate cathelicidin transcription and that the upregulation of cathelicidin by LPS is due to DNA contamination in
the LPS used.
2. Materials and methods
2.1. Cell culture
The Chinook salmon (O. tshawytscha) embryo cell line
(CHSE-214) was cultured in MEM (Earles media containing
GlutaMAXTM -1 and 25 mM HEPES), supplemented with 10%
foetal bovine serum, 25 u/ml penicillin and 25 mg/ml streptomycin, non-essential amino acids and sodium bicarbonate (all
Gibco/Invitrogen). Briefly cells were grown at 20 ◦ C in closed
25 cm2 flasks for 2 days after passage and then transferred to
16 ◦ C for 3–5 days before using for the infections. Cells were
passaged at 2–3 week intervals.
2.2. Bacterial cultures and fractionation
The pathogenic fish bacteria species used in this study
were Icelandic isolates off: Moritella viscosa the cause of
winter ulcer, Yersenia ruckeri responsible for enteric redmouth
disease, A. salmonicida subsp. achromogenes that causes
atypical furunculosis and Vibrio anguillarum (serotype O2␣)
the bacterium responsible for vibriosis. We also used two Gram
positive, non-pathogenic bacteria: Bacillus megaterium (strain
Bm11) and a Lactobacillus species originally isolated from
Atlantic salmon. The bacteria were grown in either marine
broth or soy broth at 16–20 ◦ C for 20 h or more.
Measurements of optical density at OD600 were used to get an
approximate amount of bacteria and confirmed by plating serial
dilutions of the bacteria. The bacteria were collected by centrifugation and dissolved in an approximate volume of Na–PBS
(PBS containing 2% NaCl) or PBS. Bacteria were disrupted by
sonicating 10 times for 20 s at an amplitude of 70% using a Sonics (vibra cell) sonicator. The resulting lysate was named, total
lysate (TL). For the fractionation the lysed bacteria were spun
at 20,000 × g for 10 min at 4 ◦ C, the supernatant was spun again
for 5 min and the resulting supernatant was the cytosol fraction
(Cyt). The pellet from the first spin was washed, dissolved in
Na–PBS/PBS and named membrane fraction (M).
2.3. DNase I and protease treatment
The bacterial fractions were incubated with either DNase I
or pepsin as follows. For the DNase I treatment, the respec-
2353
tive fraction was incubated without (C1) or with (DNase I+)
500 kunits/ml DNase I (Boehringer) overnight at 37 ◦ C. Subsequently the completion of the DNA digest was compared to the
undigested sample by running it on a 1.2% agarose gel. The protein was digested using pepsin at a final concentration of 1 ␮g/␮l
in 5% formic acid for 5 h at 37 ◦ C on a shaker (pepsin+). Controls
(C2) were incubated without pepsin.
2.4. Cell line infections
CHSE-214 cells grown in 25 cm2 flasks were washed with
PBS and all treatments were performed in serum free media
without antibiotics. Three millilitres media were added to each
flask and bacteria equivalent to a multiplicity of infection of
10 bacteria per CHSE-214 cell were added. E. coli LPS (Fluka
#62325) was used at 50 ␮g/ml and treated with or without DNase
I as indicated. Unless otherwise stated, cell incubations were
performed for 24 h at 16 ◦ C and subsequently RNA was isolated.
2.5. RNA extraction and 3 RACE cloning
Total RNA was isolated from CHSE-214 cells with Trizol reagent (Invitrogen) using manufacture’s instructions. The
RNA pellet from one 25 cm2 flask of cells was dissolved
in 40 ␮l RNase-free water. DNA was removed by digesting the samples with DNase I (New England Biolabs) and
subsequently the RNA was precipitated with ethanol. Rapid
amplification of the cDNA 3 ends (3 RACE) was performed
in two steps, according to manufactures protocol (Invitrogen).
In the first step the oligo-dT adaptor primer (AP, provided
with the kit) was used to reverse transcribe the mRNA into
cDNA. The second step was a PCR reaction using a gene
specific forward primer (Atlantic salmon cathelicidin primer
5 TCTCTCCTCTTGCTCGCTGT) together with the provided
reverse AUAP primer, which targets the generated 3 tail. A
nested PCR was performed using a second Atlantic salmon
cathelicidin primer (5 AGAGGTCAGACCCAGACTGA) and
AUAP, as the forward and reverse primers, respectively. The
PCR reaction was analysed on a 1.75% TAE SeaPlaque GTG
agarose gel (Cambrex), the band of desired size cut out and
cleaned using ␤-agarase (Cambrex). The DNA was subsequently precipitated and cloned into the pCR8/GW/TOPO
vector (Invitrogen). Ten colonies were analysed by colony
PCR and plasmid of the positive clones were isolated and
checked further by enzymatic digest. Plasmids containing an
insert of correct size were sequenced using vector specific
primers (GW1 and GW2). The nucleotide sequence was translated using ExPASy translate tool and both nucleotide and
amino acid sequences were compared (using BioEdit Sequence
Alignment Editor and ClustalW programs) with previously
published salmonid cathelicidin sequences (NCBI, GenBank
accession numbers: rtCath 1 AY382478; rtCath 2 AY360356;
asCath 1 AY728057; asCath 2 AY360357 (Chang et al., 2005,
2006)). The sequence data presented in this study has been
deposited at NCBI GenBank: csCATH 2 cDNA accession number: EU241331.
2354
V.H. Maier et al. / Molecular Immunology 45 (2008) 2352–2358
2.6. RT-PCR
Total RNA from CHSE-214 cells incubated with bacteria
was isolated as described in Section 2.5. The RNA was
reverse transcribed using random primers according to the
manufactures protocol (Invitrogen superscript II), with the
exception of using half the amount of enzyme stated. In the
internal control, the reverse transcriptase was substituted
with water (-RT). PCR was performed using Ampli-Taq
(Biolabs) and the following cycling protocol: 94 ◦ C for 5 min
followed by 33 cycles of 94 for 45 s, 60 ◦ C for 45 s and
70 ◦ C for 1 min, with a final extension step of 10 min at
72 ◦ C. Primers used were either for Atlantic salmon cathelicidin (forward primer: 5 AGAGGTCAGACCCAGACTGA,
reverse primer: 5 TCCAGAATCGGATGTCTGAC) or
␤-actin (as described by Chang et al., 2005, forward
primer: 5 ATGGAAGATGAAATCGCC, reverse primer:
5 TGCCAGATCTTCTCCATG). The positive control used was
a vector containing salmon cathelicidin. As negative control the
template was substituted with water (−). PCR products were run
on a 1.2% agarose gel and visualised by staining with ethidium
bromide. Amplified bands were of predicted size and the identity
of two random PCR samples was confirmed by sequencing.
3. Results
3.1. Identification of the Chinook salmon cathelicidin
cDNA
In the present paper we examined the expression of a cathelicidin gene in response to bacterial infections in the Chinook
salmon embryo cell line, CHSE-214. This cell line has been used
for transfection studies (Hansen and Jorgensen, 2007), marine
fish virus propagation (Chen et al., 2005; Song et al., 2005) and
to study cytokine responses due to viral infections (Jensen et al.,
2002).
Chinook salmon cathelicidin was cloned from CHSE-214
cells that were stimulated with bacteria in order to increase the
amounts of transcribed cathelicidin mRNA. 3 RACE cloning
strategy was applied (Frohman, 1993), using primers for conserved sequences of Atlantic salmon cathelicidin. The obtained
sequence was not full length with respect to the 5 end due to
the method of cloning. Sequence alignments were performed
using ClustalW and BioEdit Sequence Alignment Editor programs (Fig. 1). Rainbow trout, as well as Chinook salmon belong
to the Oncorhynchus genus while Atlantic salmon is of the genus
Salmo. The nucleotide sequence of the cloned Chinook salmon
cathelicidin cDNA was compared to both the Atlantic salmon
and the rainbow trout cathelicidin cDNA 1 and 2 (Chang et al.,
2006). The CHSE-214 cathelicidin was named csCath and found
to be most closely related to cathelicidin gene 2 of both rainbow
trout and Atlantic salmon. Comparison of the predicted amino
acid sequence showed the CHSE-214 protein to be similar to
both rainbow trout and Atlantic salmon cathelicidin 2 (Fig. 2).
In rainbow trout the conserved sequence QKIRTRR is encoded
by exon IV and in vitro studies showed it to be the cleavage site
for exogenous elastase thereby releasing the C-terminal rtCath
peptide (Chang et al., 2006). This sequence is also found in our
putative protein and accordingly we have predicted the borders
between cathelin and mature peptide in the Chinook salmon
cathelicidin (arrows in Fig. 2). Sequence identities in the cathelin region for csCath compared to rtCath 2 and asCath 2 are 95%
and 88%, respectively while they are 72% and 53%, respectively
for the predicted antimicrobial peptide part. The predicted peptide for csCath is 47 amino acid long and made of 30% glycine
residues, it also contains many polar (21%) and charged residues
(21%) giving an overall net charge of +8.
3.2. Cathelicidin can be induced by Gram negative
bacteria in CHSE-214 and this induction is time-dependent
Several pathogenic, Gram negative, fish bacteria were used
to infect CHSE-214 cell cultures. RT-PCR analysis showed that
infection of CHSE-214 cells with Y. ruckeri caused upregulation of cathelicidin 4 h post infection and transcript levels stayed
constant over 24 h (Fig. 3). Infection with A. salmonicida subsp.
achromogenes or V. anguillarum also caused cathelicidin transcription and high levels of cathelicidin mRNA were detected
12–24 h after infection.
3.3. Fragments of Gram negative and Gram positive
bacteria can cause upregulation of cathelicidin in
CHSE-214 cells
In order to determine whether the pathway of cathelicidin
induction could be further dissected we investigated whether live
bacteria were needed for cathelicidin transcription. CHSE-214
cells were incubated with either the Gram negative M. viscosa or
the non-pathogenic Gram positive B. megaterium (strain Bm11).
Bacteria were sonicated (total lysate – TL) and crudely separated
into a membrane (M) and a cytosol (Cyt) fraction. We found that
sonicated bacteria as well as a cytosolic and membrane fraction
of the bacteria caused cathelicidin upregulation (Fig. 4A and B).
Live bacteria after sonication were not detected when the lysate
was plated out and grown for several days at 10 ◦ C (data not
shown). This illustrates that bacteria do not need to be alive to
affect cathelicidin transcription and that even bacterial fragments
can cause induction. It further illustrates that this mechanism is
not dependent on the pathogenic character of the bacteria and
that Gram positive bacteria also regulate cathelicidin expression.
3.4. Upregulation of cathelicidin in CHSE-214 cells is
caused by different bacterial components
To approach the nature of the inducing component, bacterial
lysates were treated with either DNase I or pepsin. Treatment
of CHSE-214 cells with A. salmonicida lysate caused upregulation of the cathelicidin transcript (Fig. 5). This upregulation
was abolished when the lysate was pre-treated with DNase I,
suggesting that the inducing component causing cathelicidin
upregulation was dependent on bacterial DNA (Fig. 5). Treatment with pepsin, in order to digest protein in the bacterial lysate,
prior to infection of the CHSE-214 cells caused the cathelicidin transcript level to be reduced compared to untreated lysate,
V.H. Maier et al. / Molecular Immunology 45 (2008) 2352–2358
2355
Fig. 1. Nucleotide sequence alignment of fish cathelicidin cDNAs. CHSE-214 cathelicidin (csCath) was aligned to rainbow trout (rtCath1 and rtCath2) and Atlantic
salmon (asCath1 and asCath2) cathelicidins, using ClustalW and BioEdit Sequence Alignment Editor programs. Identical nucleotides are indicated by points (.) in
the sequence and asterisks (*) in the consensus line. The borders between predicted coding regions for the signal peptide and cathelin and cathelin and the mature
peptide are indicated by arrows. Stop codons are indicated in bold. Note that the csCath sequence is not full length at the 5 end.
indicating that a protein component is also important for cathelicidin upregulation. Similar the upregulation of cathelicidin by
the Gram positive Lactobacillus sp. is caused by DNA and also
sensitive to pepsin treatment. Upregulation of cathelicidin RNA
by V. anguillarum bacterial lysate disappeared when the lysate
was treated over night at 37 ◦ C even in the absence of protease or
DNase I (C1). This indicates the autodigestion of DNA or a protein component and that this component was mainly responsible
for the cathelicidin upregulation by V. anguillarum. On the other
hand the effect of Y. ruckeri lysate on cathelicidin transcription
Fig. 2. Amino acid alignment of Chinook salmon cathelicidin (csCath) with rainbow trout (rt) and Atlantic salmon (as) cathelicidin 2. The predicted cleavage site
between the conserved cathelin and the mature antimicrobial peptide is indicated. Identical residues (indicated by asterisks) and similar residues (indicated by periods
or colons) identified by the ClustalW program are indicated. Identities between the sequences were calculated for the cathelin and the peptide region, respectively
as marked with arrows. Note that the signal sequence for csCath is not included. The predicted processing site for the cleavage by elastase is between the threonine
(T) and the arginine (R) residues of the QKIRTR sequence, thereby releasing the active peptide.
2356
V.H. Maier et al. / Molecular Immunology 45 (2008) 2352–2358
Fig. 3. Reverse transcription PCR for csCath in cells infected with different bacteria. CHSE-214 cells were infected with either Aeromonas salmonicida (A.s.),
Yersenia ruckeri (Y.r.), or Vibrio anguillarum (V.a.) for 4, 12 or 24 hours. As control (0) cells were treated with PBS alone. RNA was isolated, followed by RT-PCR
with either cathelicidin (A) or ␤-actin (B) primers. A plasmid clone of salmon cathelicidin was used as a template in the positive control (+). Negative controls (as
described in Section 2.6) gave no signal as expected.
Fig. 4. Transcription of cathelicidin in CHSE-214 cells due to Gram negative
and Gram positive bacteria. (A) Cells were incubated with the Gram negative
Moritella viscosa bacteria (B), sonicated bacteria (TL), membrane (M) fraction
or cytosol (Cyt) for 24 h. (B) CHSE-214 cells were treated with the Gram positive Bacillus megaterium (strain Bm11) bacteria (B), sonicated bacteria (TL) or
cytosol (Cyt) of for 24 h. Control (0) samples were treated with PBS alone. RNA
was isolated, followed by RT-PCR with either cathelicidin or ␤-actin primers.
Negative controls (as described in Section 2.6) gave no signal as expected.
was not affected by treatment of the bacterial lysate with DNase
I prior to infection of CHSE-214 cells, while pepsin treatment of
the lysate abolished the signal, suggesting a protein component
responsible for cathelicidin upregulation.
3.5. Bacterial DNA as an active inducer in LPS fractions
LPS is a constituent of Gram negative bacterial cell wall and
there has been some discussion on the responsiveness of fish
Fig. 6. (A) CHSE-214 cells were incubated for 24 h without (1), with 50 ␮g/ml
LPS (2) or with 50 ␮g/ml LPS digested for 12 h with DNase I (500 kunits/ml)
at 37 ◦ C (4). Control samples (3) were cells treated with LPS incubated for 12 h
at 37 ◦ C. RNA was isolated, followed by RT-PCR with either cathelicidin or
␤-actin primers as indicated. Negative controls for the reverse transcription step
(5) or the PCR (6) as indicated in Section 2.6. (B) Agarose gel of LPS (50 ␮g)
(2), LPS incubated for 12 h at 37 ◦ C (3) or LPS treated with DNase I for 12 h at
37 ◦ C (4).
to LPS (Iliev et al., 2005b). rtCath1 transcription is induced in
rainbow trout head kidney cells due to 10–100 ␮g/ml E. coli
LPS (Chang et al., 2005). Commercially bought E. coli LPS
has considerable concentrations of DNA (Fig. 6B) and this was
diminished after digestion of the LPS with DNase I (Fig. 6B lane
4). Incubation of CHSE-214 cells with LPS (50 ␮g/ml) caused
the upregulation of cathelicidin mRNA (Fig. 6A), but this signal
disappeared after treatment of the LPS with DNase I (Fig. 6A
lane 4), suggesting that the upregulation of cathelicidin by LPS
is due to DNA contamination in the preparation.
4. Discussion
Fig. 5. Incubation of CHSE-214 cells with different bacterial fractions. Sonicated bacteria (TL) were digested with DNase I or pepsin as indicated. Control
samples were incubated with PBS alone (0), with DNase I controls (C1) or pepsin
controls (C2). RNA was isolated, followed by RT-PCR with either cathelicidin
(A) or ␤-actin (B) primers. Negative controls (as described in Section 2.6) gave
no signal as expected.
Infections due to pathogenic bacteria cause major losses in
aquaculture. The bacteria used in the present study comprised
pathogenic as well as non-pathogenic species. Vaccination, as
a preventive method, has become increasingly important in fish
farming in the last decades (Sommerset et al., 2005). In vaccinated fish, as well as in natural infections, the antibody response
is slow and temperature dependent (Ellis, 2001). A competent
V.H. Maier et al. / Molecular Immunology 45 (2008) 2352–2358
innate immune system in fish is therefore crucial in the fight
against infections (Magnadottir, 2006). Furthermore one important element of the vaccination scheme may include stimulation
of innate immunity and hence it is important to understand this
system. So far little is known about the innate immune system
in fish. In this study we have looked at the regulation of the
antimicrobial peptide cathelicidin using the CHSE-214 cell line
as a model for the first line of defence in fish.
We have identified a novel cathelicidin in the Chinook salmon
cell line CHSE-214, named csCath according to the nomenclature of cathelicidins in fish. Comparison of csCath with other
salmonid cathelicidins reveals known features seen also in mammalian cathelicidins with a conserved cathelin region and a
variable peptide part (Durr et al., 2006; Tomasinsig and Zanetti,
2005).
The predicted protein of this cathelicidin contains the conserved QKITRR motif, which has been shown to be a target of
an elastase, in a heterologous system and is at the beginning
of the amino acid sequence encoded by exon IV (Chang et al.,
2006). This organisation of exon IV containing the processing
site, the antimicrobial peptide-coding sequence and the 3 UTR
is typical also for all mammalian cathelicidins (Tomasinsig and
Zanetti, 2005). The predicted csCath peptide is 47 amino acid
long, with large stretches of polar and charged residues (Fig. 2).
Isolation of the active peptide in vivo will reveal the actual processing site and length of the peptide. In mammals production
of several peptides through post-secretory processing has been
described (Murakami et al., 2004), but whether this is also the
case in fish, remains unsolved.
Upregulation of the mRNA for csCath was seen by both Gram
negative and Gram positive bacteria and was independent of the
viability of the bacteria. Synthetic rainbow trout cathelicidin
has been shown active against both Gram negative and positive
bacteria (Chang et al., 2006). Characterisation of the mature
peptide is now possible and will provide means to examine the
activity spectrum of this antimicrobial peptide. Studies in mouse
and humans have indicated cathelicidin to be multifunctional and
be a mediator between the innate and adaptive immune system
(Tomasinsig and Zanetti, 2005). The future aims include studies
of the in vivo action of cathelicidin and to determine whether
its activity lies solely as an antimicrobial peptide or also as a
chemokine.
In our study bacterial DNA and protein induced transcription of cathelicidin but this varied depending on the bacterial
species. Microbial products are recognised by the pattern recognition receptors (PRR) and the best characterised PRRs are
the Toll-like receptors (TLR) (Iwasaki and Medzhitov, 2004).
The different TLRs are known to recognise specific bacterial or
viral products. Bacterial lipoproteins, which are attached to the
peptidoglycan layer of both Gram negative and Gram positive
bacteria, for example are recognised by TLR2. LPS is recognised
by TLR4, bacterial flagellin by TLR5 and unmethylated CpG
DNA of bacteria or viruses by TLR9 (Iwasaki and Medzhitov,
2004). In addition to the membrane bound TLR9 most recently a
cytosolic DNA sensor has been described and called DAI (DNAdependent activator of IFN-regulatory factors) (Takaoka et al.,
2007), recognising bacterial as well as mammalian DNA. In fish
2357
members of most classes of TLR (Jault et al., 2004; Roach et
al., 2005) and proteins included in the downstream signalling
pathways (Purcell et al., 2006) have been found. According to
our data it is reasonable to predict DNA pattern recognition
connected to the induction of the first line of defence.
V. anguillarum is a flagellated bacterium and able to propel itself by beating the flagella. TLR5 activation by flagellin,
the main protein of the bacterial flagellum, is known to activate
inflammatory protein production in mammals (Steiner, 2007)
and fish (Tsujita et al., 2004). In our study the upregulation of
cathelicidin by V. anguillarum was abolished by incubating the
bacteria lysate at 37 ◦ C over night. This might be due to bacterial
proteases, present in the lysate, degrading some of the factors
which cause cathelicidin transcription. Y. ruckeri upregulation
of cathelicidin on the other hand was unaffected by this treatment and only affected by incubation of the bacterial lysate with
the protease pepsin. This suggests the inducing agent to be a
protein, but more stable and to some extent more resistant to
protease treatment than the protein which causes cathelicidin
upregulation by V. anguillarum.
Interestingly the inducing agent for both A. salmonicida and
Lactobacillus sp. was found to be bacterial DNA. Bacterial DNA
contains unmethylated CpG dinucleotides and these are known
to be recognised by TLR9 (Krieg, 2000; Magnusson et al., 2007).
Synthetic oligodeoxynucleotides (ODNs) containing the CpG
motif have been shown to induce interferon like cytokines and
IL-1␤ production in rainbow trout macrophages (Jorgensen et
al., 2001) and inhibitor studies indicated a role of TLR9 in this
activation. Further studies will be done to determine whether
the increased transcription of cathelicidin by A. salmonicida and
Lactobacillus sp. is due to signaling via TLR9.
LPS has been shown to cause cathelicidin upregulation in
rainbow trout head kidney cells after 4 h at 1–100 ␮g/ml concentrations (Chang et al., 2005). In our study LPS (E. coli) also
caused the upregulation of cathelicidin in CHSE-214 cells at
50 ␮g/ml, but this signal disappeared in the DNase I treated LPS,
suggesting DNA to be the real trigger for cathelicidin transcription. In general fish cells are about 1000 times less sensitive to
LPS than mammalian cells and commonly used concentration
are 5–500 ␮g/ml (Iliev et al., 2005a; MacKenzie et al., 2003;
Stafford et al., 2003; Zou et al., 2003). Several studies have
shown that there is a clear discrepancy in signal, between pure or
crude preparations of LPS (Iliev et al., 2005a; Purcell et al., 2006)
and it is possible that contaminants like CpG DNA in phenol
extracted LPS cause many of the downstream signals attributed
to LPS. The existence of TLR 4 in fish has been questioned
(Jault et al., 2004; Roach et al., 2005) and there are suggestions that there are profound differences in the LPS recognition
mechanism between mammals and trout macrophages (Iliev et
al., 2005a,b) further supporting the non-responsiveness of fish
to LPS via the TLR4 pathway. Our study supports this and suggests that many responses we see due to LPS in fish cells could
be due to contamination with bacterial DNA and maybe other
components. The limited effects documented so far with pure
LPS might therefore come through other signalling cascades.
In conclusion we have found that the upregulation of cathelicidin in the CHSE-214 cell line is caused by different bacterial
2358
V.H. Maier et al. / Molecular Immunology 45 (2008) 2352–2358
components, including bacterial DNA and protein and varies
between the bacterial species. In future it will be interesting
to dissect these pathways further in order to illustrate which
pathogen recognition receptors and which downstream signalling molecules are involved in cathelicidin upregulation in
fish.
Acknowledgements
We thank Eva Benediktsdóttir for provision of M. viscosa and
helpful discussion. We thank Zophonias Jonsson and Eduardo
Rodriguez for their help with this project. The project was supported by The Icelandic Centre for Research (RANNIS), the
University of Iceland Research Fund and the R&D Fund of
Ministry of Fisheries in Iceland (AVS).
References
Agerberth, B., Charo, J., Werr, J., Olsson, B., Idali, F., Lindbom, L., Kiessling,
R., Jornvall, H., Wigzell, H., Gudmundsson, G.H., 2000. The human antimicrobial and chemotactic peptides LL-37 and alpha-defensins are expressed
by specific lymphocyte and monocyte populations. Blood 96, 3086–3093.
Chang, C.I., Pleguezuelos, O., Zhang, Y.A., Zou, J., Secombes, C.J., 2005. Identification of a novel cathelicidin gene in the rainbow trout, Oncorhynchus
mykiss. Infect. Immun. 73, 5053–5064.
Chang, C.I., Zhang, Y.A., Zou, J., Nie, P., Secombes, C.J., 2006. Two cathelicidin
genes are present in both rainbow trout (Oncorhynchus mykiss) and Atlantic
salmon (Salmo salar). Antimicrob. Agents Chemother. 50, 185–195.
Chen, J., Sun, X., Zhang, L., Yi, X., Zhang, Y., 2005. Mass cultivation of marine
fish Chinook salmon embryo cells in bioreactor with low-serum medium.
Aquaculture 249, 35–45.
Durr, U.H., Sudheendra, U.S., Ramamoorthy, A., 2006. LL-37, the only human
member of the cathelicidin family of antimicrobial peptides. Biochim. Biophys. Acta 1758, 1408–1425.
Ellis, A.E., 2001. Innate host defense mechanisms of fish against viruses and
bacteria. Dev. Comp. Immunol. 25, 827–839.
Frohman, M.A., 1993. Rapid amplification of complementary DNA ends for
generation of full-length complementary DNAs: thermal RACE. Methods
Enzymol. 218, 340–356.
Ganz, T., 2003. Defensins: antimicrobial peptides of innate immunity. Nat. Rev.
Immunol. 3, 710–720.
Goetz, F.W., Iliev, D.B., McCauley, L.A., Liarte, C.Q., Tort, L.B., Planas, J.V.,
Mackenzie, S., 2004. Analysis of genes isolated from lipopolysaccharidestimulated rainbow trout (Oncorhynchus mykiss) macrophages. Mol.
Immunol. 41, 1199–1210.
Hansen, T.E., Jorgensen, J.B., 2007. Cloning and characterisation of p38 MAP
kinase from Atlantic salmon A kinase important for regulating salmon TNF-2
and IL-1beta expression. Mol. Immunol. 44, 3137–3146.
Iliev, D.B., Liarte, C.Q., MacKenzie, S., Goetz, F.W., 2005a. Activation of
rainbow trout (Oncorhynchus mykiss) mononuclear phagocytes by different pathogen associated molecular pattern (PAMP) bearing agents. Mol.
Immunol. 42, 1215–1223.
Iliev, D.B., Roach, J.C., Mackenzie, S., Planas, J.V., Goetz, F.W., 2005b. Endotoxin recognition: in fish or not in fish? FEBS Lett. 579, 6519–6528.
Iwasaki, A., Medzhitov, R., 2004. Toll-like receptor control of the adaptive
immune responses. Nat. Immunol. 5, 987–995.
Jault, C., Pichon, L., Chluba, J., 2004. Toll-like receptor gene family and TIRdomain adapters in Danio rerio. Mol. Immunol. 40, 759–771.
Jensen, I., Larsen, R., Robertsen, B., 2002. An antiviral state induced in Chinook
salmon embryo cells (CHSE-214) by transfection with the double-stranded
RNA poly I:C. Fish Shellfish Immunol. 13, 367–378.
Jorgensen, J.B., Zou, J., Johansen, A., Secombes, C.J., 2001. Immunostimulatory
CpG oligodeoxynucleotides stimulate expression of IL-1beta and interferonlike cytokines in rainbow trout macrophages via a chloroquine-sensitive
mechanism. Fish Shellfish Immunol. 11, 673–682.
Koczulla, R., von Degenfeld, G., Kupatt, C., Krotz, F., Zahler, S., Gloe, T.,
Issbrucker, K., Unterberger, P., Zaiou, M., Lebherz, C., Karl, A., Raake,
P., Pfosser, A., Boekstegers, P., Welsch, U., Hiemstra, P.S., Vogelmeier, C.,
Gallo, R.L., Clauss, M., Bals, R., 2003. An angiogenic role for the human
peptide antibiotic LL-37/hCAP-18. J. Clin. Invest. 111, 1665–1672.
Krieg, A.M., 2000. The role of CpG motifs in innate immunity. Curr. Opin.
Immunol. 12, 35–43.
Lynn, D.J., Higgs, R., Gaines, S., Tierney, J., James, T., Lloyd, A.T., Fares,
M.A., Mulcahy, G., O’Farrelly, C., 2004. Bioinformatic discovery and initial
characterisation of nine novel antimicrobial peptide genes in the chicken.
Immunogenetics 56, 170–177.
MacKenzie, S., Planas, J.V., Goetz, F.W., 2003. LPS-stimulated expression of a
tumor necrosis factor-alpha mRNA in primary trout monocytes and in vitro
differentiated macrophages. Dev. Comp. Immunol. 27, 393–400.
Magnadottir, B., 2006. Innate immunity of fish (overview). Fish Shellfish
Immunol. 20, 137–151.
Magnusson, M., Tobes, R., Sancho, J., Pareja, E., 2007. Cutting edge: natural DNA repetitive extragenic sequences from Gram-negative pathogens
strongly stimulate TLR9. J. Immunol. 179, 31–35.
Murakami, M., Lopez-Garcia, B., Braff, M., Dorschner, R.A., Gallo, R.L., 2004.
Postsecretory processing generates multiple cathelicidins for enhanced topical antimicrobial defense. J. Immunol. 172, 3070–3077.
Purcell, M.K., Smith, K.D., Hood, L., Winton, J.R., Roach, J.C., 2006. Conservation of Toll-like receptor signaling pathways in teleost fish. Comp. Biochem.
Physiol. Part D Genomics Proteomics 1, 77–88.
Roach, J.C., Glusman, G., Rowen, L., Kaur, A., Purcell, M.K., Smith, K.D.,
Hood, L.E., Aderem, A., 2005. The evolution of vertebrate Toll-like receptors. Proc. Natl. Acad. Sci. U.S.A. 102, 9577–9582.
Sommerset, I., Krossoy, B., Biering, E., Frost, P., 2005. Vaccines for fish in
aquaculture. Expert Rev. Vaccines 4, 89–101.
Song, H., Santi, N., Evensen, O., Vakharia, V.N., 2005. Molecular determinants
of infectious pancreatic necrosis virus virulence and cell culture adaptation.
J. Virol. 79, 10289–10299.
Stafford, J.L., Ellestad, K.K., Magor, K.E., Belosevic, M., Magor, B.G., 2003.
A Toll-like receptor (TLR) gene that is up-regulated in activated goldfish
macrophages. Dev. Comp. Immunol. 27, 685–698.
Steiner, T.S., 2007. How flagellin and Toll-like receptor 5 contribute to enteric
infection. Infect. Immun. 75, 545–552.
Takaoka, A., Wang, Z., Choi, M.K., Yanai, H., Negishi, H., Ban, T., Lu, Y.,
Miyagishi, M., Kodama, T., Honda, K., Ohba, Y., Taniguchi, T., 2007. DAI
(DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune
response. Nature 448, 501–505.
Tomasinsig, L., Zanetti, M., 2005. The cathelicidins—structure, function and
evolution. Curr. Protein Pept. Sci. 6, 23–34.
Tsujita, T., Tsukada, H., Nakao, M., Oshiumi, H., Matsumoto, M., Seya, T., 2004.
Sensing bacterial flagellin by membrane and soluble orthologs of Toll-like
receptor 5 in rainbow trout (Onchorhynchus mikiss). J. Biol. Chem. 279,
48588–48597.
Zanetti, M., Gennaro, R., Skerlavaj, B., Tomasinsig, L., Circo, R., 2002. Cathelicidin peptides as candidates for a novel class of antimicrobials. Curr. Pharm
Des. 8, 779–793.
Zou, J., Secombes, C.J., Long, S., Miller, N., Clem, L.W., Chinchar, V.G., 2003.
Molecular identification and expression analysis of tumor necrosis factor in
channel catfish (Ictalurus punctatus). Dev. Comp. Immunol. 27, 845–858.