From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
Prothrombin Greenville, Arg 517 =Gln, Identified in an Individual Heterozygous
for Dysprothrombinemia
By R.A. Henriksen, C.K. Dunham, L.D. Miller, J.T. Casey II, J.B. Menke, C.L. Knupp, and S.J. Usala
A 64-year-old white male was referred for evaluation of
prolonged prothrombin time (PT) and activated partial thromboplastin time (aPTT) obtained before elective surgery with
initial PT and PTT results of 14.9 and 38.4 seconds, respectively, which corrected to normal in 1:1 mixes with normal
plasma. Functional prothrombin assay indicated a level of
51% with thromboplastin as an activator. The prothrombin
antigen was 102%. This discordance in the functional and
immunologic prothrombin levels was evidence for dysprothrombinemia. Western blotting showed that thrombin was
formed at a normal rate in diluted plasma consistent with a
mutation within the thrombin portion of prothrombin. DNA
was isolated from leukocytes and the thrombin exons were
amplified by polymerase chain reaction, cloned, and sequenced. For exon 13, eight clones were sequenced with
four clones showing a point mutation in the codon for Arg517,
which would result in substitution by Gln. Arg517 is part of
the Arg-Gly-Asp(RGD) sequence in thrombin and contributes
to an ion cluster with aspartic acid residues 552 and 554.
Mutation at this residue most probably distorts the structure
of the Na1 binding site in thrombin. This is the first report
indicating the critical role of Arg517 in the normal physiological interaction of thrombin with fibrinogen. This dysprothrombin is designated Prothrombin Greenville.
r 1998 by The American Society of Hematology.
P
ships. Because of the several interactions of thrombin with other
proteins, there are numerous surface residues that may be
implicated in these interactions, the mutation of which may
result in decreased function. Both the congenital and other
site-specific mutants of thrombin together with knowledge of
the thrombin crystal structure12 have contributed to our understanding of critical features required for normal thrombin
function. Some features of thrombin that are known to regulate
its activity include the catalytic triad residues, primary substrate
binding site, anion binding exosite I (which interacts with
fibrinogen and the thrombin receptor/substrate), anion binding
exosite II, the heparin binding site, the thrombomodulin binding
site, and the more recently identified Na1 binding site.13,14
The studies described here were undertaken to determine an
explanation for the observed low functional prothrombin level
in a patient who was evaluated for abnormal prothrombin and
partial thromboplastin times before elective surgery. DNA
sequencing showed that the patient was heterozygous for
dysprothrombinemia and normal prothrombin with identification of a G=A transition in exon 13 that predicts a substitution
of Gln for Arg517(187) (Residues of thrombin are numbered
according to the prothrombin sequence15 with the chymotrypsinogen numbering12 in parentheses). As reported previously,16
this residue forms part of an ionic cluster in thrombin that is
adjacent to the Na1 ion ligands.13
ROTHROMBIN, M.W. 72,000, is the plasma glycoprotein
zymogen form of the enzyme thrombin, a critical enzyme
in the regulation of hemostasis with both procoagulant and
anticoagulant activities. In addition, thrombin also stimulates
cellular activation through a cell surface thrombin receptor. The
gene for prothrombin is located on an autosomal chromosome
at 11p11-q121 and severe (homozygous) deficiencies with
phenotypic manifestations are encountered only rarely. In cases
of heterozygosity, functional deficiencies in prothrombin of
50% or less do not result in physiological manifestations and
they are not usually detected by the routine screening tests for
coagulation factor deficiency, the prothrombin time (PT), or the
activated partial thromboplastin time (aPTT). Thus, although
mutations resulting in dysprothrombinemia and hypoprothrombinemia may occur with a frequency approximating that of
hemophilia,2 these mutations are not readily identified. Because
of its functional importance, mutations in prothrombin that
result in alterations of thrombin function are of particular
interest. Congenitally mutant thrombins have been identified
previously in eight pedigrees with the primary structure defect
identified for six distinct mutations.3-11 All of these mutants
have been identified because of decreased fibrinogen clotting
activity, the thrombin function that is monitored in clinical
coagulation tests.
Site-specific mutants of proteins are of great value in
increasing our understanding of structure-function relation-
MATERIALS AND METHODS
From the Section of Allergy, Asthma and Immunology, the Section of
Hematology, and the Section of Endocrinology, Department of Medicine, East Carolina University, Greenville, NC.
Submitted July 18, 1997; accepted November 5, 1997.
Supported by National Institutes of Health Grant No. HL 45194 (to
R.A.H.). R.A.H. is an Established Investigator of the American Heart
Association.
Presented at the American Society for Hematology Annual Meeting,
Seattle, WA, December 5, 1995 (Blood 86:71a, 1995).
Address reprint requests to R.A. Henriksen, PhD, Department of
Medicine, East Carolina University, Greenville, NC 27858-4354.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1998 by The American Society of Hematology.
0006-4971/98/9103-0032$3.00/0
2026
Reagents. Fibrinogen from KabiVitrum was purchased from Helena Laboratories (Beaumont, TX). Phospholipid was obtained as rabbit
brain cephalin from Sigma Chemical Co (St Louis, MO) and a stock
solution was prepared according to the manufacturer’s directions.
Taipan venom from Oxyuranus scutellatus was obtained from Miami
Serpentarium Laboratories (Punta Gorda, FL), and Echis carinatus
venom was obtained from Sigma Chemical Co. Dade factor assay
reference plasma for preparation of prothrombin standard curves was
obtained from Scientific Products (McGaw Park, IL). The chromogenic
substrate, tos-Gly-Pro-Arg-pNA (Chromozym TH) was obtained from
Boehringer Mannheim Biochemicals (Indianapolis, IN). Oligonucleotides were prepared by the DNA core laboratory, East Carolina
University (Greenville, NC). The restriction enzyme Mnl I was obtained
from Amersham Life Science (Arlington Heights, IL). Other chemicals
were obtained from domestic suppliers.
Blood specimens for plasma and DNA. Phlebotomy was performed
after obtaining informed consent. For coagulation assays, plasma was
Blood, Vol 91, No 6 (March 15), 1998: pp 2026-2031
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
PROTHROMBIN GREENVILLE, ARG517=GLN
Table 1. Oligonucleotide Primers Used in Amplification
of Prothrombin Exons
Exon
8
9
10
11
12
13
14
Oligonucleotide
58 TGCCTGGGTCCCAACAGAGGA 38
58 CCTCGGATGCCCACTACCTCA 38
58 CCTCACTGCTTGGCTTGCTCT 38
58 AATGGTAGCGCAGGGCTCCAGGA 38
58 TACGAATTCTCATCCTCAGCTCCTAATGC 38
58 AGACACCCACGGGCCACCAGTT 38
58 TTCTCCATTTCTTTCTTGGGGT 38
58 TCAGCTAACAAGCATCTGGTGGC 38
58 TCTCACTAGGCCCTTCTTCCTTC 38
58 ATCGGATCCTTGAACCCAGGCACAACTCA 38
58 CTTGAATTCTCACCAGCTGTGTCTCGTGA 38
58 AGGCCCTGGGCTTTAGAGAAGCT 38
58 GCCTGGCAGAGGAATACTGATGT 38
58 TTTGGATCCTGGGAGCATTGAGGCTCGCT 38
obtained from citrated whole blood, subjected to a second centrifugation at 10,000g and stored in aliquots at 280°C. For isolation of DNA,
whole blood was anticoagulated with acid citrate dextrose solution (A).
Coagulation assays. Prothrombin assays were performed by one
stage assay with either taipan venom2,17 or Echis carinatus venom18 as
activators and fibrinogen as substrate. The chromogenic substrate
tos-Gly-Pro-Arg-pNA was used in a two-stage assay and prothrombin
activation was accomplished with a taipan venom activator reagent
consisting of 0.2 mg/mL taipan venom in 0.1 mol/L NaCl, 0.04 mol/L
Tris—HCl, pH 7.5, 2 mmol/L Ca21, and rabbit brain cephalin at 1/5
dilution of the stock solution. For activation, 0.1 mL of the activator
reagent was incubated with 0.1 mL of plasma diluted in 0.1 mol/L NaCl,
0.05 mol/L Tris—HCl, and pH 7.5. After 1.0 minute incubation at 37°C,
100 µL of the incubation mixture was transferred to 1.1 mL 0.1 mol/L
NaCl, 0.05 mol/L Tris—HCl, and pH 8.3 containing 0.14 mmol/L
tos-Gly-Pro-Arg-pNA. The rate of substrate hydrolysis was monitored
at 405 nm. Percent activity was determined from a standard curve
prepared with factor assay reference plasma. Other coagulation assays
were performed by established clinical laboratories.
Western blotting for prothrombin. Plasma samples from the proband and a normal individual were diluted 1/30 with 0.1 mol/L NaCl,
0.05 mol/L Tris—HCl, and pH 7.5 and treated with one half volume of
the taipan venom activator reagent containing 3 mmol/L Ca21. Samples
were incubated at 37°C and at 30, 60, and 600 seconds 100-µL aliquots
were added to a 25-µL electrophoresis sample solution, 0.24 mol/L
Tris—HCl, pH 6.8, 5 mmol/L EDTA, and 8% sodium dodecyl sulfate.
Electrophoresis on 12% polyacrylamide gels was performed as described19 without reduction of disulfide bonds. After electrophoresis,
proteins were transferred to nitrocellulose. The membrane was blocked
with 5% nonfat dry milk in phosphate buffered saline, pH 7.4. The
primary antibody was polyclonal goat antihuman prothrombin antiserum obtained from ICN (Costa Mesa, CA). The secondary antibody was
peroxidase conjugated rabbit antigoat IgG (Sigma Chemical Co) with
detection by enhanced chemiluminescence (Amersham Life Science).
DNA sequencing. DNA was isolated from leukocytes after proteinase K digestion.20 Thrombin exons were amplified by the polymerase
chain reaction (PCR) with primers derived from the adjacent noncoding
regions of the prothrombin gene. The primers were modified from those
used previously8 and are listed in Table 1. Temperature conditions for
PCR of all exons were denaturation, 1 minute at 94°C; annealing, 1
minute at 55°C; and extension, 2 minutes at 72°C for 30 cycles. PCR
amplified DNA fragments for the proband were purified by electrophoresis and cloned by using the Original TA Cloning Kit Ver 2.0 from
Invitrogen (San Diego, CA). DNA sequencing was performed by the
dideoxy method.21 Sequences were read manually and compared with
2027
the published prothrombin gene sequence.22 Both coding and noncoding strands were sequenced.
Restriction fragment length polymorphism analysis. Restriction
enzyme digestion of PCR amplified prothrombin exon 13 was performed with Mnl I. Hydrolysis was monitored by electrophoresis on 2%
agarose gel with ethidium bromide staining. The reaction mixtures were
incubated at 37°C for a total of 7 hours to ensure complete hydrolysis.
RESULTS
Case report. The proband was a 64-year-old white male
referred to the East Carolina University School of Medicine
Hematology/Oncology Clinic for evaluation of an increased PT
and aPTT obtained before elective surgery for a right rotator
cuff repair. He had no prior history of significant bleeding or
bruising and had undergone previous herniorrhaphy, right heel
surgery, traumatic amputation of the distal portions of two
fingers, and multiple tooth extractions without significant
bleeding or the need for blood transfusions. There was no
history of liver disease. Diet was normal with only remote use
of small amounts of alcohol. No family history of abnormal
bleeding was noted. Physical examination was not remarkable
for jaundice, hepatosplenomegaly, or signs of chronic liver
disease. No ecchymoses or evidence of recent bleeding was
present. No joint deformities or evidence of hemarthrosis was
noted. Limitation of motion of the right shoulder was present
because of the rotator cuff injury. Laboratory studies performed
by a reference laboratory before referral indicated a low
prothrombin activity with normal factor V and X activity levels.
The laboratory results of the hemostasis evaluation were as
follows with normal ranges in parenthesis: platelets 220 (150 440) 3 103/µL, bleeding time 3.2 (2.5 - 9.5) minutes, PTT 14.9
(11.6 - 13.2) seconds, and for a 1:1 mix with control plasma
12.3 seconds, aPTT 38.8 (22.6 - 33.0) seconds and for a 1:1 mix
with control plasma 32.5 seconds, fibrinogen 2.73 (2.00 - 4.00)
mg/mL. Values obtained for factor assays with .50% considered normal were as follows: factor V 90%, factor VII 73%,
factor IX 64% and factor X 101%. The prothrombin activity
assay was 51% (normal .50%) in a one-stage assay with
thromboplastin as the activator. In contrast the prothrombin
antigen was 102% with a normal range of 75% to 130%.
Fibrinogen was the substrate for all factor assays. Dilute
Russell’s viper venom time, antinuclear antibody, and anticardiolipin antibody panel testing were normal indicating that a lupus
anticoagulant was not present.
The normal values for the vitamin K-dependent coagulation
factors other than prothrombin indicate that the low prothrombin level was not caused by vitamin K deficiency. Thus, the
discordance between the prothrombin antigen and activity
assays indicates the presence of dysprothrombinemia in this
otherwise healthy individual. The dysprothrombin has been
designated Prothrombin Greenville. Because the surgeon did
not wish to risk bleeding complications, and because the
prothrombin activity was at or near the hemostatic threshold,
the patient was given fresh frozen plasma in the perioperative
period. The surgery was successfully completed with no
unusual bleeding noted.
Additional prothrombin assays. To further characterize the
dysprothrombin identified in the proband, additional prothrombin assays were performed with venom activators and both
fibrinogen and tos-Gly-Pro-Arg-pNA as thrombin substrates.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2028
The results of these assays are presented as mean 6 standard
deviation for three separate assays: one-stage assay with Echis
carinatus venom as activator and fibrinogen as substrate 36% 6
1%, one-stage assay with taipan venom/PL/Ca21 as activator
and fibrinogen as substrate 50% 6 2%, and two-stage assay
with the latter activator and tos-Gly-Pro-Arg-pNA as substrate
76% 6 4%. The taipan venom assay with fibrinogen as
substrate, 50%, was similar to the 51% obtained initially with
thromboplastin as activator. If the dysprothrombinemia were
the consequence of a mutation in the activation peptide or a
defect preventing hydrolysis of the Arg271(2)-Thr bond of
prothrombin, it was predicted that activation by Echis carinatus
venom would yield a normal thrombin level.23,24 This was not
observed, which suggests that the molecular defect is within the
thrombin portion of the molecule. When a chromogenic substrate was used in a two-stage assay, the prothrombin activity
for the proband was greater than observed with fibrinogen as
substrate. This result suggested that the defect in the predicted
dysthrombin probably affected thrombin-fibrinogen interaction
to a greater extent than the interaction with a low molecular
weight substrate. However, there is apparently also some defect
in catalysis by the dysthrombin because the activity toward
tos-Gly-Pro-Arg-pNA is not equivalent to that expected for the
observed antigen level.
Prothrombin activation and Western blotting. To further
examine the nature of the defect in the dysprothrombin, the time
course of prothrombin cleavage was determined by Western
blotting. The results following activation of diluted whole
plasma by taipan venom and electrophoresis on a nonreducing
gel shown in Fig 1, indicate that prothrombin is cleaved at a
Fig 1. Prothrombin activation determined by Western blotting.
The activation of prothrombin in diluted whole plasma and Western
blotting were performed as described in the Materials and Methods.
The location and size of molecular weight standards is indicated on
the left. The activation reaction was stopped at the time in seconds
indicated at the top of the figure. Prothrombin, a glycoprotein is seen
corresponding to the molecular weight marker 97.2 kD. The lane
marked thr is purified thrombin and serves as a marker for this
product. The band just above the 50 kD marker that appears after
activation is prethrombin-1 and the decreased amount seen in the
proband (P) is consistent with the decreased thrombin activity in this
sample. C indicates control plasma. The lower molecular weight
bands seen primarily at 600 seconds correspond to the activation
peptides, fragment 1, and fragment 2. The highest molecular weight
band in this unreduced sample corresponds to cross-reacting human
IgG present in the plasma. The other bands present both before and
after activation are not identified.
HENRIKSEN ET AL
similar rate for both the proband and the control and that the
products for both have similar molecular weights. A mutation at
Arg271 would result in an activation defect and approximately
half of the total prothrombin in this apparently heterozygous
individual should have remained as the higher molecular weight
proteins, meizothrombin (with the same molecular weight as
prothrombin), or prethrombin 1 at the end of the incubation
period. A mutation at Arg320(16) would result in the accumulation
of prethrombin 2 (uncleaved thrombin A and B chains). Under
reducing conditions, prethrombin 2 should appear at a higher
molecular weight than the thrombin heavy chain. Electrophoresis performed under reducing conditions indicated conversion
of all prothrombin to thrombin (results not shown). Thus, the
results are consistent with the presence of a dysthrombin. This
dysthrombin was predicted to be the consequence of a point
mutation because of the similar molecular weights for prothrombin and its hydrolysis products obtained from plasma of the
control and the proband.
DNA sequencing. Attempted screening of PCR products for
the thrombin exons was not successful in identifying a point
mutation. Because the proband was expected to be heterozygous for a dysprothrombin, at least six clones were sequenced
for each exon to verify the presence of a unique point mutation.
The following list gives the number of the prothrombin exon
with the number of clones sequenced indicated in parenthesis: 8
(7), 9 (6), 10 (14), 11 (12), 12 (11), 13 (8), and 14 (8). The
nucleotide at position 8908 in exon 1022 was C in all the clones
that were sequenced as originally reported for the human
prothrombin cDNA sequence.15 This does not result in an amino
acid substitution. For exon 13, 4 of 8 clones sequenced yielded a
transitional mutation at nucleotide 19777 corresponding to a
codon change from CGA to CAA at amino acid residue
517(187), which results in an Arg=Gln mutation. The finding
of 50% normal sequences confirms that the proband is heterozygous for the mutation. The results for sequencing two clones for
exon 13 amplified from DNA of the proband are shown in Fig 2.
A mutation at Arg517(187), a surface residue that forms part of an
ionic cluster16 in thrombin, has not been previously reported.
This region of thrombin, which is near the base of the primary
substrate binding pocket, has not been specifically associated
with the interaction of thrombin with fibrinogen.
Structural consequences of the Arg517(187)=Gln mutation.
The mutated arginine residue in this dysprothrombin is a part of
an RGD sequence in thrombin. However, the aspartic acid
residue of this sequence is located at the base of the primary
substrate binding pocket and neither this residue nor the
adjacent glycine are accessible to the molecular surface, which
makes it unlikely that this sequence contributes to binding
interactions in native thrombin.16 The ionic cluster formed by
Arg517(187) with Asp552(221) and Asp554(222) is shown schematically in Fig 3. A Na1 binding site that contributes to optimal
coagulant activity and involves an adjacent region of thrombin
has been identified13,25 in which one of the Na1 ligands is
provided by the carbonyl oxygen of Arg553(221A). Examination of
the thrombin structure indicates that the correct positioning of
this Na1 ligand must depend on formation of the ionic cluster
between the two adjacent aspartic acid residues and Arg517(187).
Thus, in Thrombin Greenville, where this ionic interaction is
lost because of the substitution of the positively charged
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
PROTHROMBIN GREENVILLE, ARG517=GLN
2029
Fig 2. Results of DNA sequencing. Nucleotide
sequence for a portion of two clones obtained for
prothrombin exon 13, which was amplified by PCR
from DNA of the proband. Sequencing was by the
dideoxy method of Sanger.21 The asterisk (*) indicates the mutated amino acid residue.
arginine residue by the neutral residue glutamine, there is most
probably a significant perturbation of the structure of the Na1
binding site, which appears to result in an enzyme lacking
significant fibrinogen clotting activity as indicated by the
functional prothrombin assays. Previous results from Di Cera’s
laboratory26,27 indicate that in the absence of Na1 the rate of
release of fibrinopeptide A by thrombin is decreased to a greater
extent than is the hydrolysis of the low molecular weight substrate
H-D-Phe-pipecolyl-Arg-p-nitroanilide. Similarly, the results obtained here for the prothrombin assays suggest that structural
features associated with the ionic cluster around Arg517(187) are
apparently less critical for the normal hydrolysis by thrombin of
the low molecular weight substrate tos-Gly-Pro-Arg-pNA than
for the release of fibrinopeptide A from fibrinogen.
Restriction enzyme digestion. Sequence analysis of the
normal and Prothrombin Greenville nucleotide sequences identified an Mnl I restriction site in the normal sequence that was
lost from Prothrombin Greenville. The recognition sequence for
Mnl I is CCTC. The recognition sequence on the complemen-
Fig 3. Structure of thrombin showing location of mutated ionic
cluster. Ribbon structure for thrombin is shown as produced by the
RasMol modeling program with coordinates obtained from the
Brookhaven database. Side chains are shown at the bottom left for
residues Arg517(187) marked by the arrow head, Asp552(221), and Asp554(222).
In this view the active site serine residue is located at the center,
anion binding exosite I extends across the center right, and anion
binding exosite II is along the upper left edge.
tary strand, GAGG corresponds to the prothrombin gene coding
sequence for nucleotides 19777 to 19780 in exon 13. The
Prothrombin Greenville mutation converts this sequence to
AAGG resulting in the loss of the Mnl I restriction cleavage site.
The PCR amplified exon 13 for the proband and several family
members were subjected to Mnl I digestion. The results shown
in Fig 4 indicate that in the proband and one son, digestion of
this fragment is incomplete, which is consistent with the loss of
the Mnl I restriction site as predicted by the observed mutation
and the expected heterozygosity for this mutation. Figure 5
shows the pedigree for the proband with prothrombin assays for
several family members. These results are consistent with the
findings obtained by Mnl I digestion.
DISCUSSION
The dysprothrombin identified in these studies has been
designated Prothrombin Greenville for the North Carolina
location where this mutant protein was characterized. It was
anticipated that a dysthrombin with decreased fibrinogen clotting activity would have an altered residue associated with
either the catalytic triad residues, anion binding exosite I, or the
primary substrate binding pocket as has been observed with
other dysthrombins.2 This did not appear to be the case for the
Fig 4. Restriction digest with Mnl I. The mutation identified in
Prothrombin Greenville predicts the loss of an Mnl I restriction site
where the sequence GAGG in the normal is the enzyme recognition
site. This site is converted to AAGG in the mutant. Exon 13 for the
proband and five family members was amplified by PCR and subjected to digestion with Mnl I. Hydrolysis was continued for 7 hours at
37°C. Additional enzyme was added to samples for lanes 3, 4, and 6
after 6 hours of hydrolysis to ensure complete hydrolysis. Shown are
the final hydrolysis products after agarose gel electrophoresis and
ethidium bromide staining. Lane numbers correspond to samples
obtained from individuals shown in the pedigree (Fig 5). Shown in the
lane at left is a 100-base pair ladder.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2030
HENRIKSEN ET AL
Fig 5. Pedigree for Prothrombin Greenville. The upper numbers beside the numbered symbols are prothrombin antigen levels as percent and
the lower numbers are percent prothrombin activity obtained after activation by Echis carinatus venom with fibrinogen as the substrate.
Shading indicates heterozygotes. ND, not determined; 1, proband; \ , deceased. Individuals without assay values were not studied.
mutation that we identified, so other structural features were
examined in an attempt to relate the identified mutation to
defective fibrinogen clotting activity. Examination of the results
of structural studies of thrombin13,25 suggest that this mutation
most probably affects the Na1 binding site. Binding of Na1 at
this site is proposed to participate in the regulation of the
procoagulant and anticoagulant forms of thrombin in which
fibrinogen or protein C are the respective thrombin substrates.14
This is the first report of a dysthrombin in which the Na1
binding site appears to be the locus of the mutation. These
findings are also consistent with a critical structural role for the
ionic cluster involving residues 517 (187), 552 (221), and 554
(222) located on the surface of thrombin. From comparison of
the prethrombin 2 and thrombin structures, it was proposed25
that this ionic cluster is a crucial driving force for the structural
rearrangement that occurs in this region of thrombin on
cleavage of the thrombin A and B chains to yield the active
enzyme thrombin. This structural rearrangement results not
only in formation of the Na1 binding site by positioning one of
the Na1 ligands, R553 (221A), but also results in a shift of the
position of D519 (189) at the base of the primary substrate
(arginine) binding pocket. It is probable that improper positioning of D519 (189) also contributes to the functional defect
observed in Thrombin Greenville. This ionic cluster is not
conserved in the primary structure of other serine proteases,13
although it is conserved in bovine thrombin as is the Arg that
provides a Na1 ligand corresponding to Arg 553(221A) of
human thrombin.28 A related mutant thrombin with the sequence Ala552(221)ArgLys has been prepared by recombinant
DNA methods. In this mutant, the allosteric effect of Na1 is lost
with the result that the kinetics for release of fibrinopeptide A
are similar in the presence and absence of Na1.13 It appears that
this latter mutant has a relatively greater activity in the release
of fibrinopeptide A than does Thrombin Greenville. As with
other dysprothrombins that have been reported, this dysprothrombin was identified because of its decreased fibrinogen clotting
activity. This heterozygous defect does not appear to have
resulted in any phenotypic manifestation in the proband. There
is no history of either excessive bleeding or thrombosis in the
proband.
The G=A transitional mutation has most probably arisen on
the noncoding DNA strand where the sequence CpG occurs, a
sequence that has been identified as a mutational ‘‘hot spot.’’
These mutations are thought to arise when a methylcytosine is
deaminated and then recognized as a T with the result that A is
incorporated on the complementary strand during DNA replication. Other dysthrombins that have arisen by a similar mechanism are Tokushima3 and Quick I.4
The identification of individuals heterozygous for dysprothrombinemia is somewhat fortuitous because they are not
generally manifested by prolonged coagulation screening tests.
For Prothrombin Greenville, the dysthrombin may have been
inhibitory contributing to the prolonged PT and aPTT tests or
the mildly decreased factor VII and factor IX levels in
combination with the low prothrombin level may have resulted
in the prolonged times.29
Further characterization of the enzymatic activity of this
mutant thrombin will require isolation of Prothrombin Greenville from plasma or the expression of the mutant protein by
recombinant DNA techniques. These studies are currently
planned and will permit a more definitive analysis of the role of
the ionic cluster formed around Arg517(187) in normal thrombin
function.
ACKNOWLEDGMENT
The authors thank the proband and his family for their generous
cooperation in making this study possible, Dr Bruce D. Wilhelmsen for
referring the proband to us for further study, and Scott Eaves for
performing the Western blotting studies after prothrombin activation.
REFERENCES
1. Royle NJ, Irwin DM, Koschinsky ML, MacGillivray RTA,
Hamerton JL: Human genes encoding prothrombin and ceruloplasmin
map to 11p11-q12 and 3q21-24, respectively. Somat Cell Mol Genet
13:285, 1987
2. Henriksen RA: Identification and characterization of mutant
thrombins. Methods Enzymol 222:312, 1993
3. Miyata T, Morita T, Inomoto T, Kawauchi S, Shirakami A,
Iwanaga S: Prothrombin Tokushima, a replacement of arginine-418 by
tryptophan that impairs the fibrinogen clotting activity of derived
Thrombin Tokushima. Biochemistry 26:1117, 1987
4. Henriksen RA, Mann KG: Identification of the primary structural
defect in the dysthrombin, Thrombin Quick I: Substitution of Cys for
Arg-382. Biochemistry 27:9160, 1988
5. Henriksen RA, Mann KG: Substitution of valine for glycine-558
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
PROTHROMBIN GREENVILLE, ARG517=GLN
in the congenital dysthrombin Thrombin Quick II alters primary
substrate specificity. Biochemistry 28:2078, 1989
6. Rabiet MJ, Jandrot-Perrus M, Boissel JP, Josso F: Thrombin Metz:
Characterization of the dysfunctional thrombin derived from a variant
of human prothrombin. Blood 63:927, 1984
7. Miyata T, Aruga R, Umeyama H, Bezequd A, Guillin M-C,
Iwanaga S: Prothrombin Salakta: Substitution of glutamic acid-466 by
alanine reduces the fibrinogen clotting activity and the esterase activity.
Biochem J 31:1457, 1992
8. Morishita E, Saito M, Kumabashiri I, Asakura H, Matsuda T,
Yamaguchi K: Prothrombin Himi: A compound heterozygote for two
dysfunctional prothrombin molecules (Met-337=Thr and Arg388=His). Blood 80:2275, 1992
9. Rabiet MJ: Prothrombin Molise: A mutant prothrombin characterized by a defect in the thrombin domain. Thromb Haemost 54:46, 1985
(abstr)
10. Degen SJF, McDowell SA, Sparks LM, Scharrer I: Prothrombin
Frankfurt: A dysfunctional prothrombin characterized by substitution of
Glu-466 by Ala. Thromb Haemost 73:203, 1994
11. O’Marcaigh AS, Nichols WL, Hassinger NL, Mullins JD,
Mallouh AA, Gilchrist GS, Owen WG: Genetic analysis and functional
characterization of Prothrombins Corpus Christi (Arg382-Cys), Dhahran
(Arg271-His), and hypoprothrombinemia. Blood 88:2611, 1996
12. Bode W, Mayr I, Baumann RH, Huber R, Stone SR, Hofsteenge
J: The refined 1.9 Å crystal structure of human a-thrombin: Interaction
with D-Phe-Pro-Arg-chloromethylketone and significance of the Tyr-ProPro-Trp insertion segment. EMBO J 8:3467, 1989
13. Di Cera E, Guinto ER, Vindigni A, Dang QD, Ayala YM, Wuyi
M, Tulinsky A: The Na1 binding site of thrombin. J Biol Chem
270:22089, 1995
14. Dang QD, Guinto ER, Di Cera E: Rational engineering of
activity and specificity in a serine protease. Nature Biotechnol 15:146,
1997
15. Degen SJF, MacGillivray RTA, Davie EW: Characterization of
the complementary deoxyribonucleic acid and gene coding for human
prothrombin. Biochemistry 22:2087, 1983
16. Bode W, Turk D, Karshikov A: The refined 1.9-Å X-ray crystal
structure of D-Phe-Pro-Arg chloromethylketone-inhibited human a-
2031
thrombin: Structure analysis, overall structure, electrostatic properties,
detailed active-site geometry, and structure-function relationships.
Protein Sci 1:426, 1992
17. Denson KWE, Borrett R, Biggs R: The specific assay of
prothrombin using taipan snake venom. Br J Haematol 21:219, 1971
18. Sakuragawa N, Takahashi K, Hoshiyama M, Jimbo C, Matsuoka
M, Onishi Y: Significance of a prothrombin assay method using Echis
carinatus venom for diagnostic information in disseminated intravascular coagulation syndrome. Thromb Res 7:643, 1975
19. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680, 1970
20. Usala SJ, Bale AE, Gesundheit N, Weinberger C, Lash RW,
Wondisford FE, McBride OW, Weintraub BD: Tight linkage between
the syndrome of generalized thyroid hormone resistance and the human
c-erbAb gene. Mol Endocrinol 2:1217, 1988
21. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain
terminating inhibitions. Proc Natl Acad Sci USA 74:5463, 1977
22. Degen SJF, Davie EW: Nucleotide sequence of the gene for
human prothrombin. Biochemistry 26:6165, 1987
23. Diuguid DL, Rabiet M-J, Furie BC, Furie B: Molecular defects
of Factor IX Chicago-2(Arg 145=His) and Prothrombin Madrid(Arg
271=Cys): Arginine mutations that preclude zymogen activation.
Blood 74:193, 1991
24. Guillin M-C, Bezeaud A, Rabiet M-J, Elion J: Congenitally
abnormal prothrombin and thrombin. Ann NY Acad Sci 485:56, 1986
25. Zhang E, Tulinsky A: The molecular environment of the Na1
binding site of thrombin. Biophys Chem 63:185, 1997
26. Dang Q, Vindigni A, Di Cera E: An allosteric switch controls the
procoagulant and anticoagulant activities of thrombin. Proc Natl Acad
Sci USA 92:5997, 1995
27. Wells CM, Di Cera E: Thrombin is a Na1-activated enzyme.
Biochemistry 31:11721, 1992
28. MacGillivray RTA, Davie EW: Characterization of bovine
prothrombin mRNA and its translation product. Biochemistry 23:1626,
1984
29. Burns ER, Goldberg SN, Wenz B: Paradoxic effect of multiple
mild coagulation factor deficiencies on the prothrombin time and
activated partial thromboplastin time. Am J Clin Pathol 100:94, 1993
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1998 91: 2026-2031
Prothrombin Greenville, Arg517→Gln, Identified in an Individual
Heterozygous for Dysprothrombinemia
R.A. Henriksen, C.K. Dunham, L.D. Miller, J.T. Casey II, J.B. Menke, C.L. Knupp and S.J. Usala
Updated information and services can be found at:
http://www.bloodjournal.org/content/91/6/2026.full.html
Articles on similar topics can be found in the following Blood collections
Hemostasis, Thrombosis, and Vascular Biology (2485 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.